ID: 955690420

View in Genome Browser
Species Human (GRCh38)
Location 3:61585381-61585403
Sequence AGTCATAAGACTGCGTGTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 72}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955690420_955690423 2 Left 955690420 3:61585381-61585403 CCTCAACACGCAGTCTTATGACT 0: 1
1: 0
2: 0
3: 5
4: 72
Right 955690423 3:61585406-61585428 CCATTTGGTACTATAGCCATTGG 0: 1
1: 0
2: 0
3: 7
4: 83
955690420_955690425 6 Left 955690420 3:61585381-61585403 CCTCAACACGCAGTCTTATGACT 0: 1
1: 0
2: 0
3: 5
4: 72
Right 955690425 3:61585410-61585432 TTGGTACTATAGCCATTGGGTGG 0: 1
1: 0
2: 0
3: 4
4: 57
955690420_955690426 7 Left 955690420 3:61585381-61585403 CCTCAACACGCAGTCTTATGACT 0: 1
1: 0
2: 0
3: 5
4: 72
Right 955690426 3:61585411-61585433 TGGTACTATAGCCATTGGGTGGG 0: 1
1: 0
2: 2
3: 2
4: 81
955690420_955690424 3 Left 955690420 3:61585381-61585403 CCTCAACACGCAGTCTTATGACT 0: 1
1: 0
2: 0
3: 5
4: 72
Right 955690424 3:61585407-61585429 CATTTGGTACTATAGCCATTGGG 0: 1
1: 0
2: 0
3: 6
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955690420 Original CRISPR AGTCATAAGACTGCGTGTTG AGG (reversed) Intronic
902594335 1:17498047-17498069 AGTCATTAGGCTGGGTGCTGTGG - Intergenic
905303006 1:36998332-36998354 AGACATGAGACAGGGTGTTGGGG - Intronic
911327970 1:96491469-96491491 ATTCAAAAGACAGTGTGTTGAGG - Intergenic
912934907 1:113994388-113994410 ATTCATAAGAATGGGTCTTGGGG - Intergenic
913280274 1:117178875-117178897 ATTCATAAGGCTGGGTGTGGTGG - Intronic
916064146 1:161122503-161122525 AGACATCAGACTGCGGGTTCGGG - Exonic
920841684 1:209560777-209560799 AAGCATAAGACAGTGTGTTGGGG - Intergenic
1064697873 10:17986717-17986739 ACTTATAAGACTGGGTGCTGTGG + Intronic
1068922596 10:62500298-62500320 AATCAGAAGACTGTGTGTTGTGG + Intronic
1074275567 10:111998762-111998784 AGTCATAAAACTGGGTGCAGTGG + Intergenic
1081978771 11:47253254-47253276 AGGTATAAGACTGGGTGTGGTGG - Intronic
1083367106 11:62148033-62148055 AGTCATGAGCCAGTGTGTTGTGG + Intronic
1084920258 11:72464032-72464054 AGTCATAAGACTCCCTGTGATGG + Intergenic
1085536894 11:77227067-77227089 AGGCAGAAGACTGCGCGGTGTGG - Intronic
1088119406 11:106350584-106350606 AGTCACAAGCCTGAGTTTTGAGG - Intergenic
1095164887 12:38960312-38960334 AGTTCTAAGACTGAGTGTTGAGG + Intergenic
1100618203 12:96247822-96247844 AGTCATAGGACAACGTTTTGAGG - Intronic
1101696605 12:107133028-107133050 AGTTATAAATCTGAGTGTTGGGG - Intergenic
1103419881 12:120771818-120771840 AGCCACAGGAATGCGTGTTGAGG - Intronic
1105500888 13:20970764-20970786 AGTCAGTAGCCTGGGTGTTGGGG + Intergenic
1107210592 13:37849459-37849481 AGTCATCAGACTTTGGGTTGAGG + Intronic
1116190588 14:41660311-41660333 AGTCATATGGCTGGGTGTGGTGG - Intronic
1118998180 14:70856507-70856529 AGTCAAAAGACATGGTGTTGGGG - Intergenic
1119523049 14:75300439-75300461 AGTCATGAGACTGGGCGTGGTGG + Intergenic
1123166232 14:106327675-106327697 AGTCATCAGACTCTGTGTTTAGG + Intergenic
1127668268 15:61170116-61170138 AGTCATAAGACTTCCTGTATTGG + Intronic
1127972258 15:63970888-63970910 GGTCATAAAACTGCTTGTAGGGG - Intronic
1131707362 15:95012724-95012746 AGTGTTAAGACTGGGTGCTGTGG + Intergenic
1132694713 16:1196752-1196774 AGTCATATGCCTGCTTGTTTGGG + Intronic
1135981441 16:27150624-27150646 AGTCATAAGGCTGGGCGTGGTGG - Intergenic
1136231632 16:28888981-28889003 AGTCAGAAGGCTGCCTGTGGGGG + Intronic
1146698646 17:34933067-34933089 AGTCATAAGGCCGGGTGTGGTGG - Intronic
1155710663 18:28874272-28874294 AGTTTTAAGACTGCATGTTCAGG - Intergenic
1158142884 18:54275170-54275192 AATCATAAGGCTGGGTATTGTGG + Intronic
925500685 2:4501069-4501091 AGGCAGAAGACTGGGTTTTGTGG - Intergenic
931476288 2:62590921-62590943 ATCCTTAAGTCTGCGTGTTGGGG - Intergenic
931623172 2:64231377-64231399 AGTCAGAAGACTTCAGGTTGAGG - Intergenic
937716987 2:125043526-125043548 AGTGATAAGGCTGGGTGTGGTGG + Intergenic
937822310 2:126324614-126324636 AGTCATAAAAGTGCTTTTTGAGG + Intergenic
947416658 2:229903565-229903587 AGTAAGAAGACTCCTTGTTGTGG - Intronic
947531739 2:230913205-230913227 AGTCATAGGAATGCTTATTGTGG - Intronic
1170611634 20:17918519-17918541 ACGCAGAAGACTGTGTGTTGTGG + Intergenic
1177093820 21:16805964-16805986 AGTAATAACAATGCCTGTTGAGG + Intergenic
1183113911 22:35674862-35674884 AGTCATTAGACTACCTGCTGGGG + Intergenic
1184520773 22:44992729-44992751 AGGCATAAGAATGAGTGATGTGG + Intronic
955690420 3:61585381-61585403 AGTCATAAGACTGCGTGTTGAGG - Intronic
955693154 3:61609567-61609589 AGAAATAAGACTGGGTGTGGTGG + Intronic
972063774 4:34912825-34912847 AGTCTTATGACTGTGTGATGTGG - Intergenic
973834116 4:54792159-54792181 AGTCATAAGGCAGTGTGGTGTGG - Intergenic
976058915 4:81103320-81103342 CTTCATAAGACGGCCTGTTGTGG - Intronic
977899693 4:102405669-102405691 AGACATAAAACTGAGTTTTGAGG + Intronic
983229908 4:165119026-165119048 ATTCATAATGCTGTGTGTTGAGG + Intronic
987842986 5:23244790-23244812 ATTCATAAAAGTGTGTGTTGGGG - Intergenic
993394278 5:87363744-87363766 ACTCAAAAGATTGCTTGTTGGGG - Intronic
998219957 5:140269298-140269320 AGTTATAAGGCTGGGTGCTGTGG - Intronic
998344651 5:141451113-141451135 AATCATAAGGCTGGGTGTGGTGG - Intronic
1004723513 6:18289690-18289712 AGTCATGACAATGGGTGTTGAGG - Intergenic
1006093402 6:31641460-31641482 AATCATAAGACTGGGAGTGGAGG + Intronic
1006980137 6:38140991-38141013 TGTTATAAGACTGTGTGGTGTGG - Intronic
1010145589 6:72665365-72665387 AGTTTTAAGACTGTGAGTTGAGG + Intronic
1011905840 6:92366342-92366364 GGTCATAAGACTTCATGTTGAGG - Intergenic
1013152581 6:107460082-107460104 AGACATAAGGCAGCGTGGTGCGG + Intergenic
1017983458 6:159422483-159422505 AGAGATAAGACTGCGTGTGGGGG - Intergenic
1023377715 7:39575171-39575193 AGACATTAGACTGAGTGGTGTGG + Intronic
1023927051 7:44676996-44677018 GGTCATGTGACTGAGTGTTGGGG + Intronic
1024987126 7:55205148-55205170 TGTCATAAGTCTCCTTGTTGAGG + Intronic
1027207849 7:76117066-76117088 ATTCATAAGACTGCCTGTAAAGG - Intergenic
1032555358 7:132827414-132827436 AGTCAACAGACTACATGTTGTGG + Intronic
1045036378 8:98179523-98179545 AGTCATAAAGCTGACTGTTGGGG + Intergenic
1048949511 8:139483752-139483774 AGCCATGTGACTGCCTGTTGGGG - Intergenic
1056151422 9:83793877-83793899 GGTCAGAAGACTGGGTGTGGTGG + Intronic
1057319379 9:93998286-93998308 AGTCATAAGACTTAGTGTACAGG - Intergenic
1058181259 9:101802992-101803014 AGGCAGAAGACTGCATCTTGAGG - Intergenic
1060639267 9:125225095-125225117 AATAATAAGACTGGGTGTGGTGG + Intronic
1189320893 X:40086534-40086556 AGTCATAAAGATGTGTGTTGGGG + Intronic
1192382391 X:70631797-70631819 AATCAGAAGACTGTGTGTTGTGG + Intronic
1195367692 X:104141873-104141895 AGTCCTAGGACTGGGTGTGGTGG - Intronic
1200055178 X:153456500-153456522 AGTCATCACTCTGCTTGTTGAGG + Exonic