ID: 955680892

View in Genome Browser
Species Human (GRCh38)
Location 3:61500684-61500706
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955680889_955680892 30 Left 955680889 3:61500631-61500653 CCAGGTTTTTATAGTTCAGAGTC No data
Right 955680892 3:61500684-61500706 AGATTTTTATATATGGTGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr