ID: 955685273

View in Genome Browser
Species Human (GRCh38)
Location 3:61543139-61543161
Sequence CATTGTGAACAGAGTGTACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955685273_955685274 5 Left 955685273 3:61543139-61543161 CCTTGTACACTCTGTTCACAATG No data
Right 955685274 3:61543167-61543189 ACTATCCATTGTGTTATCATTGG No data
955685273_955685277 29 Left 955685273 3:61543139-61543161 CCTTGTACACTCTGTTCACAATG No data
Right 955685277 3:61543191-61543213 TGCCTACTGTCTGTCTCCTTGGG No data
955685273_955685276 28 Left 955685273 3:61543139-61543161 CCTTGTACACTCTGTTCACAATG No data
Right 955685276 3:61543190-61543212 TTGCCTACTGTCTGTCTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955685273 Original CRISPR CATTGTGAACAGAGTGTACA AGG (reversed) Intergenic
No off target data available for this crispr