ID: 955701949

View in Genome Browser
Species Human (GRCh38)
Location 3:61690367-61690389
Sequence CTGCTTTTCTCCAGGATAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 272}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955701943_955701949 13 Left 955701943 3:61690331-61690353 CCCTTTCTGGGTGTTTGTTGCAG 0: 1
1: 0
2: 1
3: 25
4: 252
Right 955701949 3:61690367-61690389 CTGCTTTTCTCCAGGATAAATGG 0: 1
1: 0
2: 1
3: 29
4: 272
955701944_955701949 12 Left 955701944 3:61690332-61690354 CCTTTCTGGGTGTTTGTTGCAGG 0: 1
1: 0
2: 1
3: 14
4: 167
Right 955701949 3:61690367-61690389 CTGCTTTTCTCCAGGATAAATGG 0: 1
1: 0
2: 1
3: 29
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955701949 Original CRISPR CTGCTTTTCTCCAGGATAAA TGG Intronic
900698126 1:4025521-4025543 CTGCATTGCTCCATGAAAAAAGG + Intergenic
901690306 1:10968985-10969007 CAGCTTTTCTCCTGGAAAAGTGG + Intronic
904900254 1:33851529-33851551 CTGCTTTCCTCCCTGATGAATGG + Intronic
905381626 1:37565757-37565779 TTGATTTTCTGCAGGATAAGGGG - Exonic
907044103 1:51289180-51289202 CTCCCTTTCTCCAGGTTGAATGG + Intronic
907707190 1:56842734-56842756 CTCTTTTCCTCCAGGATAGAGGG + Intergenic
908135024 1:61122961-61122983 CTCCATTTCTCCTGGATACATGG - Intronic
909322890 1:74312375-74312397 ATGCTTTTGTTCAGGATACAGGG + Intronic
912312225 1:108634217-108634239 CTGATTTTCTGTAGGATGAATGG + Intronic
914345278 1:146793792-146793814 CTGCTGTTCTGCAGGATCAAGGG - Intergenic
915302145 1:154957801-154957823 CTCATTTCCTCCATGATAAAAGG - Exonic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917675613 1:177316372-177316394 CTGCTTTCCCAAAGGATAAAAGG + Intergenic
920125076 1:203687962-203687984 CTCCCTCTCTCCAGGCTAAAGGG - Intronic
921316999 1:213901529-213901551 GTGCTTTCCTACTGGATAAATGG - Intergenic
924640958 1:245833470-245833492 TTGCTTTTCTCAAGACTAAATGG + Intronic
924833873 1:247628615-247628637 CTGCTTTTCTCAAGTAGAAAGGG + Intergenic
1063658732 10:8017824-8017846 CTGGTTTTCTCCAGGACATTTGG - Intergenic
1064429857 10:15261617-15261639 CTGCTTTTCTCCTGGACAGCTGG - Intronic
1065997055 10:31069194-31069216 CTGCTTCTCTACAAGGTAAAGGG + Intergenic
1066233111 10:33457107-33457129 GTGCTTTTCTCCTGTACAAAAGG - Intergenic
1067658681 10:48217246-48217268 CTGCTTTGGTGCTGGATAAATGG + Intronic
1068281771 10:54881163-54881185 TGGTTTTTCTCCAGGGTAAAAGG + Intronic
1068422151 10:56808160-56808182 CTGCTTTTCTCAAGCAGAAGAGG + Intergenic
1069902501 10:71714066-71714088 CTGCATTTCTCCCTGAGAAATGG - Exonic
1070658665 10:78289282-78289304 CTGCTCTTCTCCAGGTGAAATGG + Intergenic
1072316206 10:94205779-94205801 CTGTTTTGATCCAGGATAATTGG + Intronic
1073600783 10:104844036-104844058 CAGCTTCTCTCCAGGAAAGAGGG + Intronic
1074225468 10:111480044-111480066 CTGCTTTTCTGCAGGCACAATGG + Intergenic
1074686020 10:115963182-115963204 CCTCTTTTCTCCAGGAAGAATGG - Intergenic
1078949477 11:16113474-16113496 GTGCTTTTCTTCAGGGTTAAAGG - Intronic
1079408603 11:20165848-20165870 CTGCTTTTGTCCAAGGCAAAAGG + Intergenic
1079613922 11:22467420-22467442 CTGCTTTTCTCTGGGATGATAGG + Intergenic
1079657136 11:22998111-22998133 CTTTTTATCTCCAGGGTAAAAGG - Intergenic
1080245114 11:30171189-30171211 CTGCTATTCTTCAGGCTACAAGG - Intergenic
1081275452 11:41142882-41142904 CTGTTTTTCTGCACTATAAATGG - Intronic
1081633161 11:44702955-44702977 CTGCTAATCTCCAAGAGAAATGG + Intergenic
1083243486 11:61407511-61407533 CTGCTTTTCCAGAGGATACATGG + Intronic
1083445981 11:62708281-62708303 CCTCTTTTTTCCAGGATGAAAGG + Exonic
1084634449 11:70381533-70381555 CTGCTCCTCCCCAGGAGAAAAGG + Intronic
1085429194 11:76432343-76432365 ATCCTTTTCTCCAAGATAGAGGG - Intergenic
1087032028 11:93715536-93715558 CTGCTTTTCTCAAGCAGAAGGGG + Intronic
1088726083 11:112636468-112636490 CTGCTTTTATGAAGGAAAAAAGG + Intergenic
1088753264 11:112864025-112864047 CAGCATTTCTCCAGGAAACAGGG + Intergenic
1089464112 11:118672985-118673007 CTGCTTTTCTGGAAGTTAAAGGG - Intronic
1089672224 11:120064438-120064460 CTGCAATTCTCCAGCACAAATGG + Intergenic
1090456065 11:126850702-126850724 CTGCTTATCCCCAAAATAAAAGG + Intronic
1091144098 11:133262272-133262294 AATCTGTTCTCCAGGATAAATGG + Intronic
1092210293 12:6641517-6641539 CTGCTCTGCTCCAGGTAAAAGGG + Intronic
1092792193 12:12079893-12079915 CTGCTTTTCTCAAGACTAAAAGG + Intronic
1093006805 12:14059987-14060009 CTGAGTTTCTCAAGGAGAAATGG + Intergenic
1093380367 12:18483979-18484001 ATGCTGTTCTCCAGGAAGAAAGG + Intronic
1093587241 12:20854147-20854169 CATCTTTTCTCCAGCAGAAATGG - Intronic
1093742676 12:22706338-22706360 CTTCTTTTCTCCATGAAGAAGGG + Intergenic
1094368891 12:29714502-29714524 CTGCTTTAATTCATGATAAAGGG + Intronic
1095739472 12:45591467-45591489 GTGCATTTTTCTAGGATAAAAGG + Intergenic
1095950404 12:47778603-47778625 CTACTTTTCAAGAGGATAAAAGG - Intronic
1097776199 12:63649500-63649522 TTGCTTTTCTACAGGGTCAATGG - Intronic
1098802648 12:74981595-74981617 CTGCTTCTCTCCATGAATAAGGG + Intergenic
1099138405 12:78938219-78938241 CAGCTTTTCTCCAGGAAAATAGG + Intronic
1099495303 12:83339620-83339642 CTGCTTTTCTCAAGCAGAAGGGG - Intergenic
1100010374 12:89945936-89945958 CTTCTTTTATCCAGGATGGAGGG - Intergenic
1102128184 12:110502407-110502429 CTGCTTTTCTCTCTGCTAAATGG - Intronic
1104213452 12:126712839-126712861 CTCCTTTTCTCCACCAAAAAAGG + Intergenic
1104213502 12:126713345-126713367 CTCCTTTTCTCCACCAAAAAAGG + Intergenic
1106081093 13:26500863-26500885 CTCCTTCTCTCCAGGCTAAGGGG - Intergenic
1108069304 13:46611355-46611377 CTGCTGTTCTCCAGAAGAAGTGG - Intronic
1109689340 13:65865448-65865470 ATGCTTCCCTCCAGGATACAAGG - Intergenic
1109844322 13:67965921-67965943 CTGTTGTGCTCCAGAATAAATGG - Intergenic
1110882042 13:80583933-80583955 CTGCTTTTCTCCTGGGAAAGTGG - Intergenic
1113117695 13:106891011-106891033 CTTCTTTTTTGCAGGATGAAGGG + Intergenic
1113411016 13:110089926-110089948 CTTCTTTTCTCCAGGAAATATGG - Intergenic
1117084547 14:52185885-52185907 CTTCATTTCTCTGGGATAAATGG - Intergenic
1117961913 14:61171642-61171664 CACCTTTTCTCCAGGAAAGAAGG - Intergenic
1119324222 14:73750010-73750032 CTGCTTTTCCCTAGGAAAAATGG + Intronic
1121037261 14:90716768-90716790 CTGCTTATTTCCAGGATGCAGGG + Intronic
1122382418 14:101317928-101317950 CTTTTTATCTCCAGGGTAAAAGG + Intergenic
1122879130 14:104682166-104682188 CTGCTATTCTACAGGAGAAAGGG + Intergenic
1123215253 14:106803251-106803273 CTGCTTTTCATCAGCAAAAAGGG + Intergenic
1123707004 15:22957959-22957981 CTGGTTTTCCCCAGGTTAAACGG + Intronic
1124608760 15:31193277-31193299 CTGCTTTCCCTCAGGAAAAATGG + Intergenic
1125677061 15:41507772-41507794 TTGCTTTTGCCCAGGATAATGGG - Intronic
1126374381 15:47980580-47980602 TTGGTTTTCTCCAGGATGAATGG + Intergenic
1127069757 15:55277450-55277472 CTGTTTGTCTCCATAATAAATGG + Intronic
1127163148 15:56213189-56213211 CTGCATTTCTCTGGGATAAATGG - Intronic
1128253854 15:66182873-66182895 CAGCTTCTCTCCACCATAAACGG - Intronic
1129996005 15:80006821-80006843 CTGCTGTGCTCCAGGACAAATGG - Intergenic
1130063465 15:80586118-80586140 CTGCATTTCTCCAAGAAACAAGG - Intronic
1130765880 15:86870744-86870766 CTGATTTCTTTCAGGATAAACGG + Intronic
1130931233 15:88429494-88429516 CTGCTCTTCTCTGGGACAAAGGG + Intergenic
1133330475 16:4970202-4970224 CTGTTTTTCCCCATGATGAATGG - Intronic
1134235414 16:12461457-12461479 CTCCTTCTCTCCAAGACAAATGG + Intronic
1135425267 16:22329627-22329649 GTGCTTTTGTCCAGAATAGAGGG + Intronic
1136701975 16:32152678-32152700 CTGCTCTTCACCAGGACACAGGG + Intergenic
1136765690 16:32774782-32774804 CTGCTCTTCACCAGGACACAGGG - Intergenic
1136802408 16:33095596-33095618 CTGCTCTTCACCAGGACACAGGG + Intergenic
1139988714 16:70921500-70921522 CTGCTGTTCTGCAGGATCAAGGG + Intronic
1141149340 16:81553229-81553251 CTGCTTTTCTGGAAGATGAAGGG + Intronic
1141167796 16:81671952-81671974 CTGCTTTTTTCCAGCATGCACGG + Exonic
1141184361 16:81776480-81776502 CTTCTTTTCCCAAGGATAATAGG - Intronic
1203068079 16_KI270728v1_random:1037030-1037052 CTGCTCTTCACCAGGACACAGGG - Intergenic
1142588605 17:990258-990280 CTGCTTTGCTAAGGGATAAAAGG - Intergenic
1142682732 17:1559998-1560020 CTGCTGTTCTTGAAGATAAAAGG - Intronic
1144207273 17:12988069-12988091 CTGCTTGTCTCCAGGACACTCGG - Intronic
1144452203 17:15390467-15390489 CAGGATTTCACCAGGATAAAAGG + Intergenic
1144487898 17:15682728-15682750 CTGCCTTTCTGAAGGATAAGGGG - Intronic
1146892138 17:36513014-36513036 CTGGTTTTCTCAGGCATAAAGGG + Intronic
1146982355 17:37176154-37176176 GTGCTTTTCTCCATGATCGAAGG - Intronic
1147269507 17:39258116-39258138 CTGTTTTTTTCCATTATAAAAGG + Intergenic
1149124139 17:53207694-53207716 CTGCCTTACTCCTGGAAAAATGG + Intergenic
1149234889 17:54578262-54578284 CTGCTTTTCTCAAGCAGAAGGGG - Intergenic
1149583814 17:57770960-57770982 CTGATTTGCTCTGGGATAAAAGG - Intergenic
1150030574 17:61730161-61730183 CTGTTTTTCCCTAGGATTAAAGG - Intronic
1150214969 17:63462300-63462322 CTGTGTTTCTCCTGGAGAAAAGG + Intergenic
1153363304 18:4224305-4224327 CTGCTTTTCTCAAGAAGAAGGGG - Intronic
1153530379 18:6040280-6040302 CTGAATATCTCCAGGATGAAGGG - Intronic
1153539286 18:6136458-6136480 CTGCTTTTCTGCATGAAAGATGG + Intronic
1155326675 18:24671714-24671736 TTGCTTTTCTCCAGGCTATCTGG - Intergenic
1155387870 18:25300242-25300264 CTGCTTTTCACCAGGTTGATTGG - Intronic
1157826081 18:50813646-50813668 TAGCTTCTCTCCAGAATAAAGGG + Intronic
1158622860 18:59047781-59047803 CTGCTTATCTCCAGGAGGACAGG + Intergenic
1160100386 18:75915365-75915387 CTGCTTTACTGCAGGATGATAGG - Intergenic
1160389083 18:78517028-78517050 CCTCTTTCCTCCAGGATAAAAGG - Intergenic
1161528214 19:4770532-4770554 CTGCTTCTCTCCAGGAGAACCGG + Intergenic
1163328899 19:16623421-16623443 CTGCTTTTCTGCAGAATAAATGG + Intronic
1165577368 19:36832453-36832475 CTGGTTTTCTCCAGAGCAAAAGG - Intronic
1167048604 19:47065976-47065998 CCCCTTTTCCCCAGGACAAAGGG - Exonic
925426515 2:3753126-3753148 CTGCTTTTCTCTGGGATACCAGG + Intronic
925522534 2:4763037-4763059 CTTTTTTTCTCAAGGAGAAAAGG + Intergenic
926726128 2:15999413-15999435 CTTCTTTTCTCCAGGGAAAATGG + Intergenic
927862447 2:26568533-26568555 CTCCTTCTCTCCAGAAGAAAGGG + Intronic
928072817 2:28234375-28234397 CTGCTTTTCTCCATCATTACAGG + Intronic
929414840 2:41736888-41736910 CTGCTTTTAACCAGGCTAACTGG - Intergenic
930475450 2:51875895-51875917 CTGCTTTTCTCCAACAGAAGGGG - Intergenic
930492498 2:52093237-52093259 CTGCTTCTCTCAAGAAGAAATGG + Intergenic
931061721 2:58536884-58536906 CTGCTTTTCTCCACTAAAACAGG - Intergenic
934559565 2:95305984-95306006 TTTCGTTTCTTCAGGATAAACGG + Intronic
934654800 2:96111864-96111886 CTGCATTTCTCTAGTATAAAAGG + Intergenic
935048115 2:99499690-99499712 CTTTTAGTCTCCAGGATAAAAGG + Intergenic
936171051 2:110175103-110175125 CTGCATTTCCCCAGGAGCAATGG + Intronic
938174868 2:129116416-129116438 CTGTTTTCTTCCAGGATAGAAGG + Intergenic
938681499 2:133696387-133696409 CTGTTTTTCTCAAGGAAAAAGGG + Intergenic
938758213 2:134400039-134400061 CTCCTCTTCTCCAGGATGGAAGG - Intronic
939553651 2:143646977-143646999 TTGCTTTTTTCCAAGAGAAATGG + Intronic
940189816 2:151028686-151028708 CTTCATTTCTCCAAGAGAAATGG - Intronic
940696633 2:156986923-156986945 CTGCTTCTCTGCAAAATAAAGGG + Intergenic
940795517 2:158072679-158072701 CTGATTTTCTCCCAAATAAATGG - Intronic
942672092 2:178387174-178387196 CTGCTTTTCTAAATCATAAATGG + Intronic
944884097 2:204045071-204045093 CTGCTTTTCTCCAATTTCAATGG - Intergenic
944988829 2:205210653-205210675 CTGCTTTTCTGCAGGGCAACTGG - Intronic
947854086 2:233311568-233311590 CGGCTTTTATCCAGGAAGAAGGG + Intronic
948207843 2:236172206-236172228 ATGTCTTTCTCCAGGACAAAAGG + Intergenic
1170453451 20:16509995-16510017 CAGTTTTACACCAGGATAAATGG - Intronic
1171351736 20:24507745-24507767 CTGCTTCTCTTCTGGTTAAATGG - Intronic
1173097799 20:40053605-40053627 TTTCTCTTCTCCATGATAAAGGG - Intergenic
1173450752 20:43161720-43161742 TTGCTTTTTTGCAGGAAAAATGG - Intronic
1175588359 20:60165905-60165927 CTGCTTCTCTACAGAATAAAAGG - Intergenic
1177405413 21:20661376-20661398 CTGCTATTATCCAGAAGAAATGG + Intergenic
1177569650 21:22870915-22870937 CTGCTTTTCTCAAGCAGAAGGGG + Intergenic
1178480831 21:32978191-32978213 CTACTTTTCTCCTTGATAAAAGG + Intergenic
1179027548 21:37692295-37692317 CTTTTTTTCTCAAGGGTAAAGGG - Intronic
1179230719 21:39501594-39501616 CTGTCTTTCTGTAGGATAAATGG - Intronic
1180256736 21:46635165-46635187 CTGCCTTTCTTCTGGATAAGTGG - Intronic
1181534973 22:23537045-23537067 ATGCTTTTCTCTAGGGTGAAGGG + Intergenic
951626916 3:24675431-24675453 CTTCTTTCCTCCAGGCTCAAAGG + Intergenic
953011119 3:39026480-39026502 GTGATTTTCTCCCGGGTAAAGGG + Intergenic
955137821 3:56237419-56237441 ATGCTTTTCTCCCTGATCAAAGG - Intronic
955701949 3:61690367-61690389 CTGCTTTTCTCCAGGATAAATGG + Intronic
956928548 3:74016426-74016448 CTGTTTTTCTCCAGTAAAATGGG - Intergenic
958584845 3:96073703-96073725 CTGCTATTCTCCATTATGAATGG - Intergenic
959179130 3:102956182-102956204 CTTTTTTTCTCCATGAAAAAAGG + Intergenic
959427663 3:106212443-106212465 GTTCTGCTCTCCAGGATAAATGG - Intergenic
959467848 3:106711459-106711481 CTGCTTTTATCAAAGATAACAGG - Intergenic
961051457 3:123750590-123750612 CTGTCTTTCTGCAGGATAAAGGG - Intronic
961615893 3:128180781-128180803 CTGCTTTACTCCAGAAGACAGGG + Intronic
961677100 3:128574296-128574318 CAGATTTTCTGCAGGAAAAATGG + Exonic
963704202 3:148665509-148665531 CTGCTGTTTTCCAAGAGAAATGG - Intergenic
963738738 3:149052869-149052891 CAGCTTTTCTGGAGAATAAAGGG + Intronic
965253414 3:166371042-166371064 CTGCTTCTCTCAAGTATAATGGG + Intergenic
965912372 3:173794601-173794623 AAGCATTTCTCCAGAATAAAAGG + Intronic
969145067 4:5115391-5115413 CTGCTTTCCTCCAGCATTACAGG + Intronic
969279397 4:6159947-6159969 GGGCTTTTCTCCATGAAAAATGG - Intronic
969759947 4:9174393-9174415 CTGGTTTTCCCCAGGAGATAGGG - Intronic
970743585 4:19267166-19267188 CTGCTTTACCTCAGGAAAAAAGG - Intergenic
971530495 4:27682304-27682326 CTTCTTTTCTCCTAGACAAAAGG - Intergenic
974900768 4:67994578-67994600 CTGCTTTTCCTCAGGATTCACGG - Intergenic
975720778 4:77246768-77246790 CTGAGTTTCTCGAGCATAAATGG - Intronic
976557617 4:86467490-86467512 ATGCTGTTTTCCAGGATAACAGG - Intronic
976908231 4:90266934-90266956 CTGCTTTTCTCAAGCAGAAGAGG - Intronic
978856129 4:113396964-113396986 CTTCTATTCACCAGGATATATGG + Intergenic
982469114 4:155765214-155765236 TTGCCTTTCTCCAGAATAAGGGG + Intronic
982749592 4:159144092-159144114 GTGATTTGCTCCAGGTTAAAGGG - Intronic
986895593 5:12362636-12362658 CTACTTTCCACCAGGACAAATGG + Intergenic
992045013 5:72879138-72879160 CTGCTTTTAGCCAGCAGAAAAGG + Intronic
992757955 5:79926656-79926678 CTACTTTCCTTCAGGAAAAAAGG + Intergenic
994529961 5:100956797-100956819 CTGCTTTTCTCAAGCAGAAGGGG - Intergenic
998003959 5:138644960-138644982 CTCCTTTTCTCCAGGACACTGGG + Intronic
998788871 5:145744236-145744258 CTGCTGGTCTGCAGGAGAAAAGG - Intronic
999435739 5:151562048-151562070 ATGCTTTTCTCCTGGAAAACAGG - Intronic
999583251 5:153062827-153062849 CTGCTTTTCTTAAGCAAAAATGG - Intergenic
1001560244 5:172664287-172664309 CTTGTTTTCTCCTGGAAAAATGG + Intronic
1002706994 5:181168219-181168241 TTGCTTTTCTCTGAGATAAATGG - Intergenic
1003697404 6:8423957-8423979 CAGATTTTCTCAAAGATAAATGG + Intronic
1004038805 6:11953472-11953494 CTTCTTTTCTCCAGCCTCAAAGG + Intergenic
1004307803 6:14516554-14516576 CTGCTTTTGTCCAGAATACTTGG + Intergenic
1004999591 6:21227622-21227644 CTGCTTCTCTGCAGGATGCAGGG + Intronic
1007730428 6:43942241-43942263 CTGGTTTTCTCCGGGCTAATTGG + Intergenic
1008227298 6:48936372-48936394 CTGCTTTTCTCAAGCAGAAGGGG + Intergenic
1008353428 6:50520793-50520815 CTGATTTTCCCCATGATTAATGG - Intergenic
1008711830 6:54236954-54236976 CAGGTTTTCCCCAGGAGAAATGG + Intronic
1009353159 6:62707620-62707642 CTGCTTTTCTCAAGCAGAAGGGG + Intergenic
1009542911 6:64987126-64987148 CTGCTTGTCGCCAGAATAACTGG - Intronic
1009771229 6:68145130-68145152 CTGCTTTTCTCAAGCAGAGAGGG + Intergenic
1010086374 6:71923375-71923397 CGGATTTTCTTCAGGATACAAGG + Intronic
1010871182 6:81042673-81042695 CTGCTCTTCTCCATAATAAATGG - Intergenic
1011035353 6:82968110-82968132 TTTCATTTCTCCAGGATAAAAGG + Intronic
1013233339 6:108175917-108175939 CTGCCTTTCTCCAGCATACTCGG + Intronic
1013272041 6:108554485-108554507 CCCCTTTTCTCCAGGCCAAAAGG + Intergenic
1013650747 6:112192314-112192336 CTGCTATTCTCCTGGCTGAAAGG + Intronic
1014038400 6:116794975-116794997 CAGCTTTTCTACAAGATGAATGG + Intronic
1014654046 6:124076879-124076901 CTGGTTTTCTCCATTGTAAATGG + Intronic
1015915074 6:138208027-138208049 TTGCTTTTCTCCAAGGTAATTGG + Intronic
1018482094 6:164201198-164201220 CTGATTTTCTCCAGGACCAAGGG - Intergenic
1018935990 6:168274315-168274337 CTGCCTTTCCCCAGGACACAAGG + Intergenic
1020477028 7:8608252-8608274 CAGCTGTTCTCAGGGATAAATGG + Intronic
1021382402 7:19983844-19983866 CTGCTTTTCTCAAGCATAAGTGG + Intergenic
1021962099 7:25883537-25883559 CTGTTTTTCTTCAAGATTAAGGG - Intergenic
1022050859 7:26669649-26669671 TTCCTTTTCTGCAGGAGAAAGGG + Exonic
1022935110 7:35167094-35167116 TTGCTTTTCTACAGGGTCAATGG - Intergenic
1024396607 7:48876140-48876162 GTGCTCTTTTCCAGGATAATTGG + Intergenic
1024558470 7:50623623-50623645 GTGCTTTTCTCCCGCAGAAAGGG + Intronic
1026439930 7:70435279-70435301 GTGCTTTTCTACAGGAAAAGAGG - Intronic
1029107137 7:98187207-98187229 CTGCTTTTCTAAAGGAAAATGGG - Intronic
1029831061 7:103259869-103259891 TTGCTTTTCTACAGGGTCAATGG - Intergenic
1030269745 7:107658372-107658394 CTGCTTTTCTCATAGGTAAAAGG - Intergenic
1032191371 7:129767718-129767740 CTGCCTTTCCCTAGGATACATGG - Intergenic
1035148480 7:156844523-156844545 CTCCCTTTGTCCAGGATGAAAGG + Intronic
1035856521 8:2981922-2981944 CTGGTCCTCTCCAGGAAAAAGGG - Intronic
1036263555 8:7258124-7258146 CTGGTTTTCCCCAGGAGACAGGG - Intergenic
1036264856 8:7265746-7265768 CTGGTTTTCCCCAGGAGACAGGG - Intergenic
1036266157 8:7273368-7273390 CTGGTTTTCCCCAGGAGACAGGG - Intergenic
1036267458 8:7280990-7281012 CTGGTTTTCCCCAGGAGACAGGG - Intergenic
1036268760 8:7288612-7288634 CTGGTTTTCCCCAGGAGACAGGG - Intergenic
1036270064 8:7296234-7296256 CTGGTTTTCCCCAGGAGACAGGG - Intergenic
1036297832 8:7550821-7550843 CTGGTTTTCCCCAGGAGACAGGG + Intergenic
1036299136 8:7558469-7558491 CTGGTTTTCCCCAGGAGACAGGG + Intergenic
1036300441 8:7566119-7566141 CTGGTTTTCCCCAGGAGACAGGG + Intergenic
1036301744 8:7573763-7573785 CTGGTTTTCCCCAGGAGACAGGG + Intergenic
1036303041 8:7581412-7581434 CTGGTTTTCCCCAGGAGACAGGG + Intergenic
1036315596 8:7716663-7716685 CTGGTTTTCCCCAGGAGACAGGG - Intergenic
1036316904 8:7724311-7724333 CTGGTTTTCCCCAGGAGACAGGG - Intergenic
1036318211 8:7731959-7731981 CTGGTTTTCCCCAGGAGACAGGG - Intergenic
1036319520 8:7739606-7739628 CTGGTTTTCCCCAGGAGACAGGG - Intergenic
1036320827 8:7747254-7747276 CTGGTTTTCCCCAGGAGACAGGG - Intergenic
1036322137 8:7754902-7754924 CTGGTTTTCCCCAGGAGACAGGG - Intergenic
1036323446 8:7762550-7762572 CTGGTTTTCCCCAGGAGACAGGG - Intergenic
1036324741 8:7770197-7770219 CTGGTTTTCCCCAGGAGACAGGG - Intergenic
1036351293 8:8014110-8014132 CTGGTTTTCCCCAGGAGACAGGG + Intergenic
1036352598 8:8021756-8021778 CTGGTTTTCCCCAGGAGACAGGG + Intergenic
1036353890 8:8029404-8029426 CTGGTTTTCCCCAGGAGACAGGG + Intergenic
1036846560 8:12174529-12174551 CTGGTTTTCCCCAGGAGACAGGG + Intergenic
1038060463 8:23906573-23906595 CTGTTTTTGTCCAGGATCTATGG + Intergenic
1040567959 8:48583289-48583311 CAGCTTTTCTCCAGCAAAACGGG - Intergenic
1041127222 8:54655423-54655445 TTGTTTAACTCCAGGATAAATGG + Intergenic
1041616032 8:59907616-59907638 CTGCTTTTCTCAAGCAGAAGGGG - Intergenic
1041896755 8:62933810-62933832 CTTATTTTCTCCTGAATAAAAGG + Intronic
1045257150 8:100535883-100535905 CTTCATTTCTCTAGGATAAATGG + Intronic
1045367049 8:101485925-101485947 CTGATGTTCTACAGGCTAAATGG + Intergenic
1047390778 8:124449263-124449285 CTGCTTTTCTGCAGGGCAGAAGG - Intergenic
1047896151 8:129368668-129368690 GTGCTACTCTCCAGGAGAAAGGG + Intergenic
1048389814 8:133952080-133952102 CTGCTTTTCATCATGATTAATGG + Intergenic
1048852068 8:138654898-138654920 CTGAGTTTGTCCTGGATAAAAGG + Intronic
1049010004 8:139880997-139881019 TGCATTTTCTCCAGGATAAAGGG + Intronic
1049163735 8:141113803-141113825 CTGCCTTTCTCTACGTTAAAGGG - Intergenic
1051104179 9:13559232-13559254 CTCCTTTTATCCAGGAGCAAGGG - Intergenic
1051727236 9:20100863-20100885 TTGCTTCTTTCCAAGATAAAAGG - Intergenic
1053598337 9:39585755-39585777 CTGCTGATGTTCAGGATAAAGGG - Intergenic
1053856370 9:42342764-42342786 CTGCTGATGTTCAGGATAAAGGG - Intergenic
1054804779 9:69387256-69387278 CTGCCTTTCTCCAGAAGAAAGGG + Intronic
1055283186 9:74698254-74698276 CTACTTTTTTTCAGGATAACAGG + Intergenic
1057694359 9:97312719-97312741 CGGCTTTCCACCTGGATAAAGGG + Intronic
1061820927 9:133226835-133226857 CTTCTGTTTTCCAGGATAAGTGG - Intergenic
1062238341 9:135523218-135523240 CTTCTGTTTTCCAGGATAAGTGG + Exonic
1186058280 X:5674763-5674785 CTGTTTTTCTTAATGATAAATGG + Intergenic
1187715048 X:22094402-22094424 ATGAGTTTCTCCAGGAAAAACGG - Intronic
1188600061 X:31952726-31952748 CTGCTTTTCCCCATGAGAATGGG + Intronic
1189944772 X:46166914-46166936 CAGCATTTCTCCAGCATTAAAGG + Intergenic
1192237910 X:69307565-69307587 CTGCTTTTCTCCATGAACACTGG - Intergenic
1193088392 X:77468144-77468166 CTGCTTTTCTCAAGCAGAAGGGG - Intergenic
1194033277 X:88841170-88841192 TTCCTTTTCTCCAAGACAAATGG - Intergenic
1194095751 X:89636744-89636766 CTGCTTTTCTCAAGCAGAAGGGG - Intergenic
1194546753 X:95245030-95245052 TGTCTTTTCTCCAGCATAAATGG - Intergenic
1195119208 X:101733309-101733331 CTGCTTTTCTCTGAGAGAAAGGG + Intergenic
1195322160 X:103728806-103728828 CAGCTTGGCTCCAGGATGAAAGG - Intergenic
1196512097 X:116523840-116523862 CTGTTTTTCTCAAGCAAAAAGGG + Intergenic
1197567432 X:128104714-128104736 TTGGTTTTCTGCAGGATAATAGG + Intergenic
1198073106 X:133169048-133169070 ATGCTTTTCTCCAGGTCCAATGG - Intergenic
1198835428 X:140799640-140799662 TTGCAGTTCTCCAGAATAAAGGG - Intergenic
1199670707 X:150145964-150145986 GGGCTTTTCTCCAGTATCAATGG + Intergenic
1200014002 X:153145261-153145283 CTTCTTCTCTCCAGGAAAAAGGG - Intergenic
1200025598 X:153254692-153254714 CTTCTTCTCTCCAGGAAAAAGGG + Intergenic
1200448751 Y:3298116-3298138 CTGCTTTTCTCAAGCAGAAGGGG - Intergenic
1201636940 Y:16133630-16133652 CTGATTTTAGCCAGGAGAAATGG - Intergenic