ID: 955701471 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:61686069-61686091 |
Sequence | CATTCCCGTGGTCTTGCGTG GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 51 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 3, 4: 47} |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
955701466_955701471 | 6 | Left | 955701466 | 3:61686040-61686062 | CCGTGAGGAGCACTTGGTGCTCG | 0: 1 1: 0 2: 0 3: 4 4: 76 |
||
Right | 955701471 | 3:61686069-61686091 | CATTCCCGTGGTCTTGCGTGGGG | 0: 1 1: 0 2: 0 3: 3 4: 47 |
||||
955701463_955701471 | 13 | Left | 955701463 | 3:61686033-61686055 | CCCTGCACCGTGAGGAGCACTTG | 0: 1 1: 0 2: 0 3: 4 4: 114 |
||
Right | 955701471 | 3:61686069-61686091 | CATTCCCGTGGTCTTGCGTGGGG | 0: 1 1: 0 2: 0 3: 3 4: 47 |
||||
955701462_955701471 | 19 | Left | 955701462 | 3:61686027-61686049 | CCAGGACCCTGCACCGTGAGGAG | 0: 1 1: 0 2: 1 3: 23 4: 244 |
||
Right | 955701471 | 3:61686069-61686091 | CATTCCCGTGGTCTTGCGTGGGG | 0: 1 1: 0 2: 0 3: 3 4: 47 |
||||
955701464_955701471 | 12 | Left | 955701464 | 3:61686034-61686056 | CCTGCACCGTGAGGAGCACTTGG | 0: 1 1: 0 2: 0 3: 9 4: 159 |
||
Right | 955701471 | 3:61686069-61686091 | CATTCCCGTGGTCTTGCGTGGGG | 0: 1 1: 0 2: 0 3: 3 4: 47 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
955701471 | Original CRISPR | CATTCCCGTGGTCTTGCGTG GGG | Intronic | ||