ID: 955701464

View in Genome Browser
Species Human (GRCh38)
Location 3:61686034-61686056
Sequence CCAAGTGCTCCTCACGGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 159}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955701464_955701467 0 Left 955701464 3:61686034-61686056 CCTGCACCGTGAGGAGCACTTGG 0: 1
1: 0
2: 0
3: 9
4: 159
Right 955701467 3:61686057-61686079 TGCTCGTTACCTCATTCCCGTGG 0: 1
1: 0
2: 0
3: 1
4: 23
955701464_955701470 11 Left 955701464 3:61686034-61686056 CCTGCACCGTGAGGAGCACTTGG 0: 1
1: 0
2: 0
3: 9
4: 159
Right 955701470 3:61686068-61686090 TCATTCCCGTGGTCTTGCGTGGG 0: 1
1: 0
2: 0
3: 0
4: 34
955701464_955701471 12 Left 955701464 3:61686034-61686056 CCTGCACCGTGAGGAGCACTTGG 0: 1
1: 0
2: 0
3: 9
4: 159
Right 955701471 3:61686069-61686091 CATTCCCGTGGTCTTGCGTGGGG 0: 1
1: 0
2: 0
3: 3
4: 47
955701464_955701474 16 Left 955701464 3:61686034-61686056 CCTGCACCGTGAGGAGCACTTGG 0: 1
1: 0
2: 0
3: 9
4: 159
Right 955701474 3:61686073-61686095 CCCGTGGTCTTGCGTGGGGAGGG 0: 1
1: 0
2: 0
3: 1
4: 95
955701464_955701469 10 Left 955701464 3:61686034-61686056 CCTGCACCGTGAGGAGCACTTGG 0: 1
1: 0
2: 0
3: 9
4: 159
Right 955701469 3:61686067-61686089 CTCATTCCCGTGGTCTTGCGTGG 0: 1
1: 0
2: 0
3: 2
4: 44
955701464_955701472 15 Left 955701464 3:61686034-61686056 CCTGCACCGTGAGGAGCACTTGG 0: 1
1: 0
2: 0
3: 9
4: 159
Right 955701472 3:61686072-61686094 TCCCGTGGTCTTGCGTGGGGAGG 0: 1
1: 0
2: 0
3: 2
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955701464 Original CRISPR CCAAGTGCTCCTCACGGTGC AGG (reversed) Intronic
900365554 1:2310689-2310711 CCAGGAGCTCCTCAGGGAGCTGG - Intergenic
901561787 1:10077536-10077558 CCATGTGCTAAGCACGGTGCTGG - Intronic
910955785 1:92703005-92703027 CTAAGTGCTCTTAACAGTGCTGG + Intronic
911745289 1:101435151-101435173 CCAAGTGATCCTCATATTGCTGG + Intergenic
917941056 1:179922062-179922084 CCAGGAACTCCTCACGCTGCTGG - Intronic
920864665 1:209741904-209741926 CCAGGTGCTCCTCTAGGTGCTGG - Intergenic
921902247 1:220463267-220463289 CCAAGGGCTCCCAAGGGTGCAGG - Intergenic
922419424 1:225449562-225449584 CCAGGTGCTCCTCAGGGGCCAGG - Intergenic
922749232 1:228062926-228062948 CCAGGGCCTCCTCACAGTGCTGG + Intergenic
923223884 1:231921308-231921330 CCATGTGCTCTTCACTGTGCTGG - Intronic
1063610899 10:7561305-7561327 CCAAGTGCTCCACAGGGGACAGG + Exonic
1069743792 10:70702167-70702189 CCCAGGGCTCCTCAAGGTCCTGG + Intronic
1069960228 10:72075109-72075131 CCAGGAGCTCCTCAGGGTTCAGG + Intronic
1071989341 10:91085386-91085408 TCAAGTGATCCTCTTGGTGCAGG + Intergenic
1072507989 10:96089726-96089748 CGAGGTGCTCCTCACCGTGGAGG - Intergenic
1074365144 10:112851778-112851800 CCAAGTGCCCCTCCCTGAGCTGG - Intergenic
1074955288 10:118383000-118383022 CCAAGTGATGCTAATGGTGCAGG - Intergenic
1076305234 10:129461469-129461491 GCTGGTGCTCCTCACGATGCAGG - Intergenic
1076626593 10:131824773-131824795 CCGAGTCCTCTTCACGGGGCTGG + Intergenic
1077123582 11:922376-922398 CTGAGTGCTCATCACGGGGCGGG - Intergenic
1078068207 11:8091751-8091773 CCAGCTGCTCCTCACAGAGCTGG + Intronic
1078355092 11:10627144-10627166 CCACGTGCTGCTCACGGCCCAGG - Intronic
1082693311 11:56330850-56330872 CCAACTGTTCCTCAGGGTGAGGG + Intergenic
1083167985 11:60903292-60903314 CCAGGTGCTGCTCTCAGTGCTGG + Intronic
1084432636 11:69120071-69120093 CCAAGCACACCTCACAGTGCTGG + Intergenic
1086051140 11:82591940-82591962 CCAAATTCCCCTAACGGTGCTGG - Intergenic
1089098145 11:115936955-115936977 CTATGTGCTCATCACTGTGCTGG - Intergenic
1090452039 11:126815163-126815185 CTAATTGCTCCTCATGGTCCTGG - Intronic
1090496363 11:127216737-127216759 GCCAGGGTTCCTCACGGTGCTGG + Intergenic
1091675284 12:2484668-2484690 CCAAGTGCTACTCGAGGTGGTGG - Intronic
1096976251 12:55700686-55700708 CCAAGTGTTCCTCAACATGCTGG - Intronic
1098196239 12:68004797-68004819 CCAAGTGCTCCAAACAGTGATGG + Intergenic
1098324895 12:69290973-69290995 CCAATTGCTCCACGCTGTGCAGG - Intergenic
1100197438 12:92262942-92262964 CCAAGTACTCTTCTTGGTGCTGG + Intergenic
1103067547 12:117912711-117912733 CCAAGTGCTCAACAAGGAGCTGG + Intronic
1103335091 12:120183467-120183489 CCAAGTGCTTTTCTGGGTGCTGG - Intronic
1104437381 12:128766788-128766810 CCAAGTGCTTTCCACGGCGCTGG + Intergenic
1106933146 13:34689086-34689108 CAAGGTGCTCCTGACAGTGCAGG - Intergenic
1112080733 13:95967399-95967421 CCACGTGCTCCTCAAAGTGCTGG + Intronic
1112325027 13:98438392-98438414 CCCAGGGCTCCCCACGGTGAGGG - Intronic
1114089470 14:19272133-19272155 CCAAGAGCACCTCTGGGTGCTGG + Intergenic
1115512205 14:34148563-34148585 TCAAGTGCTCTTCACGAAGCTGG - Intronic
1115768485 14:36647332-36647354 CCACTCGCTCCCCACGGTGCTGG - Intergenic
1116028062 14:39537817-39537839 CTCAGTTCTCCTCACGGGGCAGG + Intergenic
1118325139 14:64775289-64775311 CCAGGCGCTCCTCAAGGTCCTGG + Exonic
1121400819 14:93675361-93675383 CCAGGTGCTCTGCAGGGTGCTGG + Intronic
1121617755 14:95324328-95324350 CTATGTGCTCAGCACGGTGCTGG - Intergenic
1125882734 15:43208232-43208254 CCAAGTGCTCCTAATGGAGGTGG - Exonic
1128562130 15:68675826-68675848 CCCAGTGCTTCCCACAGTGCCGG - Intronic
1129382717 15:75178194-75178216 AAAAGGGCTCCCCACGGTGCCGG + Intergenic
1129457263 15:75682634-75682656 GCAAGTGCTCCTCTCGCTGAAGG - Exonic
1132975002 16:2706735-2706757 CCAAGTGCAGATCACGCTGCGGG - Intronic
1133230605 16:4364760-4364782 CCAAGTCCCCCTCACCTTGCGGG + Exonic
1136643509 16:31588747-31588769 CCCAGTGCTCCTCACTGAGGGGG - Intergenic
1137242525 16:46668745-46668767 CTAAGTGTTCCTAACGGTGATGG - Intronic
1137476584 16:48814725-48814747 TCAAGTGCTCCTGAGTGTGCGGG + Intergenic
1137598922 16:49743230-49743252 CCAACTCCTCCTCACCGTTCAGG + Intronic
1137626623 16:49912841-49912863 TGAAGTGCTACCCACGGTGCTGG - Intergenic
1141789597 16:86225564-86225586 CCATGTGCTCCATATGGTGCTGG - Intergenic
1142499257 17:323300-323322 CCAAGCAGTGCTCACGGTGCTGG + Intronic
1143628360 17:8123466-8123488 GCACGTGCGCCGCACGGTGCCGG + Intronic
1144054755 17:11530028-11530050 CCTAGTGCTGCTCAGGGTGAGGG + Intronic
1144724137 17:17493108-17493130 ACAAGGGCTCCTCACGGGGGTGG + Exonic
1147455777 17:40537191-40537213 CCTGGTGCCCGTCACGGTGCAGG - Intergenic
1149550190 17:57534059-57534081 CCAAGTGCTTAGCACAGTGCTGG + Intronic
1149570980 17:57672155-57672177 GCACTTGCTCATCACGGTGCCGG - Intronic
1149928059 17:60722376-60722398 CCAAGTGCTGCTGAGGATGCAGG - Intronic
1152243758 17:79174787-79174809 TCACCTGCTCCTCACTGTGCCGG - Intronic
1152786483 17:82250570-82250592 CCAAGTACTCCCCACGCTGATGG + Intronic
1152786760 17:82252212-82252234 CCAAGTACTCCCCACGCTGATGG + Intronic
1155117505 18:22783986-22784008 CCCATCGCTCCTCACTGTGCAGG - Intergenic
1155464507 18:26120335-26120357 CCAATTCCTCCTCATGGGGCAGG + Intergenic
1160266623 18:77344174-77344196 CCACGTGCTCCTCAGGAAGCTGG - Intergenic
1160902118 19:1433865-1433887 CCACGTCCACCTCCCGGTGCAGG - Intronic
1161220045 19:3114210-3114232 CCAGGGCCTCCTCGCGGTGCCGG + Intronic
1163020183 19:14477464-14477486 CCTGGTGCTCCCCACGGTCCGGG + Intergenic
1164431762 19:28194820-28194842 CCAGGTGATCCCCATGGTGCTGG + Intergenic
1165914968 19:39252892-39252914 CCCAGGGCTCCTCCCTGTGCTGG - Intergenic
1166891693 19:45998071-45998093 CCATGTGCTCTTCTAGGTGCTGG - Intronic
1167337643 19:48896499-48896521 CCAGGAGCTCCTCATGGTTCAGG - Exonic
925293855 2:2765381-2765403 CCAGCTGCCCCCCACGGTGCAGG + Intergenic
926171417 2:10555163-10555185 CCCAGTGCTCCTTTGGGTGCTGG + Intergenic
927061708 2:19429177-19429199 CCAAGTGATCCTGATGCTGCTGG - Intergenic
927880373 2:26686057-26686079 CCAAGTGCTCATCACCATCCTGG + Intergenic
928775519 2:34757718-34757740 AGAAGTGCTGCTCATGGTGCTGG + Intergenic
933052072 2:77612363-77612385 CCCAGTCCTCCTCACTGGGCAGG + Intergenic
935622766 2:105143932-105143954 CCAAGTCCTCCTCCCGCGGCCGG - Intergenic
946503659 2:220276331-220276353 CTCAGTGCTCATCACAGTGCTGG + Intergenic
948809544 2:240467586-240467608 CCAAGTCCTCCTCCCCCTGCAGG - Exonic
948888496 2:240895856-240895878 GAACGTGCTGCTCACGGTGCTGG - Exonic
1170083670 20:12505253-12505275 CCAAGTGATCCTCATATTGCAGG + Intergenic
1171499865 20:25585313-25585335 TCGGGTGCTCCTCGCGGTGCGGG - Intronic
1172193427 20:33075974-33075996 CCAAGAGCTCCTCAAGGTCAGGG + Intergenic
1172645815 20:36468611-36468633 CCAGGTGCCCCTCACCCTGCTGG + Intronic
1173522712 20:43711496-43711518 TCAAGTCCTCCTCCAGGTGCGGG - Exonic
1174119225 20:48249806-48249828 CCAAGTGCTGGACAAGGTGCTGG - Intergenic
1174224335 20:48984813-48984835 CCAGGCGCTCCTCCTGGTGCAGG - Exonic
1175089431 20:56489643-56489665 CCATGTCCTCCTAACGGTGCTGG + Intronic
1175583341 20:60117614-60117636 CAAATTGCTCCTCAGAGTGCTGG + Intergenic
1175634028 20:60565760-60565782 CCATCTGTTCCTCACAGTGCAGG + Intergenic
1176009745 20:62886568-62886590 CCACCTGCTTCTCAGGGTGCAGG + Intronic
1179418031 21:41214060-41214082 ACACGTGCTCCTCATGGTGCTGG - Intronic
1179503296 21:41823184-41823206 ACATGTGCTGCTCACGGTTCTGG - Intronic
1179889416 21:44328066-44328088 CCAAGAGCCCCTCACTGTGTTGG + Intergenic
1179893258 21:44348338-44348360 CAAAGTGTTTCTCACGGTGTGGG - Intergenic
1180491235 22:15850214-15850236 CCAAGAGCACCTCTGGGTGCTGG - Intergenic
1181340646 22:22177055-22177077 CCAAGTCCTCCTCTGTGTGCGGG - Intergenic
1185131230 22:49040211-49040233 CCAAGTGCTGGTCACGGTGAGGG + Intergenic
950210207 3:11117534-11117556 CCAGGTCCTCCTCCCGGGGCTGG + Intergenic
950983232 3:17331583-17331605 CCAGGTGCTGTTCAGGGTGCTGG + Intronic
955701464 3:61686034-61686056 CCAAGTGCTCCTCACGGTGCAGG - Intronic
958497547 3:94864210-94864232 CCAAGTTCTCTGCATGGTGCAGG + Intergenic
958745358 3:98127476-98127498 CCAAGTTCCCCTCAAGGTCCTGG + Intergenic
962233812 3:133691367-133691389 CTAGGTGCTCCTCTAGGTGCTGG + Intergenic
962990308 3:140572044-140572066 CCAAGAGCTCCTCATGGTCAGGG - Exonic
965118336 3:164520188-164520210 CCAAGGGCTCCTCAGTGAGCAGG + Intergenic
966855720 3:184192829-184192851 CCAGCTGCTCCACATGGTGCTGG - Exonic
967005776 3:185380773-185380795 CCAAGTGATGCTAACGCTGCTGG + Intronic
968555914 4:1246389-1246411 CCAGGTGGTGCTGACGGTGCAGG - Intronic
970036428 4:11740846-11740868 CCAGGTACTCTTCTCGGTGCTGG - Intergenic
971257436 4:25028385-25028407 CCACGGTCTCCTCACGGAGCTGG + Intronic
979671372 4:123363402-123363424 CCAAGTGCCCCTCATGGGCCAGG - Intergenic
983731188 4:170995721-170995743 CCAAGTTCTTCTCACAGTGATGG - Intergenic
985103971 4:186483948-186483970 GCAAGTGCTCCTCAGGTGGCTGG - Intronic
985709907 5:1422371-1422393 CCCAGTGCTGCCCAAGGTGCTGG + Intronic
985709963 5:1422597-1422619 CCCAGTGCTGCCCATGGTGCTGG + Intronic
985709973 5:1422633-1422655 CCCAGTGCTGCCCATGGTGCTGG + Intronic
985709983 5:1422669-1422691 CCCAGTGCTGCCCATGGTGCTGG + Intronic
985709994 5:1422707-1422729 CACAGTGCTGCCCACGGTGCTGG + Intronic
985710003 5:1422743-1422765 CCCAGTGCTGCCCAAGGTGCTGG + Intronic
985710014 5:1422781-1422803 CACAGTGCTGCCCACGGTGCTGG + Intronic
985710031 5:1422855-1422877 CCCAGTGCTGCCCATGGTGCTGG + Intronic
985710068 5:1423005-1423027 CCCAGTGCTGCCCAAGGTGCTGG + Intronic
985710113 5:1423191-1423213 CCCAGTGCTGCCCATGGTGCTGG + Intronic
985710134 5:1423267-1423289 CACAGTGCTGCCCACGGTGCTGG + Intronic
985710143 5:1423303-1423325 CCCAGTGCTGCCCATGGTGCTGG + Intronic
986440601 5:7778119-7778141 CCAACTGCTCTTCAAGGTGATGG + Intronic
988491896 5:31712129-31712151 ACAAGTGCTCCTCAGGGCTCTGG - Intronic
999049777 5:148509901-148509923 CCCATTTCTCCTCATGGTGCTGG - Exonic
1004048269 6:12047482-12047504 CCTCGTGGTCCCCACGGTGCTGG + Intronic
1008598583 6:53066252-53066274 CCCAGGGCTCCTCAAGGTGCCGG - Intronic
1009687832 6:66986671-66986693 CCAAGGGCTCCTCAATTTGCAGG + Intergenic
1015148752 6:130016765-130016787 CTAAGTGCTCTGCAAGGTGCTGG - Intronic
1021987149 7:26107872-26107894 CCAAGTGGTCCTCACGGAGTGGG - Intergenic
1023676421 7:42634885-42634907 CCAACTGCTCCTCACCTAGCTGG + Intergenic
1026890181 7:73977294-73977316 CCCAGGGCTCCTCCCTGTGCAGG + Intergenic
1031377598 7:121047481-121047503 CCATGTGCTAATCACTGTGCTGG + Intronic
1033437102 7:141343105-141343127 CCAAGCGATGCTCACGCTGCTGG + Intronic
1034336998 7:150330218-150330240 CCAAGAGCTCCTCAAAGGGCTGG - Exonic
1034760102 7:153664355-153664377 CCAAGTGTTCTCCAAGGTGCTGG + Intergenic
1038525868 8:28272857-28272879 CCTAGAGCTCCTCAGGGTGATGG - Intergenic
1041732628 8:61077779-61077801 CCCTGTGCTCCTCCCAGTGCTGG - Intronic
1045706587 8:104930476-104930498 CCAAGTGCTGGACACTGTGCTGG - Intronic
1049199897 8:141334870-141334892 CCCCGTGCTCCGCACGGAGCTGG - Intergenic
1051779102 9:20669355-20669377 CCAAGTGCTTCTCAGGCTTCTGG - Intronic
1053194849 9:36109297-36109319 CCAAGTGCTCTTCTGGGAGCTGG + Intronic
1054826544 9:69579264-69579286 AAAAGTGCTGCTCCCGGTGCAGG - Intronic
1058419100 9:104817840-104817862 CCAAGTGATCCTGATGCTGCTGG + Intronic
1060137114 9:121168221-121168243 CCAAGTGCTCTCAAAGGTGCTGG + Exonic
1060791193 9:126486799-126486821 CCAAGTCCTCCCCACTGTGACGG + Intronic
1061385065 9:130284858-130284880 CGAAGTACTCGTCACGGTGCTGG + Intronic
1061592684 9:131608200-131608222 GCAAGTCCTCCGCATGGTGCTGG + Intronic
1062645065 9:137543670-137543692 CCAGGTGCCCCCCATGGTGCTGG - Intronic
1203442524 Un_GL000219v1:22672-22694 CCAGGAGCTCCTCACGCAGCTGG + Intergenic
1203513332 Un_KI270741v1:141581-141603 CCAGGAGCTCCTCACGCAGCTGG + Intergenic
1188803295 X:34557978-34558000 CCAGGTGCTCCTGATGCTGCTGG + Intergenic
1189287325 X:39860979-39861001 CCAAGTCCTCCTCACTGCCCTGG + Intergenic
1194253155 X:91602937-91602959 CCAAGGGCTCTTCAGGGAGCAGG - Intergenic
1200572095 Y:4844180-4844202 CCAAGGGCTCTTCAGGGAGCAGG - Intergenic