ID: 955701467

View in Genome Browser
Species Human (GRCh38)
Location 3:61686057-61686079
Sequence TGCTCGTTACCTCATTCCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 25
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 23}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955701463_955701467 1 Left 955701463 3:61686033-61686055 CCCTGCACCGTGAGGAGCACTTG 0: 1
1: 0
2: 0
3: 4
4: 114
Right 955701467 3:61686057-61686079 TGCTCGTTACCTCATTCCCGTGG 0: 1
1: 0
2: 0
3: 1
4: 23
955701464_955701467 0 Left 955701464 3:61686034-61686056 CCTGCACCGTGAGGAGCACTTGG 0: 1
1: 0
2: 0
3: 9
4: 159
Right 955701467 3:61686057-61686079 TGCTCGTTACCTCATTCCCGTGG 0: 1
1: 0
2: 0
3: 1
4: 23
955701466_955701467 -6 Left 955701466 3:61686040-61686062 CCGTGAGGAGCACTTGGTGCTCG 0: 1
1: 0
2: 0
3: 4
4: 76
Right 955701467 3:61686057-61686079 TGCTCGTTACCTCATTCCCGTGG 0: 1
1: 0
2: 0
3: 1
4: 23
955701462_955701467 7 Left 955701462 3:61686027-61686049 CCAGGACCCTGCACCGTGAGGAG 0: 1
1: 0
2: 1
3: 23
4: 244
Right 955701467 3:61686057-61686079 TGCTCGTTACCTCATTCCCGTGG 0: 1
1: 0
2: 0
3: 1
4: 23

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955701467 Original CRISPR TGCTCGTTACCTCATTCCCG TGG Intronic
1106328395 13:28716684-28716706 TACTCATTTCCTCATTCCCATGG - Intronic
1156017487 18:32563093-32563115 TGGTCATTACCTCACTCCTGTGG + Intergenic
1159613676 18:70554426-70554448 TGCTAGCTACCTCATTCACAAGG + Intergenic
1163073629 19:14867579-14867601 TACTCTATTCCTCATTCCCGAGG + Intergenic
1165421301 19:35723285-35723307 GGGGCGTGACCTCATTCCCGTGG + Intronic
931695653 2:64868730-64868752 TCCTCCTTCCCTCATTTCCGTGG - Intergenic
934909917 2:98242286-98242308 TGCTCAATACCTCATTTCCAAGG - Intronic
940347221 2:152640231-152640253 TGCTCTTAGCCTCATTCCAGTGG - Intronic
1170364503 20:15584714-15584736 GGCTGGTTACCACCTTCCCGTGG + Intronic
1183100119 22:35578742-35578764 TGCTCACTGCCTCATTCCAGGGG - Intergenic
1184214766 22:43059437-43059459 TGCTGGTCACCTCCTTGCCGCGG + Exonic
1184714732 22:46274497-46274519 TGCTGGTTCCCTCATTCTCCGGG + Intronic
955701467 3:61686057-61686079 TGCTCGTTACCTCATTCCCGTGG + Intronic
963834876 3:150048150-150048172 TGCTCCTTACCTCCTTCCCAGGG - Intronic
975217149 4:71768999-71769021 TGCTCTGTACCTCATTGCCTTGG + Intronic
984152421 4:176150983-176151005 TACTAGTTACCTCATCCCTGGGG + Intronic
985417349 4:189750215-189750237 TTCTCGTTGCATCATTTCCGGGG + Intergenic
995409396 5:111837861-111837883 GGGTCGTCACCTCATTCCAGTGG + Intronic
1002322390 5:178383526-178383548 TGCTGGTTACCCCATTCTCCAGG + Intronic
1004576067 6:16896382-16896404 TGCTGGTTATCTCTTTCCCTGGG + Intergenic
1023896015 7:44433625-44433647 TGCTGGTTGCCTCATACCCATGG - Intronic
1045841002 8:106580961-106580983 TGCTTGTTTCCTCATTCTTGTGG + Intronic
1048937678 8:139370480-139370502 TGCCCCTTTTCTCATTCCCGTGG + Intergenic
1055269208 9:74537191-74537213 TCATCGTTACCTCTTCCCCGTGG + Intronic
1055703432 9:78971700-78971722 TCCTCGTTAGCTCATCCCCAGGG + Intergenic