ID: 955690426

View in Genome Browser
Species Human (GRCh38)
Location 3:61585411-61585433
Sequence TGGTACTATAGCCATTGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 2, 3: 2, 4: 81}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955690420_955690426 7 Left 955690420 3:61585381-61585403 CCTCAACACGCAGTCTTATGACT 0: 1
1: 0
2: 0
3: 5
4: 72
Right 955690426 3:61585411-61585433 TGGTACTATAGCCATTGGGTGGG 0: 1
1: 0
2: 2
3: 2
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955690426 Original CRISPR TGGTACTATAGCCATTGGGT GGG Intronic