ID: 955701464

View in Genome Browser
Species Human (GRCh38)
Location 3:61686034-61686056
Sequence CCAAGTGCTCCTCACGGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 159}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955701464_955701472 15 Left 955701464 3:61686034-61686056 CCTGCACCGTGAGGAGCACTTGG 0: 1
1: 0
2: 0
3: 9
4: 159
Right 955701472 3:61686072-61686094 TCCCGTGGTCTTGCGTGGGGAGG 0: 1
1: 0
2: 0
3: 2
4: 66
955701464_955701474 16 Left 955701464 3:61686034-61686056 CCTGCACCGTGAGGAGCACTTGG 0: 1
1: 0
2: 0
3: 9
4: 159
Right 955701474 3:61686073-61686095 CCCGTGGTCTTGCGTGGGGAGGG 0: 1
1: 0
2: 0
3: 1
4: 95
955701464_955701469 10 Left 955701464 3:61686034-61686056 CCTGCACCGTGAGGAGCACTTGG 0: 1
1: 0
2: 0
3: 9
4: 159
Right 955701469 3:61686067-61686089 CTCATTCCCGTGGTCTTGCGTGG 0: 1
1: 0
2: 0
3: 2
4: 44
955701464_955701471 12 Left 955701464 3:61686034-61686056 CCTGCACCGTGAGGAGCACTTGG 0: 1
1: 0
2: 0
3: 9
4: 159
Right 955701471 3:61686069-61686091 CATTCCCGTGGTCTTGCGTGGGG 0: 1
1: 0
2: 0
3: 3
4: 47
955701464_955701470 11 Left 955701464 3:61686034-61686056 CCTGCACCGTGAGGAGCACTTGG 0: 1
1: 0
2: 0
3: 9
4: 159
Right 955701470 3:61686068-61686090 TCATTCCCGTGGTCTTGCGTGGG 0: 1
1: 0
2: 0
3: 0
4: 34
955701464_955701467 0 Left 955701464 3:61686034-61686056 CCTGCACCGTGAGGAGCACTTGG 0: 1
1: 0
2: 0
3: 9
4: 159
Right 955701467 3:61686057-61686079 TGCTCGTTACCTCATTCCCGTGG 0: 1
1: 0
2: 0
3: 1
4: 23

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955701464 Original CRISPR CCAAGTGCTCCTCACGGTGC AGG (reversed) Intronic