ID: 955701469

View in Genome Browser
Species Human (GRCh38)
Location 3:61686067-61686089
Sequence CTCATTCCCGTGGTCTTGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 44}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955701464_955701469 10 Left 955701464 3:61686034-61686056 CCTGCACCGTGAGGAGCACTTGG 0: 1
1: 0
2: 0
3: 9
4: 159
Right 955701469 3:61686067-61686089 CTCATTCCCGTGGTCTTGCGTGG 0: 1
1: 0
2: 0
3: 2
4: 44
955701462_955701469 17 Left 955701462 3:61686027-61686049 CCAGGACCCTGCACCGTGAGGAG 0: 1
1: 0
2: 1
3: 23
4: 244
Right 955701469 3:61686067-61686089 CTCATTCCCGTGGTCTTGCGTGG 0: 1
1: 0
2: 0
3: 2
4: 44
955701466_955701469 4 Left 955701466 3:61686040-61686062 CCGTGAGGAGCACTTGGTGCTCG 0: 1
1: 0
2: 0
3: 4
4: 76
Right 955701469 3:61686067-61686089 CTCATTCCCGTGGTCTTGCGTGG 0: 1
1: 0
2: 0
3: 2
4: 44
955701463_955701469 11 Left 955701463 3:61686033-61686055 CCCTGCACCGTGAGGAGCACTTG 0: 1
1: 0
2: 0
3: 4
4: 114
Right 955701469 3:61686067-61686089 CTCATTCCCGTGGTCTTGCGTGG 0: 1
1: 0
2: 0
3: 2
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955701469 Original CRISPR CTCATTCCCGTGGTCTTGCG TGG Intronic