ID: 955690425

View in Genome Browser
Species Human (GRCh38)
Location 3:61585410-61585432
Sequence TTGGTACTATAGCCATTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 57}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955690420_955690425 6 Left 955690420 3:61585381-61585403 CCTCAACACGCAGTCTTATGACT 0: 1
1: 0
2: 0
3: 5
4: 72
Right 955690425 3:61585410-61585432 TTGGTACTATAGCCATTGGGTGG 0: 1
1: 0
2: 0
3: 4
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955690425 Original CRISPR TTGGTACTATAGCCATTGGG TGG Intronic