ID: 955674188

View in Genome Browser
Species Human (GRCh38)
Location 3:61433382-61433404
Sequence GTTTTTAAGGTGATAGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955674186_955674188 -9 Left 955674186 3:61433368-61433390 CCAGTTACAGAGATGTTTTTAAG No data
Right 955674188 3:61433382-61433404 GTTTTTAAGGTGATAGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955674188 Original CRISPR GTTTTTAAGGTGATAGAGCA AGG Intergenic
No off target data available for this crispr