ID: 955688788

View in Genome Browser
Species Human (GRCh38)
Location 3:61570044-61570066
Sequence GTGTGGTAATGGAGGGAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 249}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955688783_955688788 0 Left 955688783 3:61570021-61570043 CCTCTTCTCAGGCTTTATGGACA 0: 1
1: 0
2: 0
3: 9
4: 155
Right 955688788 3:61570044-61570066 GTGTGGTAATGGAGGGAAATAGG 0: 1
1: 0
2: 0
3: 28
4: 249
955688780_955688788 15 Left 955688780 3:61570006-61570028 CCTCAGATGTTAATTCCTCTTCT 0: 1
1: 0
2: 4
3: 28
4: 312
Right 955688788 3:61570044-61570066 GTGTGGTAATGGAGGGAAATAGG 0: 1
1: 0
2: 0
3: 28
4: 249
955688778_955688788 22 Left 955688778 3:61569999-61570021 CCTGCACCCTCAGATGTTAATTC 0: 1
1: 0
2: 1
3: 9
4: 112
Right 955688788 3:61570044-61570066 GTGTGGTAATGGAGGGAAATAGG 0: 1
1: 0
2: 0
3: 28
4: 249
955688779_955688788 16 Left 955688779 3:61570005-61570027 CCCTCAGATGTTAATTCCTCTTC 0: 1
1: 0
2: 0
3: 22
4: 229
Right 955688788 3:61570044-61570066 GTGTGGTAATGGAGGGAAATAGG 0: 1
1: 0
2: 0
3: 28
4: 249
955688777_955688788 28 Left 955688777 3:61569993-61570015 CCTAGTCCTGCACCCTCAGATGT 0: 1
1: 0
2: 0
3: 12
4: 201
Right 955688788 3:61570044-61570066 GTGTGGTAATGGAGGGAAATAGG 0: 1
1: 0
2: 0
3: 28
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955688788 Original CRISPR GTGTGGTAATGGAGGGAAAT AGG Intronic
900091338 1:922056-922078 GTGTGGTTAAGGAGGGGCATGGG - Intergenic
902336690 1:15758526-15758548 GGGTGGGAATGGGGGGGAATGGG - Intronic
902658396 1:17885154-17885176 GTGTGTTAATGGAGGGGGAGAGG + Intergenic
903415680 1:23181166-23181188 GTGTAGTAATGAAGGGCAAAGGG + Intergenic
903549661 1:24149181-24149203 GTGTGGGGATGGAGGGAGGTGGG + Intergenic
905283810 1:36866247-36866269 GTGTGGTAATTGAGGTCAATGGG - Intronic
906708867 1:47914644-47914666 ATTTGGCAATGGAGGGAAAGAGG - Intronic
908730053 1:67216903-67216925 GTTTGGTAGAGGAGGGAAATGGG - Intronic
908732489 1:67240604-67240626 GTGTAGTAAAGGAGAGAAATGGG - Intronic
909373044 1:74909112-74909134 GTGGGGTAAAGGTGGGAGATAGG - Intergenic
909574858 1:77162445-77162467 TTGGGAGAATGGAGGGAAATTGG + Intronic
910853456 1:91670831-91670853 ATGATGTGATGGAGGGAAATTGG + Intergenic
911426219 1:97716612-97716634 GTGTGGTGATGGAGGGATCTAGG - Intronic
912602873 1:110955966-110955988 GTGTTGCAATGGAAGGAGATAGG - Intronic
913991702 1:143619060-143619082 GTGTGGGAATGTAGAGCAATGGG - Intergenic
914227125 1:145729789-145729811 GTGTGGAAATGGAGTGAGAATGG - Intronic
914746656 1:150506260-150506282 GGGCGGTAAGGGAGGGAAAGGGG - Intronic
915976218 1:160391308-160391330 ATGAGGTAATGGAGTGAGATGGG + Intergenic
921790407 1:219283476-219283498 GTGTGGAAAGGGATGGAAAGTGG + Intergenic
922201788 1:223409229-223409251 GGGTGGAAATGGAGGAAAGTGGG + Intergenic
922577846 1:226674758-226674780 GTGAGGAAAAGGAGGCAAATAGG - Intronic
923016180 1:230128273-230128295 GTGTGGTTATGAAGGAAAACAGG + Intronic
923071587 1:230570111-230570133 GTGAGGATATGGAGAGAAATTGG - Intergenic
923312713 1:232751305-232751327 GGGTGGTAATGGAGTGAACTTGG - Intergenic
1063514219 10:6678384-6678406 GTGTGGTAATGGAGCCAGAAGGG - Intergenic
1064638966 10:17396399-17396421 GTGTAGCCATGGAGGGAACTGGG - Intronic
1065747677 10:28857176-28857198 GTGTGGTGATGGAGAGAAGTGGG - Intronic
1068825910 10:61438787-61438809 ATGTGGTAAGGGAGGAAAAGTGG - Intronic
1070127158 10:73631811-73631833 TTATGGGAATGGAGGGAAAAAGG - Exonic
1070809068 10:79288497-79288519 GTGTGTTGGGGGAGGGAAATTGG - Intronic
1073518139 10:104097630-104097652 GTGAAGTAATGGGGGGAAGTGGG - Intergenic
1074370800 10:112899302-112899324 GTGTGGTTAGGGAGAGAACTGGG - Intergenic
1075360688 10:121830222-121830244 GTGTGGTAGTGTTGGGAGATGGG + Intronic
1077936401 11:6792101-6792123 GTTTTTTAATGAAGGGAAATAGG + Intergenic
1077980217 11:7292523-7292545 GTGTGGAGTTGGAGGGGAATGGG - Intronic
1078645223 11:13135906-13135928 CTGTGTTTATGCAGGGAAATGGG - Intergenic
1078717428 11:13853492-13853514 GTGTGGTAATTGCAGGAAATGGG + Intergenic
1078924455 11:15861380-15861402 GTGTGGGCATGGAGTGCAATGGG - Intergenic
1079280214 11:19080544-19080566 GAGGAGTAATGGAGGGAGATTGG - Intergenic
1079702286 11:23563708-23563730 GTGTGGTTTGGGAGGGAAATTGG - Intergenic
1079712591 11:23705119-23705141 GTGTGGCAATGTTGGGAGATGGG - Intergenic
1080756122 11:35200932-35200954 GCATGGAAATGGAGGGAAAGCGG - Intronic
1081282483 11:41226803-41226825 GTTTGATTGTGGAGGGAAATAGG - Intronic
1081534557 11:43987549-43987571 GTCTGGGAATGGAGGGAAGCAGG + Intergenic
1082696146 11:56367266-56367288 GTATGGAAAAGGAGGGAGATGGG - Intergenic
1084067885 11:66715802-66715824 CTGTGGTCATGAAGGGAAGTGGG - Intronic
1085160430 11:74338253-74338275 GGGCCGTAAAGGAGGGAAATGGG + Intronic
1085272206 11:75277085-75277107 CTTTGGTTATGGAAGGAAATGGG - Intronic
1085610703 11:77945970-77945992 CTGTGGCTATGTAGGGAAATGGG - Intronic
1085630751 11:78114567-78114589 AGGTGGTAATGGGGGAAAATGGG + Intronic
1086971585 11:93086458-93086480 GTGTGGGAATTAAGGGAGATGGG + Intergenic
1087726664 11:101725914-101725936 GAGAGGAAAGGGAGGGAAATAGG + Intronic
1090130617 11:124137730-124137752 GTGGGGTCAGGGAGAGAAATGGG - Intronic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1092085793 12:5758416-5758438 GTGGGGCTGTGGAGGGAAATAGG - Intronic
1092516324 12:9218126-9218148 GTGAGGAAAGGGTGGGAAATGGG + Intergenic
1093838657 12:23868690-23868712 GGGTGGGAATGAAGGGATATGGG - Intronic
1095888552 12:47214420-47214442 GTGCTGTAAGGGAGGGAAAATGG + Intronic
1096248842 12:50013663-50013685 GTGTGGGACTTGAGGGAAATAGG - Intronic
1097759986 12:63452395-63452417 GGGTAGGAATAGAGGGAAATGGG + Intergenic
1098718388 12:73861658-73861680 GTGTGGGGATGGCGCGAAATGGG + Intergenic
1100129537 12:91474383-91474405 TTGTGTTGATGGAGGTAAATAGG - Intergenic
1101508483 12:105370778-105370800 TTGTGGTAATAGAAGGGAATTGG + Exonic
1103046885 12:117743367-117743389 ATGTGCTCCTGGAGGGAAATGGG + Intronic
1103217948 12:119217821-119217843 GTCTGGTAAGGGAGGGAAGTAGG - Intronic
1103554350 12:121757104-121757126 GTGTGGCAAGGGAGGGAGCTCGG + Intronic
1103948772 12:124540795-124540817 GGGTGGATATGGAGGGGAATGGG + Intronic
1103949082 12:124541725-124541747 GAGTGGAACTGGAGGGAGATGGG + Intronic
1107148702 13:37087708-37087730 ATGTGGAAATGGAGGCAAATTGG + Intergenic
1111149584 13:84232509-84232531 ATGTGGGAATGGAGGGAACAGGG + Intergenic
1111999844 13:95199897-95199919 GCGTGGTAGTGGAGAGAGATGGG - Intronic
1112435261 13:99387341-99387363 GGGTGGTGATGGAGGGAGAGTGG - Intergenic
1112542551 13:100329949-100329971 GTGTTGTTATGGAGAAAAATTGG - Intronic
1113599300 13:111557437-111557459 GAGTGGTGATGGAGAGAAAATGG + Intergenic
1115157844 14:30360566-30360588 GTGTGGAAATGAAGGGAAGGAGG + Intergenic
1116499958 14:45608368-45608390 GTGTGGTAGTGGGAGGGAATGGG + Intergenic
1120844892 14:89117037-89117059 TTGTGGACAGGGAGGGAAATTGG - Intergenic
1121141110 14:91543363-91543385 GTGTGCAGCTGGAGGGAAATGGG - Intergenic
1122133088 14:99617521-99617543 GTGGGGAAAGGGAGGGGAATCGG + Intergenic
1122412623 14:101533731-101533753 GTGTGGTGAGGGAGGGAGAGTGG + Intergenic
1124071381 15:26396269-26396291 GTGCTGGACTGGAGGGAAATTGG + Intergenic
1124990129 15:34664932-34664954 ATGTGGTAATGGTGGGAGGTGGG + Intergenic
1126464615 15:48950609-48950631 CAGTGGGGATGGAGGGAAATGGG + Intronic
1129311017 15:74708994-74709016 GTGTGGTAGTGGAGGCAGACGGG - Intergenic
1129601377 15:77000562-77000584 GTGGGGAAATGGAGAAAAATAGG + Intronic
1131565427 15:93481013-93481035 GTCTGGTAAAGTAGGGAATTGGG - Intergenic
1135159429 16:20080593-20080615 GTGTGGGGATGGAGGGCATTTGG - Intergenic
1136021768 16:27445098-27445120 GGGTGGGCATGGTGGGAAATGGG - Intronic
1140882306 16:79209981-79210003 GCATGATAATGGAGGGAGATTGG + Intronic
1141191846 16:81830787-81830809 GTGTGATAGTGGAGGGGGATGGG + Intronic
1142941400 17:3382581-3382603 GTGGGGTCAGGGAGGAAAATAGG - Intergenic
1143316009 17:6033963-6033985 TGGTGGTAGTGGAGGGAATTGGG + Intronic
1143706201 17:8699133-8699155 GTGTGGTCCAGGAGGGAGATAGG + Intergenic
1143727480 17:8859391-8859413 GTGTGCTAATGGTGGGCCATAGG - Intronic
1145374586 17:22335631-22335653 GTGGGGAAATGGAGGGATATGGG + Intergenic
1145888783 17:28400328-28400350 AAATGGGAATGGAGGGAAATAGG + Exonic
1146155603 17:30521838-30521860 ATGAGGAAAGGGAGGGAAATGGG + Intronic
1146833154 17:36088156-36088178 GAGGTGAAATGGAGGGAAATTGG - Intergenic
1146847675 17:36194769-36194791 GAGGTGAAATGGAGGGAAATTGG - Intronic
1147458135 17:40551493-40551515 GCGTGGCAATGCAGGGATATTGG - Intergenic
1147685980 17:42287265-42287287 GAGTGGAAATGGAGAGAAAAGGG + Intergenic
1147887908 17:43696970-43696992 GTGAGAGAATGAAGGGAAATGGG - Intergenic
1148344886 17:46896705-46896727 GTCTGCAGATGGAGGGAAATAGG - Intergenic
1149781252 17:59398181-59398203 GTGTGGTGAGGGAGGGGACTGGG + Exonic
1155114397 18:22750324-22750346 CAGTGATAATGGAGGAAAATAGG - Intergenic
1155595424 18:27480579-27480601 ATTTGGGAATGGAGGGAAACCGG + Intergenic
1155641785 18:28026307-28026329 GTTTGGTAATGGAGAGTAAAAGG - Intronic
1156396622 18:36705181-36705203 GTGTGTTGATGGAGGGATCTGGG - Intronic
1157395389 18:47336772-47336794 GTGTGGACAGGGAGGGAAGTGGG + Intergenic
1159173425 18:64802906-64802928 GTGTGGTATTGGAGAGGAACAGG + Intergenic
1159637868 18:70827365-70827387 GTGAGGTGATGCAGGGAATTAGG + Intergenic
1159684614 18:71402590-71402612 GTGAGGTTAAGGAGGGAAAGAGG - Intergenic
1165953299 19:39486687-39486709 GTGTGGGAGTGGGGGGAAATGGG + Intronic
1166882204 19:45936431-45936453 GTGTGGACATGGAGCTAAATTGG - Exonic
1167087749 19:47321877-47321899 GTGTGGGGGTGGAGGGAAGTGGG - Exonic
1168182380 19:54671176-54671198 GTGCAGAAATGCAGGGAAATAGG - Intronic
1168573309 19:57488112-57488134 GGGTGGCAATGGAGGGCAAGGGG + Intronic
1168574726 19:57500242-57500264 GGGTGGCAATGGAGGGCAAGGGG + Intronic
925459511 2:4048286-4048308 CTTTTGTAATGGATGGAAATTGG + Intergenic
925689537 2:6506876-6506898 GTGGGGCAATGGAGAGAAAGCGG + Intergenic
926027934 2:9560889-9560911 CTGTGGAACTGGAGGGTAATTGG - Intergenic
926997147 2:18748265-18748287 ATATAGTAATGGAGGGAAAAAGG - Intergenic
927689235 2:25196001-25196023 GTGTGGTAGTGGTGGGGAATAGG - Intergenic
928144198 2:28757041-28757063 GGGAGGGAATGGAGAGAAATGGG - Intronic
931092053 2:58896704-58896726 GTGTGGGTGTGGAGGGAAATGGG - Intergenic
931925346 2:67066301-67066323 GTGTGGCATGGGAGGGAAAGTGG - Intergenic
931928081 2:67096984-67097006 GTGTGGTAATGGAGAGGATCTGG + Intergenic
933343636 2:81054134-81054156 GTGTGGTAATCAAGTGAACTGGG - Intergenic
933413393 2:81952766-81952788 GTTTGGAAATGGAGGGAAAGAGG + Intergenic
934859126 2:97749365-97749387 GTGTGGGAAAGGAGGGAGATGGG + Intergenic
935182114 2:100700747-100700769 CTGGGGTGATGGAGGGACATCGG - Intergenic
935431259 2:102978322-102978344 GTGCTGAAATGCAGGGAAATTGG - Intergenic
937131372 2:119516564-119516586 GGGTGGGAATGGAGAGATATAGG + Intronic
938721260 2:134069181-134069203 GTGTGGGACTGGTTGGAAATTGG - Intergenic
939601234 2:144193368-144193390 GTGTAGTAATGGATTAAAATAGG - Intronic
939631488 2:144531291-144531313 GTGTGGGATTGGAGGGGAAAGGG - Intergenic
939999679 2:148954514-148954536 GGGTGGTAATAAAGGGAAAGAGG + Intronic
940825383 2:158406323-158406345 GGATGGCAATGGAGAGAAATGGG + Intronic
940839607 2:158564623-158564645 GTGAGGAACTGGGGGGAAATGGG - Intronic
942033335 2:171986190-171986212 GTGTGAGAAGGGAGGGAAAAAGG + Intronic
945689153 2:213010689-213010711 CTTTGGTAATGGAGAGAACTAGG + Intronic
947280333 2:228445479-228445501 GGGTGGTACTGGAAGGACATTGG - Intergenic
947292890 2:228597316-228597338 GTGTGGTAAGTGAAGGAAATAGG + Intergenic
1170064501 20:12296055-12296077 GTGTGGGAATGAAGAGAGATTGG - Intergenic
1171310755 20:24143077-24143099 GTCTGGTGATGGAGGCAAATGGG - Intergenic
1173628597 20:44492388-44492410 GTGTGGTGTCGGAAGGAAATGGG + Exonic
1173801906 20:45899384-45899406 GTCAGGTAATGGAGGGCACTGGG + Intronic
1175982192 20:62744175-62744197 GTGTGGGAAAGGAAGCAAATTGG - Intronic
1182392818 22:30013415-30013437 GTGTGGTCATGGGGAGAACTCGG + Exonic
1182521006 22:30884557-30884579 GTGTGGTGCTTGAGGGAGATGGG + Intronic
1184799831 22:46752656-46752678 GTGTGGCACTGGATGGAAAGAGG + Intergenic
950037031 3:9893673-9893695 AAGGGGTAATGGATGGAAATGGG - Exonic
952494533 3:33904276-33904298 GTGTGGTAGTGTTGGGAGATGGG + Intergenic
952845125 3:37681815-37681837 GTGAGGAGATGGAGGGAAATGGG - Intronic
952996788 3:38890832-38890854 GTGTGTGAATGGAGGGGGATAGG + Intronic
953639008 3:44688228-44688250 GGGTGGTAATGGGGGGAATAGGG - Intergenic
955688788 3:61570044-61570066 GTGTGGTAATGGAGGGAAATAGG + Intronic
957940551 3:86997377-86997399 GTGAGGTGATGGAGCAAAATAGG - Intergenic
958586123 3:96090571-96090593 GTGAGGATATGGTGGGAAATTGG + Intergenic
959820657 3:110731108-110731130 TTGTGGTAATGCAAGAAAATTGG + Intergenic
959822108 3:110747978-110748000 GTGGGGTAGTGGAAAGAAATGGG - Intergenic
960923665 3:122774637-122774659 GTGTGGGAAGGGAGGGCAAGGGG + Intronic
960953037 3:123011955-123011977 ATGTGGTGTTGGAGGGAGATTGG - Intronic
963603753 3:147397400-147397422 GTGGGGTGAGGGAGGGAAAGAGG - Intronic
964625866 3:158759317-158759339 GTGTGGTATTGGGGGAAATTGGG + Intronic
964764765 3:160169318-160169340 GTGTGGGAATGGGGAGGAATAGG - Intergenic
966133002 3:176665838-176665860 GTGTGGATATGGAGGAAAAGTGG - Intergenic
966591478 3:181688294-181688316 GTATGGGAAAGGAGAGAAATGGG + Intergenic
968975179 4:3818469-3818491 GTGTGTTTATGGATGGAACTGGG + Intergenic
969706368 4:8794324-8794346 GGGTGGGAATGGAGGGACAGAGG + Intergenic
971593734 4:28500424-28500446 TTGTGGTAGTTGAGAGAAATTGG + Intergenic
971714246 4:30154779-30154801 GTTTGGTAATGGTGGTAAGTAGG - Intergenic
972358455 4:38304062-38304084 GGGTGGAGAGGGAGGGAAATGGG + Intergenic
972393335 4:38634052-38634074 GAGTGGAAATGAAGAGAAATGGG - Intergenic
973381369 4:49323045-49323067 GGGGAGTAATGGAGTGAAATTGG - Intergenic
975706959 4:77121180-77121202 AAGTGGTAATGGAGGGATACGGG + Intergenic
976143076 4:82013306-82013328 TTGTGGTAATGTTAGGAAATGGG + Intronic
976616864 4:87086920-87086942 GTGTTGTAATGAAGGGGAAGTGG + Intronic
978504552 4:109442312-109442334 GTGGGGTAAAGCAGGGGAATAGG + Intronic
979791073 4:124781562-124781584 CTGTGGTAGGGGTGGGAAATGGG + Intergenic
980007134 4:127555518-127555540 CTGTGGAAATGGAGAGAAATTGG + Intergenic
981445722 4:144836199-144836221 TTGTGGTAATGTAGAGAAAAGGG - Intergenic
981474357 4:145173559-145173581 GTGTGGTAGAGAAGGGAAGTGGG - Intronic
981723330 4:147823380-147823402 GTGTGGAAAGGGAGAGAACTTGG + Intronic
983019463 4:162656837-162656859 GTGTGATAAAGGCCGGAAATGGG + Intergenic
983813926 4:172098990-172099012 GTGTGTTTATTGAGGGAATTTGG + Intronic
984240802 4:177217335-177217357 ATGGGGTAATGGAGGCAATTTGG - Intergenic
984842694 4:184082810-184082832 GTGAAGTAATTGAGGGAAAATGG + Intergenic
984843003 4:184085541-184085563 GGGTGGTAGTGGGAGGAAATGGG + Intergenic
986333940 5:6738855-6738877 CTGTGGTTACAGAGGGAAATTGG + Intronic
986777191 5:11026871-11026893 TTGAGGTAATGCAGGGAAACAGG + Intronic
987961357 5:24813559-24813581 GGGTGGTAATGGTGGGAATAAGG + Intergenic
988399742 5:30747516-30747538 CTGTGGCAATAGAGGGAAATAGG - Intergenic
990213200 5:53502643-53502665 GTGTGGTAATGGGGGGTGAGGGG + Intergenic
990998443 5:61757331-61757353 GTCTGGGAAGAGAGGGAAATGGG + Intergenic
993724975 5:91356450-91356472 CAATGGTAATGGAGGGAAACGGG + Intergenic
995299250 5:110558545-110558567 GTGTGGTAAGGCAGGGACCTGGG + Intronic
995385563 5:111585092-111585114 CTGTGAGAATGCAGGGAAATAGG + Intergenic
995522156 5:113018990-113019012 GTGTGGTTCTAGAGTGAAATGGG + Exonic
995522885 5:113027485-113027507 AGGTGGGAATGAAGGGAAATTGG + Intronic
995648519 5:114341266-114341288 GTGCTGTAAAGAAGGGAAATTGG + Intergenic
995815258 5:116160119-116160141 GTCTAGTAAAGGAGGCAAATGGG - Intronic
996117789 5:119636787-119636809 CTGTGGTAATAGAGGAAATTTGG - Intronic
996846863 5:127909215-127909237 GTGTGGTGAGGCAGTGAAATTGG - Intergenic
997689739 5:135819585-135819607 GGATGGGAATGGAGGGAAAATGG + Intergenic
998871038 5:146551969-146551991 ATGTGGTGATGGGAGGAAATGGG - Intergenic
999362468 5:150997637-150997659 CTTTGGAAATTGAGGGAAATTGG - Intergenic
999713164 5:154336676-154336698 GGGTGGGACTGGAGGGGAATTGG - Intronic
999916417 5:156267543-156267565 CTGTGCTCAGGGAGGGAAATTGG - Intronic
1002761855 6:208691-208713 GTGTGGAAATGGAAGCAAACAGG + Intergenic
1002791611 6:441488-441510 GTGTGGGAATGGAGGGCTGTGGG - Intergenic
1003912106 6:10752275-10752297 GTGTTGGAAAGGAGGGAAACAGG - Intronic
1004331630 6:14727207-14727229 GTATGGGGGTGGAGGGAAATAGG + Intergenic
1006497134 6:34431870-34431892 CTGTGGTGATGGAGAGTAATGGG + Intergenic
1006523812 6:34587598-34587620 GGGTGGCCATGGTGGGAAATGGG - Exonic
1006609570 6:35286098-35286120 GAGTGGAAATAGAGAGAAATGGG - Intronic
1008546611 6:52589073-52589095 GTGTGGAAAGGAAGGGAAAGGGG - Intergenic
1009422163 6:63475340-63475362 GGGTGGTAATAGAGGGCAATTGG - Intergenic
1009600914 6:65797973-65797995 GTGTGGGGATGGAGCAAAATTGG + Intergenic
1010566327 6:77418443-77418465 GTGTGTTAATTAAGGGCAATAGG + Intergenic
1012465896 6:99515739-99515761 GGAGGGTAACGGAGGGAAATCGG - Intronic
1012646460 6:101689748-101689770 GTGTGGGAATGGAGAAAAGTGGG - Intronic
1012932300 6:105329900-105329922 GTGTGGAGATGGAGGGGAAATGG + Intronic
1014005235 6:116410288-116410310 TTGTGGGAAGGGAGGGAACTGGG - Intronic
1015214237 6:130731688-130731710 GTGAGAGAAAGGAGGGAAATGGG - Intergenic
1016451026 6:144182407-144182429 GTGTGGTAAAGGAGGGAAGGGGG - Intronic
1018146734 6:160898581-160898603 GTGTGGTAATGGCTGAAAACAGG + Intergenic
1021042326 7:15877524-15877546 TTGTGGAAATAGAGGGAAAGTGG + Intergenic
1021996967 7:26188417-26188439 TTGGGGTAGTGGAGGGGAATTGG - Intergenic
1021999145 7:26208242-26208264 GTGGGGTAATGTAGGGAAGGAGG + Intronic
1022787925 7:33657661-33657683 ATGTGGTAATAAAGGGTAATGGG + Intergenic
1022922727 7:35032883-35032905 CTGTGGAGATGGAGAGAAATTGG - Intronic
1025658888 7:63544614-63544636 CTTTGGATATGGAGGGAAATTGG - Intergenic
1028474078 7:91234721-91234743 TTTTATTAATGGAGGGAAATTGG - Intergenic
1028600301 7:92593512-92593534 GAGTGGGAAGGGAGGGAAGTGGG - Intergenic
1028621197 7:92831533-92831555 TTGTGATATTGGAGGGAAAAGGG - Intronic
1030218120 7:107067332-107067354 AAGTGGAAATGGAGGGATATGGG + Intronic
1030731471 7:112994829-112994851 GTGTGGGAATGGGGAGATATTGG + Intergenic
1030994348 7:116340247-116340269 GTGTGACAATGGGGGGAAAGCGG - Intronic
1031150117 7:118044467-118044489 TATTGGTAATGGAGAGAAATAGG + Intergenic
1031829667 7:126610989-126611011 GTGTGGTAAGTGAAGGAAAAGGG - Intronic
1032307409 7:130748999-130749021 GTGTGGTACTGGTGGGAAAATGG + Intergenic
1032453095 7:132051592-132051614 TGGTGGGAATGAAGGGAAATAGG - Intergenic
1034460033 7:151193095-151193117 GTGGGGGAATGAAGGGAAAAGGG - Intronic
1035605820 8:929222-929244 GAGTGGGAATGGCGGGGAATCGG - Intergenic
1035605871 8:929384-929406 GAGTGGGAATGGCGGGGAATCGG - Intergenic
1036284362 8:7430621-7430643 GTGAGGTAAGGGAGGAAAATGGG + Intergenic
1036337114 8:7880909-7880931 GTGAGGTAAGGGAGGAAAATGGG - Intergenic
1036373538 8:8181050-8181072 GTGTGGTAAGGGTGAGAAACAGG - Intergenic
1038556805 8:28525759-28525781 GTGTGGAAATGGAGATCAATTGG + Intronic
1042062159 8:64831753-64831775 GTGTGGTATTGGTGGAAAAAGGG - Intergenic
1043459172 8:80442070-80442092 GAGTGGAAATGGATGGAATTAGG + Intergenic
1045520163 8:102896523-102896545 CTTTGGTACTGGAGGGGAATTGG - Intronic
1048377257 8:133833654-133833676 GTGTGGGTATGGAGGGAATTGGG - Intergenic
1050082433 9:1929020-1929042 GTGTTGTAATGGAGGGCGGTGGG + Intergenic
1050715306 9:8517821-8517843 GTTTGGTTGAGGAGGGAAATAGG - Intronic
1051257223 9:15226861-15226883 GAGTGGAAATGGAAGGAGATTGG - Intronic
1051851851 9:21518655-21518677 GTGTGGAAATGTAGAGAATTTGG + Intergenic
1052162278 9:25279416-25279438 GTGTGGTATTGGTGAAAAATAGG + Intergenic
1055970151 9:81903636-81903658 GGGTGGTGATGTAGGTAAATTGG + Intergenic
1056873774 9:90308212-90308234 GACTAGTAATGGATGGAAATAGG + Intergenic
1059069261 9:111118207-111118229 ATGTGGTATTGCTGGGAAATGGG - Intergenic
1059974585 9:119701973-119701995 GGGTGGTGGTGGAGGGAATTGGG + Intergenic
1060712100 9:125877315-125877337 GTGGGGTACAGGATGGAAATCGG - Intronic
1186137003 X:6532715-6532737 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186297707 X:8169068-8169090 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186325152 X:8467403-8467425 GTGTGGGGAGGGAGGGAAGTGGG + Intergenic
1186684111 X:11906446-11906468 CTTTGAAAATGGAGGGAAATTGG - Intergenic
1188766992 X:34105819-34105841 GTGGGGTACTGGGGGAAAATGGG - Intergenic
1189725992 X:43968784-43968806 AAGTGGTAGTGGAGGGGAATTGG + Intronic
1193664123 X:84295292-84295314 GTGGGGTAATAGGGAGAAATTGG - Intergenic
1193939945 X:87670165-87670187 GTGTGTTAAGGGAGGGGATTAGG - Intergenic
1198708390 X:139474592-139474614 GTGTGATAATGGTGGCAAACAGG + Intergenic
1198766422 X:140084528-140084550 GTGTCGTCAGTGAGGGAAATGGG + Intergenic
1199549855 X:149047541-149047563 GTGTGGTATTGGTGTAAAATAGG - Intergenic
1199963745 X:152801038-152801060 GTGTGGGAAGGGAGGGAGGTGGG - Intergenic
1200271058 X:154683864-154683886 GTTTGGGGATGGAGAGAAATTGG + Intronic
1201973849 Y:19826057-19826079 GTGGTGTACTAGAGGGAAATGGG + Intergenic