ID: 955701463

View in Genome Browser
Species Human (GRCh38)
Location 3:61686033-61686055
Sequence CAAGTGCTCCTCACGGTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 114}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955701463_955701470 12 Left 955701463 3:61686033-61686055 CCCTGCACCGTGAGGAGCACTTG 0: 1
1: 0
2: 0
3: 4
4: 114
Right 955701470 3:61686068-61686090 TCATTCCCGTGGTCTTGCGTGGG 0: 1
1: 0
2: 0
3: 0
4: 34
955701463_955701467 1 Left 955701463 3:61686033-61686055 CCCTGCACCGTGAGGAGCACTTG 0: 1
1: 0
2: 0
3: 4
4: 114
Right 955701467 3:61686057-61686079 TGCTCGTTACCTCATTCCCGTGG 0: 1
1: 0
2: 0
3: 1
4: 23
955701463_955701472 16 Left 955701463 3:61686033-61686055 CCCTGCACCGTGAGGAGCACTTG 0: 1
1: 0
2: 0
3: 4
4: 114
Right 955701472 3:61686072-61686094 TCCCGTGGTCTTGCGTGGGGAGG 0: 1
1: 0
2: 0
3: 2
4: 66
955701463_955701474 17 Left 955701463 3:61686033-61686055 CCCTGCACCGTGAGGAGCACTTG 0: 1
1: 0
2: 0
3: 4
4: 114
Right 955701474 3:61686073-61686095 CCCGTGGTCTTGCGTGGGGAGGG 0: 1
1: 0
2: 0
3: 1
4: 95
955701463_955701471 13 Left 955701463 3:61686033-61686055 CCCTGCACCGTGAGGAGCACTTG 0: 1
1: 0
2: 0
3: 4
4: 114
Right 955701471 3:61686069-61686091 CATTCCCGTGGTCTTGCGTGGGG 0: 1
1: 0
2: 0
3: 3
4: 47
955701463_955701469 11 Left 955701463 3:61686033-61686055 CCCTGCACCGTGAGGAGCACTTG 0: 1
1: 0
2: 0
3: 4
4: 114
Right 955701469 3:61686067-61686089 CTCATTCCCGTGGTCTTGCGTGG 0: 1
1: 0
2: 0
3: 2
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955701463 Original CRISPR CAAGTGCTCCTCACGGTGCA GGG (reversed) Intronic
900933101 1:5748880-5748902 CAGTTGCTCCTGAAGGTGCAGGG - Intergenic
908207632 1:61867748-61867770 TAAGTGTTCCTCACTGTGGAAGG - Intronic
910176846 1:84440095-84440117 CAAGTGCTATTAACTGTGCATGG + Intergenic
912968947 1:114262242-114262264 CTAGTGCTCATCACTTTGCAGGG - Intergenic
915731328 1:158056374-158056396 CAATTCCTCCTCACAGGGCAGGG + Intronic
918720701 1:187849004-187849026 AAAGTGTTCCTCATGGGGCAAGG + Intergenic
920864664 1:209741903-209741925 CAGGTGCTCCTCTAGGTGCTGGG - Intergenic
1063610900 10:7561306-7561328 CAAGTGCTCCACAGGGGACAGGG + Exonic
1069960229 10:72075110-72075132 CAGGAGCTCCTCAGGGTTCAGGG + Intronic
1083163605 11:60870379-60870401 GAAGTTCTTCTCACGATGCAGGG - Exonic
1084519757 11:69656021-69656043 CATGTGCTCCTCTCCCTGCATGG - Intronic
1085026384 11:73239066-73239088 AAAGTCCTCCTCACAGTGCCTGG + Intergenic
1089598994 11:119601850-119601872 GAAGTGCTCAGCACAGTGCATGG + Intergenic
1093743306 12:22712545-22712567 AAATTGCTTCACACGGTGCATGG + Intergenic
1097924091 12:65108656-65108678 CAGGTGCTCCTCACCTTTCATGG + Intronic
1098324894 12:69290972-69290994 CAATTGCTCCACGCTGTGCAGGG - Intergenic
1103851572 12:123937008-123937030 CCAGTGGTGCTCACAGTGCATGG + Exonic
1112080734 13:95967400-95967422 CACGTGCTCCTCAAAGTGCTGGG + Intronic
1112238926 13:97661822-97661844 CAACTCCTCCTCACTCTGCAAGG - Intergenic
1116028063 14:39537818-39537840 TCAGTTCTCCTCACGGGGCAGGG + Intergenic
1119546483 14:75475508-75475530 CTAGTGCCCGTCACGGTGCCTGG + Intergenic
1120606422 14:86583936-86583958 CAAGTGCCCATCATGGAGCAAGG + Intergenic
1120702489 14:87713286-87713308 CAGGTGCTCCAAACGGTGAAAGG + Intergenic
1121658480 14:95616304-95616326 CAAGTGCCCCTCATGGTGTCTGG - Intergenic
1122071295 14:99207313-99207335 CAAAGGCTCATCAAGGTGCAGGG - Intronic
1125458866 15:39889109-39889131 CCAGTGCTCCTGACATTGCAAGG + Intronic
1129457262 15:75682633-75682655 CAAGTGCTCCTCTCGCTGAAGGG - Exonic
1130054298 15:80509111-80509133 CACGTGCTCTTCAAGGTGCCCGG + Intronic
1130224914 15:82048844-82048866 CAAGTGTTCCTCTCTGTGGAGGG - Intergenic
1132565598 16:621163-621185 CAGGTGCTTCTCCCGGGGCAAGG - Intronic
1135775623 16:25255360-25255382 GGAGTGCTTCTCCCGGTGCACGG + Exonic
1137626622 16:49912840-49912862 GAAGTGCTACCCACGGTGCTGGG - Intergenic
1142244354 16:88962698-88962720 CCTGTGGTCCTCACGGTGCTCGG + Intronic
1143628361 17:8123467-8123489 CACGTGCGCCGCACGGTGCCGGG + Intronic
1144461956 17:15465819-15465841 CATGTCCTCCCCACGGTGGATGG - Intronic
1147455776 17:40537190-40537212 CTGGTGCCCGTCACGGTGCAGGG - Intergenic
1148786464 17:50148458-50148480 AAAGTGCCCCTCCCTGTGCAAGG + Intronic
1149090960 17:52778809-52778831 CAACTGCTTATCATGGTGCAGGG - Intergenic
1149658646 17:58323397-58323419 CAAGTGCTCCTCATGAGGGAAGG + Intronic
1149740545 17:59041586-59041608 AAAGTGCTTCTCACAGTGCCTGG + Intronic
1150765613 17:67999454-67999476 CAAGTTATCCTCAGGGTGCTTGG + Intergenic
1152243757 17:79174786-79174808 CACCTGCTCCTCACTGTGCCGGG - Intronic
1152360367 17:79830547-79830569 CAAGTGCTCCTCTCTCTGCCTGG + Intergenic
1152987307 18:332530-332552 CAAATGCCTCTCACGGTGCCTGG + Intronic
1153720709 18:7899104-7899126 CTAGTGCTCCTGAGAGTGCAAGG - Intronic
1153721011 18:7903137-7903159 CAAGTGCTTATCACAGTGCCTGG + Intronic
1155117503 18:22783985-22784007 CCATCGCTCCTCACTGTGCAGGG - Intergenic
1160020501 18:75177013-75177035 CAAGTGCTTCACACCGTGCCTGG + Intergenic
1163437612 19:17304697-17304719 CAAGGGCTCCTCAAGGGCCAGGG - Intronic
1163775335 19:19213986-19214008 CATGTGCTCCACCCGGTGCACGG + Intronic
1165860926 19:38908956-38908978 CAAGTGCTGCTCACGGAGGCAGG + Intergenic
925146340 2:1585659-1585681 CACGTGCTCCCCAGGGTGGAGGG - Intergenic
925991694 2:9259858-9259880 CAGGGGCTCATCAGGGTGCAAGG - Intronic
926944345 2:18170772-18170794 CAATTGCTGTTCAGGGTGCAGGG - Intronic
928204322 2:29273220-29273242 CACGTGCCCAGCACGGTGCATGG - Intronic
928483265 2:31705112-31705134 CAAGAGCTCATCTCGGTGGAAGG - Intergenic
929910470 2:46085303-46085325 AAAGTGGCCCTCACAGTGCATGG + Intronic
933052074 2:77612364-77612386 CCAGTCCTCCTCACTGGGCAGGG + Intergenic
935757110 2:106284812-106284834 CAAGGGCTTCTCCCAGTGCAGGG + Intergenic
936518033 2:113194423-113194445 CAAGTGCTCAGCACGGTGCTTGG + Intronic
938236933 2:129712778-129712800 CTATAGCTCCTCACGGTGAACGG - Intergenic
942633924 2:177981201-177981223 CAAGTGCTCATCAAAGGGCATGG + Intronic
943539119 2:189189549-189189571 CAAGTGGTCCTCACCATGCCTGG - Intergenic
944883712 2:204041807-204041829 CCAGTGCCTATCACGGTGCATGG - Intergenic
1170903795 20:20492511-20492533 CTAGTGCTCCTTACTGTGGAAGG - Intronic
1171499864 20:25585312-25585334 CGGGTGCTCCTCGCGGTGCGGGG - Intronic
1172963692 20:38817619-38817641 CAAGTGCTGAGCACGGTGCCTGG + Intronic
1173522711 20:43711495-43711517 CAAGTCCTCCTCCAGGTGCGGGG - Exonic
1174763835 20:53232791-53232813 AAAGTGCTTCACACGGTGCTTGG - Intronic
1175308458 20:57994306-57994328 CAAGAGCTCAGCACGGTGCCCGG + Intergenic
1175634029 20:60565761-60565783 CATCTGTTCCTCACAGTGCAGGG + Intergenic
1178520188 21:33282952-33282974 CAGGTGCTCCTCTCAGTTCAGGG - Intronic
1183150055 22:36029701-36029723 AAAGTGCTCCTCAGGCAGCAAGG - Intergenic
949251109 3:1984985-1985007 CAGGTGCTCCACATGATGCAAGG + Intergenic
950735933 3:15008088-15008110 CAAGTTCTCCCCATGGTGCCAGG - Intronic
952224149 3:31357060-31357082 CTAATGCGCCTCACGGGGCATGG + Intergenic
953907485 3:46875621-46875643 CAACTGCTCCACAATGTGCATGG + Intronic
955701463 3:61686033-61686055 CAAGTGCTCCTCACGGTGCAGGG - Intronic
956029693 3:65024263-65024285 CAAGTGCTTGGCACGGGGCAGGG - Intergenic
956149678 3:66227642-66227664 CAAGCGGTCCTCACTTTGCATGG - Intronic
958497548 3:94864211-94864233 CAAGTTCTCTGCATGGTGCAGGG + Intergenic
961492627 3:127265862-127265884 CAAGTGCCTCTCACTGTGCCTGG - Intergenic
961809791 3:129515154-129515176 CACGTGCTCCGCACGGTGCCCGG + Intronic
962087506 3:132207478-132207500 CAAGTGCTCACCCTGGTGCAAGG - Intronic
968941465 4:3640854-3640876 CAAGGGCTCCCCAAGGAGCATGG + Intergenic
972707337 4:41558054-41558076 CAAGGACCCCTCACGGTGCCTGG + Intronic
972832539 4:42831614-42831636 AAAGTGCTCTGCACAGTGCATGG - Intergenic
977979702 4:103307341-103307363 CAGCTGCTCCTCACCGTGGAGGG - Intergenic
979671371 4:123363401-123363423 CAAGTGCCCCTCATGGGCCAGGG - Intergenic
985710097 5:1423118-1423140 CCAGTGCTGCCCACGGTGCTAGG + Intronic
988491895 5:31712128-31712150 CAAGTGCTCCTCAGGGCTCTGGG - Intronic
990231392 5:53716428-53716450 CGATTGCTCCTCACCGGGCAGGG + Intergenic
997267518 5:132503845-132503867 CAGGTGCTCATCACTGTGCCTGG + Intergenic
1001027328 5:168235270-168235292 CAAGTGCTGCTCACCATGTAAGG - Intronic
1004150315 6:13113098-13113120 CAAGTGATCCTCACACTTCAGGG - Intronic
1005356817 6:24992299-24992321 CAGGTACTCCTCACTTTGCATGG + Intronic
1015340730 6:132097283-132097305 CAAGTGCTTCCCAAGGGGCATGG + Intergenic
1015799865 6:137049361-137049383 CATTTGCTCCTCACATTGCAAGG - Intergenic
1019094752 6:169570185-169570207 CAGGTGCTCTTCATGGAGCATGG + Intronic
1023833753 7:44056736-44056758 CAAGTGCTGCTCCTGCTGCAGGG + Exonic
1034219449 7:149432694-149432716 CAGGTGCCGCTCACCGTGCACGG + Exonic
1037207993 8:16348178-16348200 CAGGTGCTCCTGAAGGTCCAAGG - Intronic
1038499362 8:28030609-28030631 CAAGTGCTTCCCATGGTGCCTGG + Intronic
1038868298 8:31463976-31463998 CAAGTGGTCTTCAAGGTTCATGG + Intergenic
1042803266 8:72744330-72744352 CAAGTGCTGCTCACTGTGGTAGG - Intronic
1049030617 8:140034690-140034712 GAAGTGCTGCTCACAGTGCCTGG - Intronic
1053435666 9:38072503-38072525 CAAGAGCTCCTCAAGCTGCTAGG + Intergenic
1053567581 9:39269375-39269397 CACTTGCTCCTCACTGTGAAAGG + Intronic
1053833594 9:42110324-42110346 CACTTGCTCCTCACTGTGAAAGG + Intronic
1054129562 9:61349623-61349645 CACTTGCTCCTCACTGTGAAAGG - Intergenic
1054596956 9:67077088-67077110 CACTTGCTCCTCACTGTGAAAGG - Intergenic
1058861168 9:109119247-109119269 CAGCTGTTCCTCCCGGTGCAGGG - Intronic
1060282337 9:122222867-122222889 CAAGAGCTCCCAACGGGGCAAGG - Intronic
1060796866 9:126518020-126518042 CAAGTGTTCCCCACTCTGCAAGG - Intergenic
1061385066 9:130284859-130284881 GAAGTACTCGTCACGGTGCTGGG + Intronic
1061407897 9:130402875-130402897 CACGTCTTCCTCACTGTGCAAGG + Intronic
1062083068 9:134634561-134634583 CCAGTGCTCCACACTGTGGAGGG - Intergenic
1189001911 X:36957382-36957404 GAAATGCTCCTGACGGGGCAAGG + Intergenic
1190178839 X:48174366-48174388 CAAGTGCTCATCACCATGCCCGG + Intergenic