ID: 955690424

View in Genome Browser
Species Human (GRCh38)
Location 3:61585407-61585429
Sequence CATTTGGTACTATAGCCATT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 114}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955690420_955690424 3 Left 955690420 3:61585381-61585403 CCTCAACACGCAGTCTTATGACT 0: 1
1: 0
2: 0
3: 5
4: 72
Right 955690424 3:61585407-61585429 CATTTGGTACTATAGCCATTGGG 0: 1
1: 0
2: 0
3: 6
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955690424 Original CRISPR CATTTGGTACTATAGCCATT GGG Intronic
900849029 1:5127530-5127552 CATTTGTTACCATTGCAATTTGG - Intergenic
901623800 1:10611338-10611360 AAGTTGGCACTATAGCCAGTTGG - Intronic
902746655 1:18479101-18479123 CATTTGGGACAATAGCCAGCAGG - Intergenic
904015002 1:27412809-27412831 CATTTGATACAAAAGCTATTAGG + Intronic
904879833 1:33687214-33687236 CATTTTGCACTTGAGCCATTTGG - Intronic
910497973 1:87854133-87854155 CATTTAGCATTAAAGCCATTTGG - Intergenic
913514521 1:119592150-119592172 CATATGGTATTAAAGCAATTTGG + Intergenic
917619550 1:176782109-176782131 CATTTTATAATATAGGCATTTGG + Intronic
918557215 1:185817209-185817231 CATGTGGACCTATAGCCACTGGG - Intronic
918810154 1:189106771-189106793 CACTTTGAACTACAGCCATTAGG - Intergenic
919236303 1:194847654-194847676 CATTAGGTACTACAGGCATTTGG - Intergenic
920791264 1:209095168-209095190 CATTTGGTACTTTTGCCTTGGGG + Intergenic
922043353 1:221918879-221918901 CACTAAGCACTATAGCCATTAGG - Intergenic
924921217 1:248631184-248631206 CATTTGGTACCACAGCCATAGGG + Intergenic
1064279526 10:13938874-13938896 TACTTGGTACTATTGACATTTGG - Intronic
1066585349 10:36927875-36927897 CATTCTGTACTATAGGTATTAGG + Intergenic
1071750200 10:88466737-88466759 CATTTGGTAATTTAAACATTTGG + Intronic
1072130242 10:92487097-92487119 CATTTGGTACTATGTTGATTTGG - Intronic
1073370285 10:102982053-102982075 ATTTTGGAACTATAGTCATTTGG + Intronic
1074671439 10:115796378-115796400 AATTTAGTCCTAAAGCCATTAGG - Intronic
1075086108 10:119415438-119415460 GACTTGGTCCTATAGGCATTGGG + Intronic
1080527298 11:33136838-33136860 TATTGGGTATTATAGTCATTAGG - Intronic
1080625153 11:34022501-34022523 CATCTGGAACTGTAGTCATTTGG - Intergenic
1081803542 11:45876440-45876462 CATTTGAAACAATAGCTATTTGG - Intronic
1082655125 11:55845367-55845389 CTTTGGTTACTATAGCCTTTTGG + Intergenic
1084457510 11:69276847-69276869 CAAGTGCTACTATAGCTATTGGG + Intergenic
1086463613 11:87031179-87031201 CATTTGTTACTATAAGCTTTAGG + Intergenic
1092027288 12:5252527-5252549 CATTTGGGATTATAGCCTTCGGG - Intergenic
1093798387 12:23341312-23341334 CATTTGGTTCTCAAGGCATTTGG + Intergenic
1097916078 12:65021610-65021632 AATTTAGTCCTAAAGCCATTAGG - Intergenic
1098596333 12:72276103-72276125 TTTTTGTTACTATAGCCACTTGG + Intronic
1099384062 12:81992834-81992856 GGTTAGGTACTATAGACATTAGG + Intergenic
1099720310 12:86353890-86353912 GATTTGGTACTCTAGCTATGAGG - Intronic
1100456413 12:94755899-94755921 GATTTCGTTCCATAGCCATTAGG - Intergenic
1103019368 12:117521545-117521567 CATTTGCGGCTATAGCAATTGGG + Intronic
1107019774 13:35739724-35739746 CATATAGTACTATAGTCTTTAGG - Intergenic
1107625045 13:42273081-42273103 CAGTTTGTACTAAAGCTATTAGG - Intronic
1109976941 13:69849994-69850016 CATTTAGTAATATAGATATTTGG - Intronic
1111377793 13:87403201-87403223 CACTTGGAACAATAGACATTGGG + Intergenic
1119990688 14:79193628-79193650 CATTAGTTACTTTGGCCATTTGG - Intronic
1127246631 15:57183499-57183521 CCTTTCTTACCATAGCCATTGGG + Intronic
1130702252 15:86196403-86196425 CATTTGTTCCTAGAGCCCTTAGG + Intronic
1133470204 16:6067881-6067903 CATTTGTTATTGTAGCAATTGGG + Intronic
1135170226 16:20177429-20177451 GAGTTGGGACTATAGGCATTTGG - Intergenic
1135392742 16:22107373-22107395 CATTTGGCACTATTGACATTTGG - Intronic
1135392743 16:22107389-22107411 CATTTGGCACTATTGGCATTTGG - Intronic
1141304339 16:82847213-82847235 CATTTGTTACAGCAGCCATTGGG - Intronic
1146109570 17:30075846-30075868 AATTTGATCCTAAAGCCATTAGG - Intronic
1146246939 17:31294008-31294030 CATTTGGTACTACAACCAGGTGG - Intronic
1146437011 17:32859510-32859532 AATTTGGTCCTAAAGCCATTGGG - Intronic
1150317370 17:64180604-64180626 CATTTCCTAATATTGCCATTTGG + Intronic
1153986628 18:10356783-10356805 CATTGGTTACTATAGACAGTGGG - Intergenic
1155545494 18:26910256-26910278 CCTTTGGTCCTATATCCAGTGGG - Exonic
1155684989 18:28537539-28537561 CATATGGCACTAAAGCCATGTGG - Intergenic
1161460861 19:4396691-4396713 ATTTTGGTACTATTGACATTTGG + Intronic
930928634 2:56852383-56852405 CTTTTGATTCTATAGCCCTTTGG + Intergenic
939134770 2:138280194-138280216 AATATGGTCCCATAGCCATTTGG + Intergenic
939521294 2:143233943-143233965 CATTTGAAAAGATAGCCATTGGG - Intronic
940021922 2:149164983-149165005 CTTTTGCTAATATTGCCATTTGG + Intronic
942645580 2:178107328-178107350 CATTTTGTCCTATAATCATTTGG + Intronic
943032473 2:182701701-182701723 AATCTGGTACTTTAGTCATTTGG - Intergenic
944868112 2:203881930-203881952 CATTTGGTCCTTTAATCATTTGG + Intergenic
946165866 2:217863489-217863511 CCTGTGGTACTATTGGCATTTGG - Intronic
1169614851 20:7429655-7429677 CATTAGGCACTTTAGTCATTAGG - Intergenic
1172041658 20:32050951-32050973 AATTTGGCACTATTGACATTTGG - Intergenic
1177391595 21:20480995-20481017 CATTGGGTAGCTTAGCCATTAGG + Intergenic
1178482183 21:32989201-32989223 CATCTGGGACTATAGCCGCTAGG - Intergenic
1179198551 21:39190710-39190732 CATTTTATTCTACAGCCATTGGG - Intronic
1179841985 21:44082607-44082629 CTTTTGATACAATAGCCTTTGGG + Intronic
1181910565 22:26235137-26235159 AATTTGGCACTATTGGCATTTGG + Intronic
1182016839 22:27047523-27047545 CATTTGTTTCTATACCCTTTTGG + Intergenic
1182139600 22:27942290-27942312 CATGTGGTACTATCACCATGAGG + Intergenic
955690424 3:61585407-61585429 CATTTGGTACTATAGCCATTGGG + Intronic
959702785 3:109314012-109314034 CATTTGGTACCAAGGCCACTGGG + Intronic
964089868 3:152862771-152862793 AATTTAGTCCTAAAGCCATTTGG + Intergenic
965664730 3:171081111-171081133 GATTTGGTAGTATAGCAATCAGG + Intronic
966076784 3:175945769-175945791 TATTTGTGACTATAGCCATGTGG - Intergenic
967207195 3:187134762-187134784 CTTTTGGTAGTGAAGCCATTTGG - Intronic
971734992 4:30436791-30436813 AAATAGGTACTATAGACATTTGG + Intergenic
972137787 4:35913884-35913906 TATTTGGAAATATTGCCATTGGG + Intergenic
974036234 4:56820930-56820952 CATTTGGTTCTGTTCCCATTAGG + Intronic
980531111 4:134056038-134056060 CAAATGGTGCTATAGCAATTTGG - Intergenic
982413101 4:155101731-155101753 CCTTTGGGACTATAGCTCTTTGG + Intergenic
984424542 4:179566183-179566205 AATTTAGTAATAAAGCCATTGGG + Intergenic
988620575 5:32818918-32818940 CACTTGGTACTTTATTCATTTGG - Intergenic
999821054 5:155229435-155229457 CATTTGGGATTTTAGACATTAGG + Intergenic
1001850150 5:174956645-174956667 ACATTGGCACTATAGCCATTTGG - Intergenic
1005056548 6:21734714-21734736 TATCTGATACTATAGCCACTGGG - Intergenic
1008207135 6:48674890-48674912 CATTTGGTACTATAAGTAATGGG - Intergenic
1011476778 6:87756166-87756188 AATTTGGTGCTAAAGCCTTTAGG - Intergenic
1014936961 6:127396574-127396596 AATTTGGTATAATAGCAATTTGG + Intergenic
1014948375 6:127524451-127524473 CAGTTGGTTCTATAGCCTTCTGG - Intronic
1015015578 6:128408762-128408784 AATTTTTTCCTATAGCCATTGGG - Intronic
1015731210 6:136350029-136350051 TATTAGGTACTAAAGACATTAGG + Intronic
1027705275 7:81524710-81524732 CATTTGCTAATACAGCCAGTAGG + Intergenic
1028224051 7:88229187-88229209 CATTTTAAACTATACCCATTTGG - Intergenic
1028415171 7:90572499-90572521 CATTTGGTGCTATAGCACCTTGG + Intronic
1028515610 7:91674857-91674879 CTTTTGGGAGAATAGCCATTCGG + Intergenic
1029033779 7:97496565-97496587 CATATGGCATTATAGCCATATGG - Intergenic
1029320706 7:99756881-99756903 AATTTAGTCCTAAAGCCATTAGG - Intergenic
1030917416 7:115332800-115332822 TATTTTGTTCTATTGCCATTTGG + Intergenic
1035866732 8:3091801-3091823 TATCTGTCACTATAGCCATTTGG - Intronic
1037527998 8:19746386-19746408 CATTAGGTACCATGGCCAATAGG - Intronic
1038686979 8:29727784-29727806 CATTAGGTCCTAGAGACATTAGG - Intergenic
1043646623 8:82529247-82529269 CATTTGGTATTATATTCCTTTGG + Intergenic
1044662066 8:94601067-94601089 CAGTTGGTAATATTTCCATTTGG - Intergenic
1048676209 8:136784357-136784379 AATTTAGTAGTAAAGCCATTTGG - Intergenic
1050595625 9:7201633-7201655 CATTTGGTAATAGAGCCCCTGGG + Intergenic
1050668181 9:7965475-7965497 CTATTGGTAATATAGGCATTAGG - Intergenic
1050797622 9:9563923-9563945 CATTTGGTTTGAGAGCCATTGGG - Intronic
1053423558 9:37996552-37996574 CAGTTGGTACTATAGAGATAAGG - Intronic
1055716345 9:79122221-79122243 CACCTTGTGCTATAGCCATTAGG + Intergenic
1055998217 9:82185042-82185064 CTTTTGTTTCTATGGCCATTAGG + Intergenic
1057976227 9:99608951-99608973 CATTTTGTGCTGTAGCCTTTGGG - Intergenic
1059470457 9:114501369-114501391 GATTTGATCCTATATCCATTGGG - Intronic
1186070963 X:5820109-5820131 CATTTGGTATTATAGAAATTTGG - Intergenic
1186358737 X:8815717-8815739 CCTTTGGCACTATTGACATTGGG - Intergenic
1187685521 X:21812034-21812056 CAGTTGGGACTATAGTCATCTGG + Intergenic
1189676465 X:43465577-43465599 CAGCTGTTACTATAGCCCTTTGG + Intergenic
1195091810 X:101467597-101467619 CATCAGGTGCTATAGCCATGAGG - Intronic
1197322714 X:125052316-125052338 CATTTGGTACTGTTCCTATTTGG - Intergenic