ID: 955690426

View in Genome Browser
Species Human (GRCh38)
Location 3:61585411-61585433
Sequence TGGTACTATAGCCATTGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 2, 3: 2, 4: 81}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955690420_955690426 7 Left 955690420 3:61585381-61585403 CCTCAACACGCAGTCTTATGACT 0: 1
1: 0
2: 0
3: 5
4: 72
Right 955690426 3:61585411-61585433 TGGTACTATAGCCATTGGGTGGG 0: 1
1: 0
2: 2
3: 2
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955690426 Original CRISPR TGGTACTATAGCCATTGGGT GGG Intronic
904051694 1:27643675-27643697 TGGCACTAGAGCCACTGAGTGGG - Intergenic
904328430 1:29742583-29742605 TGGAACCATGGCCATGGGGTGGG - Intergenic
911293221 1:96082614-96082636 TGGTAATGTGGCCATTGGCTGGG + Intergenic
914089655 1:144485192-144485214 TGTTGCCATAGCAATTGGGTGGG + Intergenic
914308958 1:146449024-146449046 TGTTGCCATAGCAATTGGGTGGG - Intergenic
914593155 1:149124107-149124129 TGTTGCCATAGCAATTGGGTGGG + Intergenic
917733569 1:177900382-177900404 TGGGATTACAGCCACTGGGTTGG - Intergenic
921013746 1:211168545-211168567 TGGGGGTATAGGCATTGGGTAGG + Intergenic
922688282 1:227665043-227665065 TGGTATAATCCCCATTGGGTAGG - Intronic
1064157418 10:12915685-12915707 TGCTACTGGAGCCTTTGGGTAGG + Intronic
1065464438 10:26004049-26004071 TAGAACAAAAGCCATTGGGTGGG + Intronic
1069674443 10:70237630-70237652 AGGTAATATGGCCATTGGGCAGG - Intergenic
1075490726 10:122866655-122866677 TGTTACTATTGCCATTGTTTTGG + Intronic
1077380469 11:2234248-2234270 AGGTCCTATAGCCACAGGGTCGG + Intergenic
1078510990 11:11983821-11983843 TTGTTGTATAGGCATTGGGTCGG - Intronic
1079434966 11:20438520-20438542 GGGTACTAGAGTCATTGTGTAGG + Intronic
1079439944 11:20502261-20502283 TGGTATTATAGCCACTGCCTTGG + Intronic
1092725557 12:11482350-11482372 TGCTTCTAGACCCATTGGGTTGG - Intronic
1100499509 12:95160335-95160357 TTTTATTATAGCCATTGTGTGGG - Intronic
1105503079 13:20989068-20989090 TGGCACCGTAGCCCTTGGGTGGG + Exonic
1132174085 15:99694669-99694691 TCATACTGTAGCCTTTGGGTAGG + Intronic
1140576741 16:76179609-76179631 TTGTCATATAACCATTGGGTTGG + Intergenic
1143155291 17:4832876-4832898 TGTTGCCATAGCAATTGGGTGGG + Intergenic
1146109568 17:30075842-30075864 TGATCCTAAAGCCATTAGGTGGG - Intronic
1146437010 17:32859506-32859528 TGGTCCTAAAGCCATTGGGTTGG - Intronic
1153986627 18:10356779-10356801 GGTTACTATAGACAGTGGGTTGG - Intergenic
1167805292 19:51779014-51779036 TGGTAACACAGCCATTGGGAGGG + Intronic
925888121 2:8411082-8411104 TGGTACGGGAGCCACTGGGTTGG - Intergenic
927335722 2:21921867-21921889 TGGTACTATTTCCATTGTTTGGG - Intergenic
928499646 2:31876891-31876913 TGGTAATTTAGACAGTGGGTAGG - Intronic
931155254 2:59621540-59621562 TGGGACTATGGCCAGTGGCTTGG - Intergenic
932252918 2:70259777-70259799 TGGAATTACAGCCATGGGGTGGG + Intronic
933575938 2:84067772-84067794 TGTTACTATTGCAATTGTGTTGG + Intergenic
939737249 2:145862956-145862978 TGGTATTAAAGCCATTGGGTTGG - Intergenic
944304616 2:198165263-198165285 CGGTGCTAGAGCTATTGGGTGGG - Intronic
944737012 2:202576186-202576208 TGGAATAATAGACATTGGGTGGG - Intergenic
946897500 2:224339221-224339243 TGGAACAATAGACACTGGGTAGG + Intergenic
1170023905 20:11867810-11867832 TGGTACTGTTGCCACTGGATAGG + Intergenic
1171057933 20:21926070-21926092 TGGTCTTATAGCTAGTGGGTGGG + Intergenic
951807619 3:26663888-26663910 TTCTACTATAGCCTTTGAGTTGG + Intronic
953841461 3:46393090-46393112 TGGTTCTATAGGATTTGGGTAGG + Intergenic
955114605 3:55984930-55984952 TGGTACTGTAGTCAATGGATTGG + Intronic
955690426 3:61585411-61585433 TGGTACTATAGCCATTGGGTGGG + Intronic
966690192 3:182733532-182733554 TTGTAATTTAGCCATAGGGTTGG - Intergenic
967017810 3:185497630-185497652 TGCTACTATAACCCTTGGGCAGG - Intronic
968505822 4:971108-971130 GGGTAGGACAGCCATTGGGTAGG - Intronic
977811290 4:101358571-101358593 TGGTACTATAACCTTTAGATGGG - Intergenic
978714986 4:111831343-111831365 TGGTACCATATCCATTGGAGTGG - Intergenic
979921936 4:126508315-126508337 TGGTATTATAGCCAATGCTTTGG + Intergenic
979928664 4:126601695-126601717 TGGTATTAAAGCCATGGGGCTGG + Intergenic
988945727 5:36196307-36196329 TGGTACTTTAGCCATTCTGGTGG + Intronic
990257950 5:53991045-53991067 TGGAATTATACCCATGGGGTGGG - Intronic
991346209 5:65671490-65671512 AGTTTCTCTAGCCATTGGGTAGG + Intronic
993315091 5:86393791-86393813 TGGAAATGTAGCCATTGTGTTGG - Intergenic
993599825 5:89907938-89907960 TGGTACTATTGTCATTGTTTTGG - Intergenic
993744505 5:91580234-91580256 GGGTGCTATTGACATTGGGTGGG + Intergenic
996063588 5:119057555-119057577 TAGTACTATTGGCATTTGGTGGG - Intronic
996618215 5:125467506-125467528 TGTTACTATAGCCATTGGTCTGG + Intergenic
1002038378 5:176491296-176491318 TGGTACTATACAAATAGGGTAGG + Intronic
1002521272 5:179794339-179794361 TGGTAGGATAGCCATGGGCTTGG + Intronic
1005379687 6:25220598-25220620 TGGTGCTAAAGCTATTGGGGTGG - Intergenic
1008012894 6:46487872-46487894 TGCTACTAGAACCATTGGTTTGG - Intronic
1008751979 6:54746068-54746090 GGGCACTATAGCCACTGGGATGG + Intergenic
1011022002 6:82825065-82825087 TAGTTCTAAAGCCATTAGGTAGG + Intergenic
1011476776 6:87756162-87756184 TGGTGCTAAAGCCTTTAGGTGGG - Intergenic
1015370566 6:132446976-132446998 GGGTACCATAGACACTGGGTTGG + Exonic
1015813717 6:137186352-137186374 TGTGCCTATGGCCATTGGGTTGG + Intergenic
1017462325 6:154663043-154663065 TGGTACAAGAGCCCTTGGGTTGG - Intergenic
1019873800 7:3791278-3791300 TGGAACTACAGCCAGTGAGTAGG + Intronic
1025195905 7:56933139-56933161 TGTTACTATTGCCATTGTTTGGG + Intergenic
1025676043 7:63643797-63643819 TGTTACTATTGCCATTGTTTGGG - Intergenic
1028276115 7:88858879-88858901 TGGTTCTATAGCTATAAGGTAGG + Intronic
1029320704 7:99756877-99756899 TAGTCCTAAAGCCATTAGGTGGG - Intergenic
1029735293 7:102462290-102462312 TTGTTCCATAGCCATCGGGTTGG + Intronic
1030626790 7:111853679-111853701 TGGGATTAAAGCCAGTGGGTGGG - Intronic
1034721359 7:153296710-153296732 TGGCACAATAATCATTGGGTAGG - Intergenic
1039455522 8:37703391-37703413 TGTTATTACAGCCATTGGGGAGG - Intergenic
1045748691 8:105455879-105455901 TGGTAATATAGCCAGGGGCTTGG + Intronic
1050048644 9:1575538-1575560 TGGTACTATAGTCCTCAGGTGGG + Intergenic
1051029473 9:12657679-12657701 TGGAGATCTAGCCATTGGGTGGG - Intergenic
1185874356 X:3690158-3690180 TGCTGCTATAACCAGTGGGTGGG + Intronic
1186036226 X:5426293-5426315 TGGGACTATAGTCATTGGAGGGG + Intergenic
1189072426 X:37877902-37877924 TGGTACTATTGTCATTGTTTAGG + Intronic
1198510331 X:137344020-137344042 TGGTAGAATTGTCATTGGGTTGG - Intergenic
1199311580 X:146327214-146327236 TGATACCATAGATATTGGGTGGG - Intergenic
1200806288 Y:7436763-7436785 AGGTGCTATTGGCATTGGGTGGG + Intergenic