ID: 955690425

View in Genome Browser
Species Human (GRCh38)
Location 3:61585410-61585432
Sequence TTGGTACTATAGCCATTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 57}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955690420_955690425 6 Left 955690420 3:61585381-61585403 CCTCAACACGCAGTCTTATGACT 0: 1
1: 0
2: 0
3: 5
4: 72
Right 955690425 3:61585410-61585432 TTGGTACTATAGCCATTGGGTGG 0: 1
1: 0
2: 0
3: 4
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955690425 Original CRISPR TTGGTACTATAGCCATTGGG TGG Intronic
909209844 1:72808989-72809011 TTGGGGCTATGGCCATTGGAGGG + Intergenic
911293220 1:96082613-96082635 TTGGTAATGTGGCCATTGGCTGG + Intergenic
1063740777 10:8816621-8816643 TTGGTTCTCTATCCATTGGGAGG - Intergenic
1065464437 10:26004048-26004070 TTAGAACAAAAGCCATTGGGTGG + Intronic
1065839131 10:29686019-29686041 TTGGTCCTAGGGCCAATGGGTGG - Intronic
1086641642 11:89165547-89165569 TTGGTTTTATAGTTATTGGGAGG + Intergenic
1089861351 11:121592619-121592641 TTGCTTCCATAGCCATTGTGTGG + Intronic
1090962749 11:131571858-131571880 TTGGTAATATGGGCTTTGGGAGG + Intronic
1091452328 12:580712-580734 TGTATACTATAGCCATTGGCAGG - Intronic
1097916077 12:65021607-65021629 TTAGTCCTAAAGCCATTAGGTGG - Intergenic
1100499510 12:95160336-95160358 TTTTTATTATAGCCATTGTGTGG - Intronic
1104916511 12:132267620-132267642 TTAGTACCACAGCCATTGGCAGG + Intronic
1112026852 13:95419251-95419273 TTGGCACTATTGACATTTGGAGG - Intergenic
1116584917 14:46691090-46691112 TTATTACTCTAGCCATTGGTTGG + Intergenic
1119943957 14:78672153-78672175 TTTGTACTAAAGACTTTGGGAGG + Intronic
1120190160 14:81433424-81433446 TTGGGACTTTATCCATTGGCAGG - Intronic
1120567842 14:86081505-86081527 TTGGTACTAAAGGCATTAGAAGG + Intergenic
1121873404 14:97429925-97429947 TGGGAAGTATGGCCATTGGGAGG - Intergenic
1135615376 16:23907058-23907080 TTGGCATTATTGACATTGGGGGG + Intronic
1138784246 16:59827691-59827713 TTGGTAGAATAACCATTAGGAGG - Intergenic
1146109569 17:30075843-30075865 TTGATCCTAAAGCCATTAGGTGG - Intronic
1150907490 17:69353579-69353601 TTGGTGCTATAATCATTGGGGGG + Intergenic
1152995324 18:401201-401223 TTGGTACTATCTGCATTCGGAGG + Intronic
1164289644 19:23855856-23855878 TTGGTCCCAGAGCCATTAGGTGG + Intergenic
1167805291 19:51779013-51779035 GTGGTAACACAGCCATTGGGAGG + Intronic
927335723 2:21921868-21921890 TTGGTACTATTTCCATTGTTTGG - Intergenic
930633232 2:53777277-53777299 TTGATACTATAATGATTGGGTGG - Intronic
933774325 2:85762753-85762775 TTGGCACTATCGACATTTGGGGG + Intronic
939134773 2:138280197-138280219 ATGGTCCCATAGCCATTTGGGGG + Intergenic
947507041 2:230715667-230715689 TTGCTACTATAACAAATGGGTGG + Intronic
948536504 2:238651165-238651187 TTTGTACTATAGCCATGTGATGG - Intergenic
1179841988 21:44082610-44082632 TTGATACAATAGCCTTTGGGGGG + Intronic
951918494 3:27827111-27827133 TTGGTCCTGTAGCCAGTGTGGGG - Intergenic
954792931 3:53146282-53146304 TGGGTACCAGAGCCCTTGGGAGG - Intergenic
955655465 3:61240495-61240517 TTGTTTCTATAGCCAGTTGGAGG - Intronic
955690425 3:61585410-61585432 TTGGTACTATAGCCATTGGGTGG + Intronic
961415665 3:126754833-126754855 TTGGTGCTTTGGCCTTTGGGAGG + Intronic
964089869 3:152862774-152862796 TTAGTCCTAAAGCCATTTGGTGG + Intergenic
965040866 3:163505309-163505331 TTGGAAATGTAGCCTTTGGGAGG - Intergenic
972101644 4:35427441-35427463 TTTATACTAAAACCATTGGGAGG - Intergenic
984310287 4:178049578-178049600 TTGGGATTATAGCACTTGGGAGG - Intergenic
993744504 5:91580233-91580255 TGGGTGCTATTGACATTGGGTGG + Intergenic
1006275785 6:33004767-33004789 TTTGCAATATAGCCATGGGGAGG - Exonic
1011324132 6:86130091-86130113 TTGGTCCTGTAGCCACTGGGTGG - Intergenic
1011476777 6:87756163-87756185 TTGGTGCTAAAGCCTTTAGGTGG - Intergenic
1017113465 6:150954158-150954180 TTGGTACTATAGGCATCCGTAGG - Intronic
1024376774 7:48648616-48648638 TGGGTACTATAAACATGGGGTGG + Intergenic
1029162375 7:98561789-98561811 TTGGTGGTAGAGCCAGTGGGAGG - Intergenic
1029320705 7:99756878-99756900 TTAGTCCTAAAGCCATTAGGTGG - Intergenic
1038915722 8:32019737-32019759 CTGGTACTATAGCAACTGTGTGG - Intronic
1042703947 8:71647065-71647087 TTGGAGGTATAGCCTTTGGGAGG - Intergenic
1043788416 8:84431892-84431914 TTGGTTATATACCCAGTGGGGGG + Intronic
1050048643 9:1575537-1575559 TTGGTACTATAGTCCTCAGGTGG + Intergenic
1185874355 X:3690157-3690179 TTGCTGCTATAACCAGTGGGTGG + Intronic
1186036225 X:5426292-5426314 GTGGGACTATAGTCATTGGAGGG + Intergenic
1187628280 X:21141438-21141460 TAGGTCCTAGAGCCTTTGGGTGG + Intergenic
1188132372 X:26452963-26452985 TTAGTTCTGAAGCCATTGGGTGG + Intergenic
1191801632 X:65087305-65087327 TCAGTACTAAAGCCATTAGGTGG - Intergenic
1193152799 X:78141670-78141692 ATGGTACTATAGTCTTAGGGTGG + Intergenic
1194035648 X:88868133-88868155 TTTGTATTCTAGCCAGTGGGAGG + Intergenic
1199311581 X:146327215-146327237 TTGATACCATAGATATTGGGTGG - Intergenic
1200806287 Y:7436762-7436784 TAGGTGCTATTGGCATTGGGTGG + Intergenic