ID: 955701469 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:61686067-61686089 |
Sequence | CTCATTCCCGTGGTCTTGCG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 47 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 2, 4: 44} |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
955701464_955701469 | 10 | Left | 955701464 | 3:61686034-61686056 | CCTGCACCGTGAGGAGCACTTGG | 0: 1 1: 0 2: 0 3: 9 4: 159 |
||
Right | 955701469 | 3:61686067-61686089 | CTCATTCCCGTGGTCTTGCGTGG | 0: 1 1: 0 2: 0 3: 2 4: 44 |
||||
955701462_955701469 | 17 | Left | 955701462 | 3:61686027-61686049 | CCAGGACCCTGCACCGTGAGGAG | 0: 1 1: 0 2: 1 3: 23 4: 244 |
||
Right | 955701469 | 3:61686067-61686089 | CTCATTCCCGTGGTCTTGCGTGG | 0: 1 1: 0 2: 0 3: 2 4: 44 |
||||
955701466_955701469 | 4 | Left | 955701466 | 3:61686040-61686062 | CCGTGAGGAGCACTTGGTGCTCG | 0: 1 1: 0 2: 0 3: 4 4: 76 |
||
Right | 955701469 | 3:61686067-61686089 | CTCATTCCCGTGGTCTTGCGTGG | 0: 1 1: 0 2: 0 3: 2 4: 44 |
||||
955701463_955701469 | 11 | Left | 955701463 | 3:61686033-61686055 | CCCTGCACCGTGAGGAGCACTTG | 0: 1 1: 0 2: 0 3: 4 4: 114 |
||
Right | 955701469 | 3:61686067-61686089 | CTCATTCCCGTGGTCTTGCGTGG | 0: 1 1: 0 2: 0 3: 2 4: 44 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
955701469 | Original CRISPR | CTCATTCCCGTGGTCTTGCG TGG | Intronic | ||