ID: 955689014

View in Genome Browser
Species Human (GRCh38)
Location 3:61572418-61572440
Sequence CTCGTTCTGGATCTTGTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 91}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955689014 Original CRISPR CTCGTTCTGGATCTTGTGTC TGG Intronic
900001667 1:17945-17967 CTTGCTCTGGATCCTGTGGCGGG + Intergenic
913722118 1:121607322-121607344 ATAGTTCTGGCTCTTGTGTCAGG + Intergenic
913741903 1:121854902-121854924 ATAGTTCTGGCTCTTGTGTCAGG + Intergenic
916040504 1:160957119-160957141 CTGATGCTGGATCTGGTGTCGGG + Intergenic
1068958707 10:62844961-62844983 CTCCTTCTTGTCCTTGTGTCTGG + Intronic
1073687337 10:105769756-105769778 CTCCTACTGGATTTTCTGTCGGG - Intergenic
1074683088 10:115930403-115930425 CTAGTTCTGAAGCTTGTGTATGG - Intronic
1079141919 11:17816754-17816776 CTGATTCTGGATCTTGTCTCAGG - Intronic
1079836560 11:25342023-25342045 CTCGTTATAGAGCTTGGGTCTGG + Intergenic
1081950849 11:47041166-47041188 CTTGGCCTGGATCTTGTGTCAGG + Intronic
1091374753 12:18067-18089 CTTGCTCTGGATCCTGTGGCGGG + Intergenic
1101568931 12:105935397-105935419 CTACTTCTGGATATTGTGTTAGG + Intergenic
1109469788 13:62790271-62790293 CTCTTTCTGCATTGTGTGTCGGG - Intergenic
1111110914 13:83708138-83708160 CTTTTTCTGGATATTCTGTCTGG + Intergenic
1111664554 13:91250432-91250454 ATCTTTCTTGATCTTGTTTCTGG - Intergenic
1115860304 14:37678625-37678647 CATGTTCTGGAAATTGTGTCAGG + Intronic
1122467049 14:101940925-101940947 CTTCTTATGGACCTTGTGTCAGG - Intergenic
1122728528 14:103777427-103777449 TTGGTTCTGGATCCTCTGTCAGG - Intronic
1122738369 14:103856605-103856627 TTCCCTCTGGATGTTGTGTCAGG + Intergenic
1124267157 15:28247046-28247068 CTCTTTCTGTATCATGTGACTGG + Intronic
1127680812 15:61296110-61296132 CTAGTTCTGGATCTTGATTTTGG - Intergenic
1128565880 15:68700178-68700200 CTGGGTCTGGATGTCGTGTCTGG - Intronic
1129222581 15:74140218-74140240 CTGGTCCCAGATCTTGTGTCTGG + Intergenic
1132051497 15:98611247-98611269 CTCTTGCTGGAGCTTGTGCCTGG - Intergenic
1132451842 15:101972995-101973017 CTTGCTCTGGATCCTGTGGCGGG - Intergenic
1132455050 16:17634-17656 CTTGCTCTGGATCCTGTGGCGGG + Exonic
1133146447 16:3790673-3790695 CTCGTTGTGGTTCTTCTGTAGGG + Intronic
1134088850 16:11378927-11378949 TTCCTTCTTGATCTTCTGTCTGG + Intronic
1140719496 16:77758532-77758554 CTAGTTCTGGATCTAGTCTCTGG + Intergenic
1140719504 16:77758605-77758627 CTGGTTCTGGATCTAGTCTCTGG + Intergenic
1140832554 16:78765206-78765228 CTCGTGCTGGATCCTCTGCCAGG - Intronic
1144351218 17:14398710-14398732 ATCTATCTGGATTTTGTGTCTGG - Intergenic
1146414525 17:32619938-32619960 GTCATTCTGGATATTGTGTTAGG + Intronic
1146893135 17:36521500-36521522 CTCCTTCTGGAACTTCTGTGAGG - Intronic
1148843103 17:50511740-50511762 CTCTTTCTGGTTCTTTGGTCTGG - Intronic
1151688200 17:75662277-75662299 CTTGTTCTGGATCCTGTGGAAGG - Intronic
1156762285 18:40607388-40607410 CTCTTTCTATATATTGTGTCAGG + Intergenic
1160434917 18:78842653-78842675 CTCTTTCTTGCTTTTGTGTCAGG + Intergenic
1160679955 19:408017-408039 CTCGATCTGGATCACGTGCCGGG + Exonic
1162736015 19:12747558-12747580 CTTGGCCTGGATCTTGTGACGGG - Exonic
1166244600 19:41516624-41516646 CTGGTTTTGGATCTGGTGCCTGG + Intergenic
1168471697 19:56645572-56645594 CAGGTTCTGAATCTTGTGCCTGG + Exonic
1168586786 19:57600241-57600263 CTGGTGCTGGATCTCGTTTCTGG + Intronic
925075002 2:1009121-1009143 CTGGTCCTGGATCGTGTGTATGG + Intronic
926693108 2:15750998-15751020 CTCGTCCTGGATACTGGGTCTGG - Intergenic
932302711 2:70678438-70678460 CTGGTTCTGGGTCATGTGCCTGG + Intronic
935562002 2:104568961-104568983 TTCGTTCTGGCTTTTGGGTCAGG - Intergenic
936568056 2:113595463-113595485 CTTGCTCTGGATCCTGTGGCGGG - Intergenic
940948024 2:159640292-159640314 TTCTTTGTTGATCTTGTGTCTGG - Intergenic
946142098 2:217700188-217700210 CTTGTTCTGTATCTTGTGCCAGG - Intronic
946601332 2:221363232-221363254 GGCTTTCTGGTTCTTGTGTCTGG + Intergenic
1170275925 20:14588019-14588041 CTTTTTCTGGATCTGGTATCAGG + Intronic
1171127024 20:22611257-22611279 CTCCTTCTGGATCTGGTTCCTGG + Intergenic
1171243413 20:23589234-23589256 CTAGCTCTGTGTCTTGTGTCTGG + Intergenic
1172101568 20:32486876-32486898 CTCTTTCTGGATTTCTTGTCTGG - Intronic
1177400497 21:20597375-20597397 ATCATTCTGGATTTTTTGTCTGG - Intergenic
1178829667 21:36045324-36045346 CTCGTGCTGCATCCTCTGTCCGG - Intronic
1179514625 21:41898167-41898189 CTGGCTCTGGCTCTTGTGTGGGG - Intronic
1183186912 22:36297097-36297119 CTCGTTATGAAACGTGTGTCAGG + Intronic
949538209 3:5012034-5012056 CTGGTTCTGGTTCTGCTGTCAGG + Intergenic
953338116 3:42111140-42111162 CTCCTTCTGGACCTTCTGTCTGG - Intronic
953380049 3:42463159-42463181 TTGGATCTGAATCTTGTGTCTGG - Intergenic
953787329 3:45921104-45921126 CTCTTTCTGGCCCTTTTGTCTGG - Exonic
955474726 3:59324860-59324882 CATGTTCTGTATCTTGTTTCGGG + Intergenic
955689014 3:61572418-61572440 CTCGTTCTGGATCTTGTGTCTGG + Intronic
963358704 3:144242927-144242949 ATTGTTCTGGATCTTTTCTCTGG - Intergenic
970632785 4:17970191-17970213 CTATTTCTGGATCTTCTATCTGG - Intronic
971060280 4:22960474-22960496 CTCTTTCTTGATCTTGTCTCAGG + Intergenic
971645646 4:29198028-29198050 CTTTTTCTGGATTTGGTGTCAGG + Intergenic
972480660 4:39492957-39492979 CTCCTTCTGGATGTTGTGGCTGG - Intergenic
979832501 4:125318305-125318327 TTCCGTCTGGATCCTGTGTCTGG + Exonic
984857065 4:184204488-184204510 CTGGTTCTGAATCATGTGCCTGG + Intronic
986177309 5:5363526-5363548 CTGGTTTTGGATCTAGGGTCTGG + Intergenic
989690880 5:44142801-44142823 GTCATTCTGGATCTGGGGTCTGG + Intergenic
989956228 5:50363714-50363736 AGAGTTCTGGCTCTTGTGTCAGG - Intergenic
998785777 5:145707291-145707313 CTCCCTCTTGATTTTGTGTCAGG + Intronic
1003965632 6:11249862-11249884 TTCCTTCTGGCTCCTGTGTCTGG + Intronic
1005077097 6:21919120-21919142 CCTGTTCTGGATCATGTGCCAGG - Intergenic
1007589547 6:43013180-43013202 CTTGTTCAGGATCTTGGTTCAGG + Exonic
1010360633 6:74988456-74988478 CTATTTCTGGATCTTATTTCTGG - Intergenic
1015299419 6:131635529-131635551 CTTGTTCTGGACTTTGTGTAAGG - Intronic
1017158335 6:151341967-151341989 CTCGTTCTGGGTCCCGTGACAGG + Intronic
1028553451 7:92097288-92097310 CTCGTTCTAGTTCTTGCTTCTGG - Exonic
1032500614 7:132396979-132397001 CTGGGTCTGGATCTTGGGGCAGG - Intronic
1034655205 7:152723672-152723694 CTGGTTCTGGATTTTGTGGGGGG - Intergenic
1042574755 8:70205625-70205647 CTCCTTCTGGGTCTTCTGTTTGG - Intronic
1044471307 8:92571958-92571980 CTCTTTCTGCATCTTATGACAGG + Intergenic
1047869432 8:129066324-129066346 CTCCTTCTTGAGTTTGTGTCTGG - Intergenic
1049884475 9:18058-18080 CTTGCTCTGGATCCTGTGGCGGG + Intergenic
1050303407 9:4282545-4282567 CTCTTCCTGGATCTTGAGCCTGG + Intronic
1050400791 9:5251617-5251639 TTCCTTATGGATTTTGTGTCTGG - Intergenic
1051699644 9:19808114-19808136 TTCTTTCTGGATCTTGCTTCAGG + Intergenic
1052348763 9:27436932-27436954 CGCGTTCTGTTCCTTGTGTCTGG - Intronic
1052459724 9:28747141-28747163 CTCCTTCTGGATCCTGGGTCTGG - Intergenic
1055071828 9:72174526-72174548 TTGGTTCTGGATTTTGTGTATGG + Intronic
1058858965 9:109095744-109095766 GCTGTTCTGTATCTTGTGTCAGG - Intronic
1061406505 9:130395413-130395435 CCCGCTCTGGATCTTGGATCCGG - Intronic
1187261216 X:17686782-17686804 CTGGATCTGGATAGTGTGTCTGG + Intronic
1188509691 X:30922004-30922026 CTCATTCTTGATCATGCGTCAGG - Intronic
1194946714 X:100077271-100077293 CTCTTCCTGGATCTTGAGCCTGG - Intergenic
1198666215 X:139026020-139026042 CTAGTTCTGAATCCTGTGGCAGG - Intronic
1199833688 X:151567504-151567526 CTCTTTATGGCTCTGGTGTCAGG + Intronic
1200401331 X:156022093-156022115 CTTGCTCTGGATCCTGTGGCGGG - Intergenic