ID: 955690423

View in Genome Browser
Species Human (GRCh38)
Location 3:61585406-61585428
Sequence CCATTTGGTACTATAGCCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 83}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955690420_955690423 2 Left 955690420 3:61585381-61585403 CCTCAACACGCAGTCTTATGACT 0: 1
1: 0
2: 0
3: 5
4: 72
Right 955690423 3:61585406-61585428 CCATTTGGTACTATAGCCATTGG 0: 1
1: 0
2: 0
3: 7
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955690423 Original CRISPR CCATTTGGTACTATAGCCAT TGG Intronic
901478256 1:9505654-9505676 CCATTTGTTACAGTAGCCACAGG - Intergenic
901741243 1:11343388-11343410 CCATTTGGACCTTTATCCATGGG + Intergenic
908535601 1:65073949-65073971 TCATTTGGTGCTAGATCCATAGG + Intergenic
914995504 1:152539921-152539943 CCAATTGGTACTATAGGAACAGG + Intronic
915003028 1:152610981-152611003 CCAATTGGTACTATAGGAACAGG - Intergenic
916803315 1:168234457-168234479 CCATTTGACTCTATAGCTATTGG - Intronic
918988545 1:191665774-191665796 CCATTTATTACAATAGCTATAGG + Intergenic
920791263 1:209095167-209095189 CCATTTGGTACTTTTGCCTTGGG + Intergenic
921289304 1:213641521-213641543 CCACTTGGTACTACACACATGGG - Intergenic
922091850 1:222403165-222403187 GCTTTTGGGACTCTAGCCATGGG - Intergenic
924921216 1:248631183-248631205 TCATTTGGTACCACAGCCATAGG + Intergenic
1067925810 10:50506977-50506999 GCATTTGGTACTAGAACAATGGG - Intronic
1068847974 10:61702311-61702333 ACATTTGGAAATATACCCATGGG - Intronic
1073222841 10:101890654-101890676 CCATTTGCTACTCTAGTCTTTGG - Intronic
1080935353 11:36857452-36857474 CCATTTGAAACTACAGCCTTAGG + Intergenic
1092027289 12:5252528-5252550 GCATTTGGGATTATAGCCTTCGG - Intergenic
1095577320 12:43755979-43756001 CCATATGGTATGGTAGCCATGGG - Intronic
1097884956 12:64719812-64719834 CCAGTTGTTACTTTAGCCAGAGG - Intronic
1106122864 13:26876038-26876060 CCATATGGTATTTTTGCCATGGG - Intergenic
1106590697 13:31096124-31096146 CCATTTGGTCATATAGCACTAGG + Intergenic
1110388832 13:74947622-74947644 CCATTTAGTATACTAGCCATGGG - Intergenic
1111107229 13:83662518-83662540 GCCTTTGATACTAAAGCCATTGG + Intergenic
1114803764 14:25809452-25809474 CCTTTTGGTTCTACAGCCAAAGG + Intergenic
1117438857 14:55742141-55742163 CCAGCTGGGACTATAGCCAGGGG - Intergenic
1119957489 14:78814689-78814711 CCTTATGGAACTACAGCCATAGG - Intronic
1136520813 16:30794643-30794665 CTAGTTGGGACTATAGGCATGGG + Intergenic
1137312884 16:47283765-47283787 CAATTTGTTACTATGGCAATAGG + Intronic
1138737150 16:59263720-59263742 CAATCTGATACTAAAGCCATTGG + Intergenic
1146437012 17:32859511-32859533 GAATTTGGTCCTAAAGCCATTGG - Intronic
1149281424 17:55109586-55109608 CCATTTGGTACAGCAGCAATAGG - Intronic
1153709985 18:7788820-7788842 CTTTTTGTTAATATAGCCATGGG + Intronic
1155545496 18:26910257-26910279 CCCTTTGGTCCTATATCCAGTGG - Exonic
1157136923 18:45065113-45065135 CCAAGTTGTACTCTAGCCATTGG + Exonic
931980080 2:67685352-67685374 CAATTTGGAGCTATAACCATAGG + Intergenic
935428583 2:102948138-102948160 ACATATGGTACTATAGTCAATGG - Intergenic
942536358 2:176968612-176968634 CCATGTGGTGCGATAGCAATAGG - Intergenic
1172994105 20:39057427-39057449 CCATTTGGTACGGCAGCCCTGGG + Intergenic
1173544698 20:43886163-43886185 GCATTTAGTTTTATAGCCATAGG + Intergenic
1176971040 21:15266099-15266121 CCAATTGGTGATATAGCAATAGG - Intergenic
1179198552 21:39190711-39190733 CCATTTTATTCTACAGCCATTGG - Intronic
1181988499 22:26818850-26818872 CCATTTGTTACAGCAGCCATGGG + Intergenic
1182196105 22:28520072-28520094 CCATTTGGAACTATAGAAACTGG - Intronic
1182220962 22:28758342-28758364 CCCTTTGGTACTGTGGCCTTGGG + Intergenic
955486560 3:59439934-59439956 CCATTTGTTATGATAGCAATAGG + Intergenic
955690423 3:61585406-61585428 CCATTTGGTACTATAGCCATTGG + Intronic
956415622 3:69025663-69025685 CCATTTGCTGATATAGGCATTGG + Exonic
960474993 3:118112902-118112924 CCATTTGATACTATAATCCTAGG - Intergenic
961232686 3:125332372-125332394 CCTTTTGGTACTATTGCTATAGG - Intronic
963309289 3:143690965-143690987 TCAATGGGTACTAAAGCCATTGG + Intronic
963784015 3:149514852-149514874 CTATTTGGTACTATGAGCATAGG - Intergenic
967972442 3:195009394-195009416 TCATTTGTTACAGTAGCCATAGG - Intergenic
970811499 4:20099715-20099737 CCATTTTATACAATTGCCATGGG - Intergenic
972026425 4:34384059-34384081 CCAATGGGTCCTAGAGCCATGGG - Intergenic
973720796 4:53721448-53721470 CTATGGTGTACTATAGCCATGGG - Intronic
975526286 4:75353978-75354000 CCATTTGTTACAGTAGCCAAAGG + Intergenic
981392328 4:144205741-144205763 CCATTTGCTACCACAGCCCTGGG + Intergenic
988040269 5:25880125-25880147 CGATTAGGTACTATACACATTGG - Intergenic
988601678 5:32645816-32645838 CTATTTGATCCTAAAGCCATAGG - Intergenic
988833287 5:35007664-35007686 CCATTTGTTAGTATAAGCATGGG - Intronic
989191356 5:38672699-38672721 CCTTCTGGTACTATAGCCAAAGG - Intergenic
992996541 5:82339694-82339716 GCATTTGGTATTGTAGCCAGAGG + Intronic
997752928 5:136366154-136366176 CCATTTGGTTACATAGCAATTGG - Intronic
1003129708 6:3385384-3385406 GTAGTTGGAACTATAGCCATGGG - Intronic
1008460927 6:51770754-51770776 AAATCTGGAACTATAGCCATAGG - Intronic
1012270292 6:97201383-97201405 GCATTTGGTAATATAGACAGTGG + Intronic
1012711512 6:102612912-102612934 ACACTTGGTGATATAGCCATCGG - Intergenic
1015015579 6:128408763-128408785 CAATTTTTTCCTATAGCCATTGG - Intronic
1015691083 6:135924307-135924329 CCATATGGTACAATATCCTTTGG - Intronic
1022789497 7:33672739-33672761 CCACTAGGTTCTGTAGCCATCGG - Intergenic
1024791040 7:52965001-52965023 TAATTTGGTACAATAGCCATAGG + Intergenic
1032245628 7:130209242-130209264 TCATTTAGCATTATAGCCATAGG + Intronic
1032614280 7:133449389-133449411 TCATTTGTTACTGTAGCCCTGGG + Intronic
1034141738 7:148825277-148825299 CCATTTGTTGCTTCAGCCATTGG - Intronic
1040803315 8:51367412-51367434 GCAATTGGTAATATAGCCCTTGG - Intronic
1044685031 8:94818499-94818521 ACATTTGTTAATATCGCCATTGG + Intronic
1050676029 9:8053833-8053855 CCATAGGGTACTTTAGCCCTAGG - Intergenic
1050797623 9:9563924-9563946 CCATTTGGTTTGAGAGCCATTGG - Intronic
1053552925 9:39102996-39103018 CTATTTGGTATTCTAGCTATAGG - Intronic
1053817041 9:41923176-41923198 CTATTTGGTATTCTAGCTATGGG - Intronic
1054107298 9:61066833-61066855 CTATTTGGTATTCTAGCTATGGG - Intergenic
1054613559 9:67264292-67264314 CTATTTGGTATTCTAGCTATGGG + Intergenic
1057608326 9:96518058-96518080 CCATTTGGAAGTATAGTCATTGG - Intronic
1057902053 9:98957044-98957066 CCATTAGGTTCTATAGCAAAGGG + Intronic
1057976228 9:99608952-99608974 CCATTTTGTGCTGTAGCCTTTGG - Intergenic
1060632711 9:125174109-125174131 CCAGTTTGTACTATTGCCAAAGG + Intronic
1186436596 X:9548148-9548170 CAAATTGGTACTATAAACATCGG - Intronic
1186801155 X:13093404-13093426 TCATTTGTTACTGCAGCCATAGG + Intergenic
1189133306 X:38522932-38522954 CTATGTGGGACTATAGGCATGGG - Intronic
1190367120 X:49706039-49706061 CCATTTAGTCCTATAGGCATGGG + Intergenic
1191010682 X:55754676-55754698 CCTTTTGCTACTATAGCAACAGG + Intronic
1193241178 X:79171489-79171511 GCATTTGGTCCTATTGCCAGAGG - Exonic