ID: 955690425 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:61585410-61585432 |
Sequence | TTGGTACTATAGCCATTGGG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 62 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 4, 4: 57} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
955690420_955690425 | 6 | Left | 955690420 | 3:61585381-61585403 | CCTCAACACGCAGTCTTATGACT | 0: 1 1: 0 2: 0 3: 5 4: 72 |
||
Right | 955690425 | 3:61585410-61585432 | TTGGTACTATAGCCATTGGGTGG | 0: 1 1: 0 2: 0 3: 4 4: 57 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
955690425 | Original CRISPR | TTGGTACTATAGCCATTGGG TGG | Intronic | ||