ID: 955704108

View in Genome Browser
Species Human (GRCh38)
Location 3:61710531-61710553
Sequence GGGCAGCATGTACCCCAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 675
Summary {0: 1, 1: 0, 2: 15, 3: 134, 4: 525}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955704097_955704108 12 Left 955704097 3:61710496-61710518 CCAGATCATTCCAAGCTTGTCCA 0: 1
1: 0
2: 1
3: 11
4: 139
Right 955704108 3:61710531-61710553 GGGCAGCATGTACCCCAGGATGG 0: 1
1: 0
2: 15
3: 134
4: 525
955704102_955704108 -8 Left 955704102 3:61710516-61710538 CCAACCCGTGGCCCAGGGCAGCA 0: 1
1: 1
2: 7
3: 57
4: 289
Right 955704108 3:61710531-61710553 GGGCAGCATGTACCCCAGGATGG 0: 1
1: 0
2: 15
3: 134
4: 525
955704095_955704108 14 Left 955704095 3:61710494-61710516 CCCCAGATCATTCCAAGCTTGTC 0: 1
1: 0
2: 2
3: 20
4: 103
Right 955704108 3:61710531-61710553 GGGCAGCATGTACCCCAGGATGG 0: 1
1: 0
2: 15
3: 134
4: 525
955704099_955704108 2 Left 955704099 3:61710506-61710528 CCAAGCTTGTCCAACCCGTGGCC 0: 6
1: 59
2: 143
3: 190
4: 219
Right 955704108 3:61710531-61710553 GGGCAGCATGTACCCCAGGATGG 0: 1
1: 0
2: 15
3: 134
4: 525
955704096_955704108 13 Left 955704096 3:61710495-61710517 CCCAGATCATTCCAAGCTTGTCC 0: 1
1: 0
2: 2
3: 14
4: 130
Right 955704108 3:61710531-61710553 GGGCAGCATGTACCCCAGGATGG 0: 1
1: 0
2: 15
3: 134
4: 525

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955704108 Original CRISPR GGGCAGCATGTACCCCAGGA TGG Intronic
900230544 1:1554815-1554837 CGGCAGCAGGGAACCCAGGATGG - Intronic
901487580 1:9575643-9575665 AGGCAGGGAGTACCCCAGGAAGG + Intronic
901626973 1:10630074-10630096 GGGCAGCTTGGAGCCCAGGTAGG + Exonic
902035651 1:13456181-13456203 GGGAGGGATGTACCCCAGAAAGG + Intergenic
902242835 1:15100234-15100256 TGGCAGCATGTACCCCAGCAGGG + Intronic
902260423 1:15221011-15221033 GGTGAGCATGTCCCCCTGGAGGG + Intergenic
903225103 1:21890239-21890261 GGACAGCCTGTACCCAAAGAAGG + Intronic
903516082 1:23911909-23911931 TGGCAGCATGAAAACCAGGATGG - Intronic
905283091 1:36861506-36861528 GGGCTGGATGTTCCCCATGACGG - Intronic
905373983 1:37505405-37505427 GGGCCGCAAGCAGCCCAGGACGG + Intronic
905698262 1:39992107-39992129 GGGCCACATGCAGCCCAGGATGG - Intergenic
906075353 1:43048060-43048082 GGGCAGCATGCAGCCCAGGATGG + Intergenic
906390970 1:45415863-45415885 GGGCCACATGTAGCCCAGAATGG + Intronic
906478664 1:46186339-46186361 AGGCAGCCTGGACCCTAGGAAGG - Intergenic
906479809 1:46192688-46192710 GGGAAGGAGGTACTCCAGGAAGG - Intronic
906581667 1:46940352-46940374 GGGCTGCATGTAGCTCAGGATGG - Intronic
906602049 1:47138546-47138568 GGGCTGCATGTAGCTCAGGATGG + Intronic
907044173 1:51289610-51289632 GGACAGCAGGTGCCCCAAGAAGG - Intronic
907086026 1:51674978-51675000 AGGCTGCATGTAGCACAGGATGG - Intronic
907221407 1:52909608-52909630 GGGCCGCATGTGGCCCAGGATGG - Intronic
907250030 1:53132000-53132022 GGGAAGCATGTTCCAGAGGAAGG + Intronic
907451745 1:54549828-54549850 GGGCAGAGTGTCTCCCAGGAGGG + Intronic
907566863 1:55443580-55443602 GGGCAGAATGAGCCTCAGGACGG - Intergenic
908828763 1:68158667-68158689 GGGCCGCATGCAGCCCAGGACGG - Intronic
908902008 1:68966416-68966438 GGGAAGCATTTACCCCAGCTAGG + Intergenic
908979887 1:69942896-69942918 AGCCACCATGTAGCCCAGGACGG + Intronic
909582726 1:77256176-77256198 GGGCCACATGTGGCCCAGGATGG + Intergenic
909922585 1:81400688-81400710 CAGCAGCAAGTACCCCAGAATGG + Intronic
910299020 1:85684387-85684409 GGGCAGCATGGCCCCAAAGAGGG + Intronic
910823538 1:91379552-91379574 AGGCTGCATGTGGCCCAGGATGG - Intronic
911191078 1:94949022-94949044 GGGCTGCATGCAGCCTAGGATGG + Intergenic
911586273 1:99694997-99695019 GGGCCGCATGTGGCCCAGGATGG - Intergenic
911617470 1:100030400-100030422 AGGCTGCATGCAGCCCAGGATGG + Intergenic
911749527 1:101480586-101480608 GGGCTGCATGCAGCCCAGGATGG + Intergenic
911828969 1:102525978-102526000 GGGCTGCATGCAGCCCAGGATGG - Intergenic
912252471 1:108025811-108025833 AGGCAGCAGGTACGCAAGGAGGG - Intergenic
912933963 1:113986770-113986792 GGGCCACATGTGGCCCAGGATGG - Intergenic
913235150 1:116774540-116774562 GGGCACCATGCAGCTCAGGATGG + Intergenic
913497423 1:119441182-119441204 GTCCCGCCTGTACCCCAGGAAGG + Intergenic
913505115 1:119509738-119509760 GTCCTGCTTGTACCCCAGGAAGG + Intronic
915018785 1:152760669-152760691 GGGCAGGAGGCGCCCCAGGAGGG - Exonic
915026827 1:152838653-152838675 GGGCCCCATGTGACCCAGGACGG - Intergenic
915394349 1:155571228-155571250 GGGCTGCATACAACCCAGGACGG + Intergenic
915972063 1:160362099-160362121 GGGAAGCAGGGACCCCTGGAAGG + Intergenic
917773231 1:178303540-178303562 GGGCTGCATGCAGCCCAGGATGG - Intronic
918385074 1:183997643-183997665 GGGCCACATGCAGCCCAGGACGG - Intronic
918450334 1:184651323-184651345 GGGTCGCATGCAGCCCAGGATGG + Intergenic
918478593 1:184952645-184952667 GGGCTGCATGTGGCCCGGGAAGG - Intronic
918733201 1:188023778-188023800 GGGCTGCATGCAACCCTGGATGG - Intergenic
919226567 1:194711105-194711127 AGACAGCATGTACCCCAGCTGGG - Intergenic
920332784 1:205222916-205222938 AGGCCGCATGCAGCCCAGGACGG - Intergenic
920353040 1:205350333-205350355 TGGCAGCAGGCACCCCAGAAAGG - Intronic
920372487 1:205488127-205488149 GGGCTGCATGTGGCCCAGGATGG - Intergenic
920435074 1:205942282-205942304 GGGCAGCATGGAGACCAGCATGG - Intronic
920613694 1:207468266-207468288 GGACAGCATGTGGCCCAGGATGG + Intronic
920834948 1:209502171-209502193 CAGCAACAAGTACCCCAGGATGG + Intergenic
922435996 1:225607307-225607329 GGGCCACATGTGGCCCAGGATGG - Intronic
922507442 1:226134746-226134768 GGGAGGCATGAAGCCCAGGAAGG - Intergenic
922755660 1:228095451-228095473 AGGCCGCATGTGGCCCAGGATGG + Intronic
922942993 1:229484433-229484455 GGGCTGCATGCGGCCCAGGATGG - Intronic
923116764 1:230947627-230947649 GGGCCACATGCAGCCCAGGATGG - Intronic
924714484 1:246560007-246560029 GGGCCGCATACAGCCCAGGACGG + Intronic
924942203 1:248819793-248819815 GGGCCGCATGCAGCCCAGGATGG - Intronic
1062819611 10:524156-524178 GGGCAGCTTCTACCCCAGGGAGG + Intronic
1062863901 10:833337-833359 GGGCGGCATGCCGCCCAGGACGG - Intronic
1062884186 10:1004235-1004257 TGGCAGCAAGGACCCCAGAATGG + Intronic
1062903720 10:1165795-1165817 GGGCAAACTGTAGCCCAGGAAGG + Intergenic
1063524545 10:6772776-6772798 GGGCTGCACGTGGCCCAGGATGG - Intergenic
1063599025 10:7463371-7463393 AGGCCGCATGCAGCCCAGGATGG - Intergenic
1064189138 10:13190048-13190070 GGGCCACATGCAGCCCAGGATGG - Intronic
1064706652 10:18079388-18079410 GGGCTGCATGTGGCCCAGGATGG - Intergenic
1064918242 10:20486440-20486462 TGGCTGCATGTGGCCCAGGATGG + Intergenic
1065050750 10:21788611-21788633 TGGCAGCAAGTAGCCCAGAATGG - Intronic
1065124064 10:22555977-22555999 GGGCTGCATGGGGCCCAGGACGG - Intronic
1065586790 10:27226580-27226602 GGGCAGCATGTGGCCCAAGACGG + Intronic
1065616761 10:27535179-27535201 GGGCTGCATGTGGCCCAGGATGG + Intronic
1065685206 10:28277476-28277498 GGGCCGCATGCAGCCCAGGACGG - Intronic
1065731569 10:28713947-28713969 GGGCAGCAAGTATCCCATGGGGG + Intergenic
1065796415 10:29312303-29312325 GAGCTGCATGTGGCCCAGGATGG + Intronic
1066246421 10:33587611-33587633 GGGCTGCATGCAGCCCAGGATGG - Intergenic
1066250629 10:33629556-33629578 GGGCCACATGTGTCCCAGGATGG - Intergenic
1066326889 10:34369213-34369235 GGGCCGCATGTGGTCCAGGATGG + Intronic
1067486687 10:46657152-46657174 GGGCTGCATGTGGTCCAGGATGG - Intergenic
1067608061 10:47684510-47684532 GGGCTGCATGTGGTCCAGGATGG + Intergenic
1067851629 10:49758544-49758566 TCGCAGCCTGTACCCCAAGACGG + Exonic
1068525121 10:58119965-58119987 GGGCCACATGCAACCCAGGACGG + Intergenic
1069578793 10:69550949-69550971 AGGTAGCTTGTACCCAAGGATGG - Intergenic
1069855638 10:71439541-71439563 GGACAGCCAGTCCCCCAGGAGGG + Intronic
1071623660 10:87146217-87146239 GGGCTGCATGTGGTCCAGGACGG + Intronic
1071793039 10:88976277-88976299 GGGCCACATGCAGCCCAGGATGG - Intronic
1072262918 10:93698834-93698856 GGGCCTCATGTGGCCCAGGATGG + Intronic
1072468763 10:95692681-95692703 CGGCCGCATGCAGCCCAGGACGG + Intronic
1073052397 10:100676252-100676274 GGGCCGCATGCAGCCCAAGATGG + Intergenic
1073250429 10:102117705-102117727 GGGCAGCATGTGGCTCAGAAGGG - Intronic
1073303090 10:102482855-102482877 GGGCTGCACGTGGCCCAGGATGG - Intronic
1074171917 10:110948846-110948868 GGGCCACATGCAGCCCAGGATGG + Intronic
1075075917 10:119350075-119350097 GGCCAGAATGTGCCACAGGATGG + Intronic
1075435647 10:122438946-122438968 GGGCCGCATGTGGCCCAGGACGG - Exonic
1075538219 10:123289322-123289344 AGGCTGCATGCAGCCCAGGAGGG + Intergenic
1075788758 10:125068531-125068553 GGGCAGCAGGAAGGCCAGGAAGG + Intronic
1076063930 10:127433744-127433766 GGGCCACATGCAGCCCAGGATGG + Intronic
1076075822 10:127533123-127533145 GGGCCACATGTGGCCCAGGATGG + Intergenic
1076287764 10:129317065-129317087 AGGCTGCATGCAGCCCAGGATGG + Intergenic
1076314559 10:129531451-129531473 GGGCATCACGGACACCAGGAGGG - Intronic
1076345742 10:129777931-129777953 GGGCAGCCTGGACCACGGGAGGG - Intergenic
1076602118 10:131664050-131664072 GGGCTGCATGTGGCCCAGGATGG - Intergenic
1077069508 11:661943-661965 GGGCTGCATGCAGCCCAGGATGG + Intronic
1077408590 11:2393346-2393368 GGGCAGCATGCACCTGGGGAGGG - Intronic
1077444847 11:2586183-2586205 GGGCCTGATGTCCCCCAGGAAGG + Intronic
1077768461 11:5188548-5188570 GGGCTGCATGCATCCCAAGATGG + Intergenic
1077898582 11:6473083-6473105 GGGCAGGCTGCACCCCAGGGAGG - Intronic
1077943192 11:6866342-6866364 GGGCTGCATGCAGACCAGGACGG + Intergenic
1078061335 11:8046989-8047011 AGGCTGCACGTAGCCCAGGATGG - Intronic
1078617922 11:12882093-12882115 GGGTAGCCTGTAGCTCAGGAGGG + Intronic
1078758483 11:14233346-14233368 GGGGAGCAAGGACCCCAGGCAGG - Intronic
1078842461 11:15091569-15091591 TGGCAGCAAGTACCCCAGAAGGG + Intergenic
1079027673 11:16961590-16961612 GGGCAGCATCATCCCCAGAAGGG + Intronic
1079091907 11:17486658-17486680 GGGCAGAATGCTCCCAAGGAAGG - Intergenic
1079200833 11:18376131-18376153 GGATCACATGTACCCCAGGAAGG + Intergenic
1080190309 11:29537494-29537516 GGGCTGCATGTGGCCCAGGATGG + Intergenic
1080623687 11:34009083-34009105 GGGCAGCATGTGTCCCAGGATGG - Intergenic
1080642470 11:34165880-34165902 GTACAGCAGGTACCCCAGGAAGG + Intronic
1080870095 11:36229323-36229345 GGGCAGCCTGGCCCCCAGGAGGG + Exonic
1081047078 11:38288998-38289020 GGGCCGCAAGTGCCCCAGAATGG + Intergenic
1081296469 11:41395963-41395985 GGGCCACATGTGGCCCAGGACGG + Intronic
1081486059 11:43530151-43530173 GGGCTGCATGCAGTCCAGGATGG + Intergenic
1081504596 11:43702727-43702749 GGGCCACATGTGGCCCAGGATGG + Intronic
1081616942 11:44596689-44596711 GGGCAGCTTGTATGACAGGAGGG + Intronic
1081683979 11:45028504-45028526 GGGCCACATGCAACCCAGGAAGG - Intergenic
1081914248 11:46720557-46720579 GGGAAGGATTTGCCCCAGGAAGG + Intronic
1083011100 11:59400388-59400410 GGGCAGCATGCAGCCCAGGATGG - Intergenic
1083547053 11:63556637-63556659 TGGAAACAAGTACCCCAGGAGGG - Intronic
1083605894 11:63978709-63978731 GGGCAGGAAGTACCTCAGCAGGG + Intronic
1083708761 11:64534582-64534604 GGGCACTTTGTTCCCCAGGACGG - Intergenic
1083868438 11:65471565-65471587 GGGCAGTGTGCACCCCTGGAAGG + Intergenic
1083880618 11:65546664-65546686 GGGCAGCCTCTACTCCCGGAAGG + Intronic
1083896667 11:65623544-65623566 CAGCAGCAGGTAGCCCAGGAAGG - Exonic
1085470655 11:76755523-76755545 GGGCCGCATGTGGCCCAGGACGG - Intergenic
1085494820 11:76959452-76959474 GGGCCGCATGTGACCCAGGATGG + Intronic
1085735923 11:79039005-79039027 AGGGAGAATGTACCCCAGGGGGG + Intronic
1087097616 11:94334759-94334781 AGGCTGCATGCAGCCCAGGATGG - Intergenic
1087762472 11:102115872-102115894 GGTCAGCATGTGACCCAGCAGGG - Intronic
1088275803 11:108083901-108083923 GGGCTGCATGCGGCCCAGGACGG + Intronic
1088298550 11:108328839-108328861 GGGCCGCATGTGGCCCAGGACGG - Intronic
1088373535 11:109116814-109116836 GGACCGCATGTGGCCCAGGATGG - Intergenic
1088942344 11:114472464-114472486 GGGCCACATGTGACCCAGGATGG - Intergenic
1089070485 11:115695994-115696016 GGGGATCATCTCCCCCAGGAGGG - Intergenic
1089485705 11:118844524-118844546 AGGCTGCATGTGGCCCAGGATGG + Intergenic
1090215414 11:124958281-124958303 GGGCCACATGTGGCCCAGGATGG + Intronic
1090656437 11:128849533-128849555 GGGCAGCAGGTACCCTGGGTTGG + Intronic
1090869512 11:130730801-130730823 AGGCTGCATGAAGCCCAGGACGG + Intergenic
1091557377 12:1584484-1584506 GAACAGCATGACCCCCAGGAAGG - Intronic
1092788445 12:12050905-12050927 GGGCTGCATGAGGCCCAGGATGG - Intronic
1093999056 12:25674803-25674825 GGGCTGCATGCAGCCCAAGATGG - Intergenic
1094096086 12:26706487-26706509 GGGCAGCTTGTACACAAGGAAGG - Intronic
1094608024 12:31966232-31966254 GGGCAGCATGCAGCCCAAGACGG - Intronic
1094800739 12:34031788-34031810 AGGCCGCATGTAGCCCAGGATGG + Intergenic
1095182658 12:39164157-39164179 GGACAGCATGTTGCCCAGGCTGG + Intergenic
1095475440 12:42582724-42582746 GGGCCACATGCAACCCAGGATGG + Intronic
1095662332 12:44752033-44752055 GGGCTGCATGCAGCCCAGGATGG - Intronic
1095859195 12:46896571-46896593 AGGCTGCATGTGGCCCAGGATGG + Intergenic
1097153456 12:56995877-56995899 GGGCAGCAGGAAGCCCAGGATGG - Exonic
1097651417 12:62302488-62302510 GGGCTGCATGCGGCCCAGGATGG + Intronic
1098005327 12:65990499-65990521 GGGCCACAAGTAGCCCAGGATGG + Intergenic
1098157117 12:67610722-67610744 GGGCCACAAGTAGCCCAGGATGG + Intergenic
1098345472 12:69498435-69498457 GGGCCGCATGAACCGCAGGTTGG - Intronic
1098381381 12:69873318-69873340 GGGCTGCATGCAGCCCAGGACGG - Intronic
1098514521 12:71358556-71358578 TGGCAGCAAGTACCCCAGAATGG - Intronic
1098781902 12:74698218-74698240 GGGCTGCATGCGGCCCAGGACGG + Intergenic
1099363748 12:81742070-81742092 GGACAGCAAGAACACCAGGATGG + Intronic
1099799409 12:87438902-87438924 GGGCTGCATGTAGCCCAGGATGG + Intergenic
1100403256 12:94250530-94250552 GGGCAGCATGAGTCCAAGGATGG + Intronic
1101158526 12:101950859-101950881 GGGCTGCATGCGGCCCAGGATGG - Intronic
1101526790 12:105538316-105538338 GGGAAGCATCAACCCCAGGGGGG + Intergenic
1101631250 12:106497035-106497057 GGGCGGCATGTGGCCCAGGACGG + Intronic
1102491362 12:113291366-113291388 GGGCAGCCTTTATCCCAGTAGGG - Intronic
1102599287 12:114016958-114016980 GGCCTGCAAGCACCCCAGGATGG - Intergenic
1103118755 12:118362414-118362436 AGGCTGCATGCACCCCAGGATGG - Intronic
1103285739 12:119799764-119799786 GGGCTGCATGCAGCCCAGGATGG + Intronic
1103598869 12:122041404-122041426 GTGCAGCATGGCCCCCAGAAAGG + Intronic
1103964590 12:124630690-124630712 GGGCACAGTGGACCCCAGGATGG + Intergenic
1104658885 12:130594630-130594652 GGGCCACATGCAGCCCAGGATGG - Intronic
1104801438 12:131557450-131557472 CACCAGCATGTGCCCCAGGAGGG + Intergenic
1104837512 12:131800933-131800955 GGGCAGCATCTGCCCGAGGACGG - Intergenic
1105309057 13:19190171-19190193 AGGCAGCGTTAACCCCAGGAGGG - Intergenic
1105528550 13:21197977-21197999 AGGCAGCATTAACCCCAGGGGGG + Intergenic
1105753260 13:23441319-23441341 GGGCAGAAAGGTCCCCAGGACGG - Intergenic
1106089757 13:26579920-26579942 GGGCTGCATGTGGCCCAGAATGG + Intronic
1106284284 13:28305697-28305719 GGGCTGCATGAATCCCAGGATGG + Intronic
1106755263 13:32816067-32816089 AGGCCACATGTAGCCCAGGATGG - Intergenic
1106793660 13:33182667-33182689 AGGCCGCATGCAGCCCAGGATGG - Intronic
1106840783 13:33683003-33683025 AGGCAGCATGGACCCAACGACGG - Intergenic
1107011898 13:35678348-35678370 AGGCTGCATGTGGCCCAGGATGG + Intergenic
1107155545 13:37163058-37163080 GGGCAGCATGTGGCCCAGGACGG + Intergenic
1107445437 13:40466361-40466383 GGGCCGCATGCAGCCCAGGATGG - Intergenic
1108481808 13:50880231-50880253 AGGCTGCATGCAGCCCAGGATGG + Intergenic
1108538082 13:51406814-51406836 AGGCTGCATGTAGCCCAGTATGG + Intronic
1110335920 13:74329592-74329614 GGGCAGCGTGTAGCTCAGCATGG + Intergenic
1111588958 13:90318768-90318790 GGGCCACATGCAGCCCAGGATGG + Intergenic
1111911351 13:94315872-94315894 GGCCTGCATGTGGCCCAGGATGG + Intronic
1113432228 13:110261193-110261215 AGGCAGCCTGCTCCCCAGGAAGG + Intronic
1113477947 13:110598666-110598688 GGGCCACATGTGGCCCAGGAGGG + Intergenic
1113694525 13:112334767-112334789 GGGCCGCATGTGGCCCAGGATGG - Intergenic
1114856635 14:26454228-26454250 GTGCAACCTGTGCCCCAGGATGG - Intronic
1115199527 14:30838055-30838077 GGGCTGCATGTGGCCCAGGATGG - Intergenic
1115428455 14:33288417-33288439 GGCGAGCATGTTCCCCAGGCTGG + Intronic
1115635755 14:35288881-35288903 AGGCTGCATGTGGCCCAGGATGG + Intronic
1115696667 14:35906618-35906640 AGGCTGCATGTGGCCCAGGAAGG + Intronic
1116001324 14:39245457-39245479 AGGCTGCATGCAGCCCAGGATGG - Intronic
1117235882 14:53774082-53774104 GGGCCACATGTGGCCCAGGAAGG + Intergenic
1117874997 14:60243088-60243110 GGGCCGCATACAGCCCAGGATGG + Intergenic
1118391685 14:65301067-65301089 GGACTGCATGTGGCCCAGGACGG + Intergenic
1118582746 14:67319693-67319715 GAGCTGCATGCAGCCCAGGACGG - Intronic
1118649429 14:67874340-67874362 GGGCCGCATACAGCCCAGGATGG + Intronic
1118965943 14:70585480-70585502 GGGCAGCATGAGGCCCAGGATGG + Intronic
1119356732 14:74013410-74013432 GGGCCGCATGTAGCCCAGGATGG + Intronic
1120077147 14:80172032-80172054 GAGCCGCATGCAGCCCAGGATGG + Intergenic
1120503576 14:85326505-85326527 GGGCACCATGTGGCCTAGGATGG - Intergenic
1121267719 14:92615270-92615292 GGGCCGCATGCAGCCCAGCATGG + Intronic
1121922167 14:97892198-97892220 GGGCTGCATGCAGCCCAGGACGG + Intergenic
1122156953 14:99755657-99755679 AGGCACCCTGTTCCCCAGGAGGG - Intronic
1123886196 15:24730399-24730421 GGGCCACATGTGGCCCAGGACGG - Intergenic
1124031384 15:26015628-26015650 GGGCTGCATGTGTACCAGGAAGG - Intergenic
1125337457 15:38641173-38641195 GGGCTGCATGCAGCCAAGGATGG - Intergenic
1125851887 15:42912048-42912070 GGGCCGCACGTGGCCCAGGACGG - Intronic
1126619219 15:50620217-50620239 GGGCTGCATGCAGCCCAAGATGG + Intronic
1127218378 15:56849280-56849302 AGGCTGCATGCAGCCCAGGATGG + Intronic
1127274659 15:57431649-57431671 GGGCTGCCTGTGGCCCAGGATGG + Intronic
1128227224 15:66010548-66010570 GGGCCGCATGCAGCCCAGGATGG - Intronic
1128606694 15:69041780-69041802 GGGCCGCATGGGGCCCAGGACGG + Intronic
1128880892 15:71241820-71241842 GGGCGTCATGTGGCCCAGGATGG + Intronic
1129499344 15:76020674-76020696 GGGCCGCATGCAGCCCAGAATGG - Intronic
1129566256 15:76626068-76626090 AGGCCGCATGTGGCCCAGGATGG - Intronic
1129696453 15:77743113-77743135 AGGCAGCATGGAGCCCAGGAGGG - Intronic
1129876041 15:78976463-78976485 GGGCCGCATATGGCCCAGGATGG - Intronic
1130452563 15:84071289-84071311 GGGCTGCGTGTGGCCCAGGATGG + Intergenic
1131244814 15:90781741-90781763 GGGCCACATGCAGCCCAGGATGG - Intronic
1132110987 15:99102353-99102375 GAGCAGAATGGATCCCAGGAGGG - Intronic
1133161748 16:3916434-3916456 GGGCAGCATGCACCAGAGAAAGG + Intergenic
1135043806 16:19137956-19137978 GGGCTGCATGCAGCCCAGGATGG + Intronic
1135397405 16:22141750-22141772 GGGCAGCAGGTACCGTGGGAAGG + Intronic
1135772607 16:25228699-25228721 GGGCAGCGTGTTCCCCAGGCTGG - Exonic
1136296252 16:29305049-29305071 GCACAGCCTGTGCCCCAGGATGG + Intergenic
1137242950 16:46673862-46673884 AGGCCGCATGCAGCCCAGGATGG + Intronic
1137437770 16:48471548-48471570 GGGCAGCCAGGAGCCCAGGAGGG + Intergenic
1139173561 16:64660663-64660685 GGGCTGCTTGTGGCCCAGGACGG - Intergenic
1139729231 16:68928495-68928517 GGGCACCATGTTAGCCAGGATGG + Intronic
1139935884 16:70570757-70570779 TGGCAGTGTGTGCCCCAGGAGGG - Intronic
1140348762 16:74241274-74241296 GGGCTGCATGAAGCCCAGGAGGG - Intergenic
1142264139 16:89055767-89055789 GACCAGCAAGAACCCCAGGACGG - Intergenic
1142278132 16:89133592-89133614 GGGCAGCAGGGCCACCAGGAAGG - Intronic
1142364326 16:89641972-89641994 GGTCTGCCTGCACCCCAGGATGG - Intergenic
1144030861 17:11321788-11321810 AGGCTGCATGAAGCCCAGGATGG + Intronic
1144274455 17:13652293-13652315 GGGCTGCATGCAGCCCAGGATGG - Intergenic
1144307981 17:13986664-13986686 GTGCAGCTTGTGCCTCAGGAAGG - Intergenic
1144463594 17:15478717-15478739 GGGTCGCATGTGGCCCAGGATGG - Intronic
1145745533 17:27316967-27316989 GGGCCACATGTGGCCCAGGATGG - Intergenic
1146108326 17:30063248-30063270 TGGCAGCAAGTAACCCAGAAAGG - Intronic
1146212521 17:30953480-30953502 GGGCCACATGCAACCCAGGACGG + Intronic
1146453213 17:32991014-32991036 TGGTAGCAGGTGCCCCAGGATGG - Intronic
1146514152 17:33475835-33475857 GGCAAGCATTCACCCCAGGAAGG - Intronic
1146724162 17:35143947-35143969 AGGCTGCATGCAGCCCAGGATGG + Intergenic
1147220015 17:38923044-38923066 GGGCTGCCTGCACCCCTGGAGGG - Intergenic
1148105514 17:45116680-45116702 CACCAGCATGTCCCCCAGGATGG + Exonic
1149638871 17:58190716-58190738 GGGATGTATGTACCCCAGGTTGG - Intergenic
1149638890 17:58190780-58190802 GGGGTGCATGTACCCCAGGTTGG - Intergenic
1149638900 17:58190812-58190834 GGGCTGTATGTACCCTAGGTTGG - Intergenic
1149638948 17:58191003-58191025 GGAATGCATGTACCCCAGGTTGG - Intergenic
1149711723 17:58749170-58749192 GGGCCACATGCAGCCCAGGACGG + Intergenic
1150563491 17:66316439-66316461 GGGCCGCATGCAGCCCAGGATGG + Intronic
1151273309 17:73013610-73013632 GGGCAGCAGGTGGCCCAGGACGG + Intronic
1151459862 17:74248147-74248169 GGGGAGCATGTGCCAGAGGAGGG + Intronic
1151778323 17:76224802-76224824 GGGCTACATGTGGCCCAGGATGG - Intronic
1151993613 17:77594626-77594648 GCACAGCATGGACCCCAAGAGGG - Intergenic
1152011264 17:77719822-77719844 GGGCCGCATGCAGCCCAGGATGG - Intergenic
1152523481 17:80873958-80873980 GAGCAGCGGGTACCCCAGAAGGG + Intronic
1152838018 17:82547432-82547454 GGGCTGCATGCAGCCCAGGATGG - Intronic
1152942246 17:83178792-83178814 GGGCAGCATGGGGCTCAGGACGG + Intergenic
1153538282 18:6127215-6127237 GGGCTGCATGTGGCCTAGGATGG + Intronic
1154173768 18:12068403-12068425 GAGCAGCACGTACGCCAAGAGGG - Intergenic
1155054471 18:22171719-22171741 GGGCAGCATGGAACCCACGCGGG - Exonic
1155413108 18:25567612-25567634 GGGCTGCATGTGTCCCAGGATGG + Intergenic
1155676540 18:28436036-28436058 AGGCTGCATGTGGCCCAGGATGG + Intergenic
1155703843 18:28782984-28783006 GGGCCGCATGTGGCCCAGGATGG + Intergenic
1156258488 18:35422508-35422530 TGACAGCAAGTACCCCAGAATGG + Intergenic
1156454965 18:37287669-37287691 GGGCAGCAGGGAATCCAGGAGGG - Intronic
1156469222 18:37367097-37367119 GGCCAGCATGCACCTGAGGAGGG + Intronic
1156803612 18:41149134-41149156 GGGCCACATGTGGCCCAGGATGG - Intergenic
1159043965 18:63351034-63351056 GGGCAGCGTGTACCCCAGCCGGG - Exonic
1159250887 18:65874991-65875013 GGGCCACATGTGGCCCAGGATGG + Intronic
1159322774 18:66875471-66875493 TGGAAGCTTGTATCCCAGGATGG - Intergenic
1159440925 18:68478976-68478998 GGGCCACATGTGTCCCAGGATGG + Intergenic
1160452567 18:78975361-78975383 GGGCTGCATGTAGACCAGGAGGG - Intergenic
1161965878 19:7548474-7548496 GGGCTGCACGTGGCCCAGGATGG - Intronic
1162158982 19:8697991-8698013 GAGCAGCATCTCCGCCAGGAAGG + Exonic
1162367774 19:10259677-10259699 GAGCAGCTTGTCCTCCAGGAAGG - Exonic
1163101477 19:15099826-15099848 AGGCTGCATGTGGCCCAGGAAGG - Intergenic
1163303895 19:16465159-16465181 TGGCTGCATGTGGCCCAGGATGG - Intronic
1163631404 19:18419642-18419664 GAGCAGCATGTACGCCAAGGGGG + Exonic
1164689834 19:30202399-30202421 GGGGAGAATGTACGCCAGGCGGG + Intergenic
1165446418 19:35859257-35859279 GGGCTGCATGCAGCCCAGGATGG + Intronic
1165621102 19:37248872-37248894 AGGCTGCATGTGGCCCAGGATGG - Intergenic
1166420912 19:42635242-42635264 AGGCATCATGGACCCCAGGGAGG + Intronic
1166502764 19:43353737-43353759 TGGGAGGATGAACCCCAGGAGGG - Exonic
1166689777 19:44815375-44815397 GCGCAGGGTCTACCCCAGGAAGG - Intronic
1166953482 19:46446187-46446209 GGGCTGCATGCGGCCCAGGATGG - Intergenic
1167449551 19:49558927-49558949 GTGCAGAATGTACTCCAGGATGG + Exonic
1167791363 19:51684788-51684810 GGGCCTCATGTGGCCCAGGATGG - Intergenic
1167833272 19:52045071-52045093 GGGCTGCATGCAGCTCAGGATGG - Intronic
925145123 2:1576765-1576787 GGGCTGCATGCGGCCCAGGATGG + Intergenic
925402950 2:3588677-3588699 GGGCTGCATGTGGCCCAGGATGG + Intergenic
925593531 2:5533293-5533315 GGGCTGCTTGCAGCCCAGGATGG - Intergenic
925786403 2:7435368-7435390 GGGCAGCATGTATGACAGGCAGG - Intergenic
926307514 2:11649291-11649313 GGCCAGCATCTAACCCAGGCTGG + Intergenic
926421800 2:12707302-12707324 GGGCTGCATGCGGCCCAGGATGG - Intergenic
926754006 2:16221575-16221597 GGACAACATGGACCACAGGATGG - Intergenic
927278009 2:21278252-21278274 TGGCAGCATGTACCCTAGGGTGG - Intergenic
927727562 2:25438385-25438407 GGGCTGCATGCAGCCCAGGATGG - Intronic
927761890 2:25764517-25764539 AGGCTGCATGTGGCCCAGGATGG - Intronic
928766300 2:34650495-34650517 GGGTATCATCAACCCCAGGAGGG - Intergenic
930025941 2:47029176-47029198 GGGCAGCATGTGCCTGGGGAAGG + Intronic
930029418 2:47049255-47049277 GGGCTGCTTGTGCCCCAGGATGG + Intronic
930376632 2:50575351-50575373 GGGCTGCATCTTCCCCAGGGTGG + Intronic
930591164 2:53328176-53328198 GGGCTGCATGCAGCCCAGGATGG - Intergenic
931224673 2:60319383-60319405 GGGCATCATGAACCCCCAGATGG - Intergenic
931572762 2:63687147-63687169 GGGCTGCATGCAGCCCAAGATGG - Intronic
931890432 2:66665452-66665474 GGCCAGCATGGTCCCCAGAATGG - Intergenic
932285776 2:70530566-70530588 GGGCCGCCTGTGGCCCAGGAGGG - Intronic
932344443 2:70986374-70986396 GGGCAGCAGGGAGCCAAGGAAGG + Exonic
932784704 2:74590026-74590048 AGGCTGCATGCAGCCCAGGACGG - Intronic
932958868 2:76388758-76388780 AGGCTGCATGTAGCCCAGGATGG - Intergenic
933112117 2:78416052-78416074 GGGCTGCATGCAGCCCAGGATGG + Intergenic
935036155 2:99376067-99376089 GGGCCACATGCAGCCCAGGATGG + Intronic
935083392 2:99821568-99821590 GGGCTGCATGCAGCCCAGGACGG - Intronic
935754308 2:106265144-106265166 GGGCACCATGGGCCTCAGGAGGG + Intergenic
936004700 2:108873820-108873842 GGGCTGCATGCGGCCCAGGATGG - Intronic
936954880 2:118013772-118013794 GGGGAGCAGGTACCCCTGCATGG - Intronic
937827753 2:126386748-126386770 AGGCTGCATGTGGCCCAGGATGG - Intergenic
937988590 2:127649892-127649914 GGGCAGCATCTCTTCCAGGAGGG - Intronic
938293428 2:130162303-130162325 GGGCAGGATGTGCACCAGGCCGG - Intronic
938463126 2:131510658-131510680 GGGCAGGATGTGCACCAGGCCGG + Intergenic
938620180 2:133043593-133043615 GGGCTGCATGTGACCCAGGATGG - Intronic
938958278 2:136318618-136318640 GTGCAGCCTGTGCCTCAGGATGG + Intergenic
939325261 2:140679832-140679854 GGGCCACATGCAGCCCAGGATGG + Intronic
939427522 2:142058469-142058491 GGGCTGCATGTGGGCCAGGATGG + Intronic
939633169 2:144550148-144550170 AGGCAGAATGTACCACTGGATGG + Intergenic
940024166 2:149187814-149187836 AGGCTGCATGCAGCCCAGGAAGG - Intronic
940158440 2:150684091-150684113 GGGCCACATGCAGCCCAGGAAGG + Intergenic
940265431 2:151830754-151830776 GGGCTGCATGCAGCCCAGGATGG - Intergenic
940432235 2:153606411-153606433 AGGCTGCATGTGGCCCAGGATGG + Intergenic
941203013 2:162538141-162538163 GGGCTACATGTGGCCCAGGATGG + Intronic
941226779 2:162859681-162859703 GGGCCACATGTGGCCCAGGAAGG + Intergenic
941959174 2:171236736-171236758 GGTGAGCATGTAACCCAGGATGG + Intergenic
942478491 2:176355832-176355854 GGGCTGCATATGGCCCAGGATGG + Intergenic
943985490 2:194612406-194612428 GGGCTGTATGCACCTCAGGATGG + Intergenic
944025976 2:195167694-195167716 GGGCTGCATGTAGCCCAGGATGG - Intergenic
944908440 2:204285729-204285751 GGGCCACATGCAGCCCAGGATGG + Intergenic
945386206 2:209203987-209204009 GGTCCGCATGTGGCCCAGGATGG - Intergenic
945476159 2:210285036-210285058 TAGCAGCAAGTACCCCAGAATGG + Intergenic
947025636 2:225734881-225734903 GGGCAGCAGGTACTCCCTGAGGG + Intergenic
947030338 2:225785082-225785104 GGGCTGCATGCAGCCCAGGATGG + Intergenic
947952586 2:234160977-234160999 GGGCAGAAAGTGCACCAGGAAGG + Intergenic
948457789 2:238114922-238114944 GGGCAGCACGGCACCCAGGAAGG + Intronic
948498374 2:238370580-238370602 GGGAAGCATGTACACTAGGCTGG - Intronic
948843742 2:240673015-240673037 TGGCAGCCGGTAGCCCAGGATGG - Intergenic
949063958 2:241978194-241978216 GGGCTGCATGCGGCCCAGGATGG + Intergenic
1169186424 20:3620903-3620925 GGGCTACATGCAGCCCAGGACGG + Intronic
1169438455 20:5613956-5613978 GGGCTACATGTGGCCCAGGACGG - Intergenic
1171004545 20:21451508-21451530 GGGCTGCATGTGGCCCAGGGTGG + Intergenic
1172951284 20:38724796-38724818 GAGCGGCATGTTCGCCAGGATGG + Exonic
1173372412 20:42448937-42448959 GGGCTGCATGCAGCCCAGGATGG - Intronic
1173597279 20:44267026-44267048 GGGCCACATGCAGCCCAGGATGG - Intronic
1173713541 20:45181180-45181202 AGGCTGCATGTGGCCCAGGATGG + Intergenic
1173809980 20:45949686-45949708 GGCAAGCATGGACCCCAGGAGGG + Intronic
1175097563 20:56553498-56553520 GGGCAGCGTGTACCCTTGGTAGG - Intergenic
1175166583 20:57048493-57048515 GGGCAGCAGGGAGCCCAGGGAGG + Intergenic
1175266768 20:57708234-57708256 GGGCAGCCTGGCCCCCAGCAGGG + Intronic
1175532068 20:59680588-59680610 GGGACGCATGCAGCCCAGGATGG + Intronic
1175611951 20:60358972-60358994 GGGCAGCAAACTCCCCAGGAGGG - Intergenic
1175977242 20:62717143-62717165 GGGCACCACCCACCCCAGGAGGG + Intronic
1176364033 21:6021810-6021832 GAGCAGCAGAGACCCCAGGAAGG - Intergenic
1177121145 21:17138453-17138475 GGGGTGCATGTACCCCAGTTTGG - Intergenic
1177777961 21:25590456-25590478 GGGCTGCATGCAGTCCAGGACGG - Intronic
1179017224 21:37604463-37604485 GGTCAGTATGTACCCCAGAAAGG - Intergenic
1179023570 21:37660353-37660375 TGGCATCATGTGCCCCAGGCTGG + Intronic
1179087686 21:38234195-38234217 GGACCACATGTAGCCCAGGATGG + Intronic
1179714241 21:43279672-43279694 GGGCACCATCTAACACAGGAGGG + Intergenic
1179759485 21:43516735-43516757 GAGCAGCAGAGACCCCAGGAAGG + Intergenic
1182393865 22:30021343-30021365 TGGCAGCATCTGCCACAGGATGG - Intronic
1182451157 22:30422695-30422717 GGGGGGCATGTACCACAGGGTGG + Exonic
1182716926 22:32364407-32364429 GGGCAGCAGGTGCACCAGCAGGG + Intronic
1183300624 22:37057339-37057361 GAGCACCAGGCACCCCAGGAGGG - Intronic
1183495710 22:38142686-38142708 AGGCTGCATGCAGCCCAGGACGG - Intronic
1183742384 22:39675958-39675980 AGGCAGCAGGTGCCACAGGAGGG + Intronic
1183979963 22:41533610-41533632 GGCCAACATGCCCCCCAGGACGG + Intronic
1184293580 22:43510430-43510452 GGCCAGCATGCACCCCAGCAGGG + Intergenic
1184464224 22:44659502-44659524 GAGCAGCTTGTGCCCCAGGTTGG - Intergenic
1184624673 22:45715444-45715466 AGGCCGCATGCAGCCCAGGATGG + Intronic
1184759053 22:46534626-46534648 TGGCACCATGTACACCATGATGG - Exonic
1185058102 22:48591747-48591769 GGGCAGCATGTTCCCCAGTCAGG + Intronic
1185135149 22:49066212-49066234 GGGCCCCATGTGGCCCAGGATGG - Intergenic
949190784 3:1245988-1246010 AGGCTGCATGCAACCCAGGATGG - Intronic
949286887 3:2417072-2417094 GGGCAGCATGTCCCACACTAAGG - Intronic
949791598 3:7798456-7798478 GGGCTGCGTGCAGCCCAGGATGG - Intergenic
949978274 3:9480741-9480763 GGGCTGCACGTGGCCCAGGATGG - Intergenic
950004317 3:9681896-9681918 GGGCAGCAAGTTCCCAAGGCTGG - Intronic
950613684 3:14141936-14141958 TGGCAGCATGTGCACCAGGTTGG + Exonic
950674357 3:14545553-14545575 GGGAAGCATGGAGCCCAAGAGGG - Intergenic
951341210 3:21489723-21489745 GGGCAACCTGTAGCACAGGATGG - Intronic
951778841 3:26340507-26340529 TGGCAGCAAGTACCCCAGAATGG + Intergenic
951808630 3:26675364-26675386 AGGTAGCAAGTACTCCAGGAAGG - Intronic
952273475 3:31855068-31855090 ATGCAGCATGCACCCCAGGCTGG - Intronic
952326443 3:32324652-32324674 TGGCAGCATCTTACCCAGGAAGG + Intronic
952801159 3:37293219-37293241 GGCCTGCATGCAGCCCAGGACGG + Intronic
952818062 3:37462782-37462804 GGGGACCATGCACCCCAGGATGG - Intronic
952902061 3:38117142-38117164 AGGCAGCATGCTACCCAGGAGGG - Intronic
952928814 3:38343823-38343845 GGGCTGCATGTGGCCCAGGATGG - Intergenic
953100597 3:39822372-39822394 GGGCTGCATGTGGCCCAGAATGG + Intronic
953313095 3:41899525-41899547 GGGCTGCATGCAGCCCAAGACGG + Intronic
953471783 3:43173568-43173590 GGGTTGCATGTGGCCCAGGAAGG + Intergenic
954786336 3:53095514-53095536 GGGCACCATGTTTCCCAGGCTGG - Intronic
955126475 3:56117136-56117158 AGGCAGTATGTAGCTCAGGAAGG - Intronic
955197053 3:56814217-56814239 AGGCTGCATGCATCCCAGGATGG + Intronic
955704108 3:61710531-61710553 GGGCAGCATGTACCCCAGGATGG + Intronic
955943437 3:64168447-64168469 AGGCTGCATGCAGCCCAGGATGG - Intronic
956952660 3:74299835-74299857 GGGCAGCATCTTCCCCATCAGGG - Intronic
957614995 3:82515834-82515856 GGGCAGCATGTGGCCCAGGATGG - Intergenic
957639821 3:82837845-82837867 GGGCTGCATGTGGCCCAGGATGG - Intergenic
958112314 3:89164338-89164360 GGGCCGCATGCGGCCCAGGATGG - Intronic
959084972 3:101842469-101842491 GGGCTGCATGTGGCCCAGGATGG + Intronic
959216068 3:103451703-103451725 GGGCAACCTGCAGCCCAGGATGG - Intergenic
959259915 3:104064552-104064574 AGGCCGCATGCAGCCCAGGATGG + Intergenic
959574738 3:107922464-107922486 GGGCCACATGTGGCCCAGGATGG - Intergenic
959992843 3:112647678-112647700 GGGCTGCATGCAGCCCAGGGTGG + Intronic
961426986 3:126856210-126856232 GGGCTGCATGCAGCCCAGGAAGG - Intronic
961747249 3:129072374-129072396 GTCCAACATGTGCCCCAGGATGG - Intergenic
961846519 3:129769160-129769182 GGGCCGCACGTGGCCCAGGATGG + Intronic
961902137 3:130223369-130223391 GGGCAGTATGTGGCCCAGGATGG + Intergenic
962574680 3:136745904-136745926 GGGCTGCATGCAGCCCAGAATGG - Intronic
962593819 3:136918597-136918619 GGGCTGCATGCAGCCCAGGATGG + Intronic
962819253 3:139032094-139032116 GGGCCGCATGCAGCCTAGGATGG + Intronic
963309466 3:143692893-143692915 GGGCTGCATGCAGCCCAAGATGG - Intronic
964348034 3:155774583-155774605 GGGCCACATGCAGCCCAGGATGG + Intronic
964481213 3:157140118-157140140 GGGTCGCATGCAGCCCAGGATGG - Intergenic
967185419 3:186940511-186940533 GGGCCGCATGTAGCCCAGGATGG + Intronic
968217720 3:196907818-196907840 GGGCAGCATGCAGCCCAGGACGG - Intronic
968807644 4:2786242-2786264 GCACAGCAGGTACTCCAGGAGGG + Intergenic
968900618 4:3429934-3429956 GAGCAGAATGAACCCGAGGAGGG - Intronic
968951807 4:3699390-3699412 GGCAAGCATGGCCCCCAGGAGGG - Intergenic
969618561 4:8267580-8267602 GGGCAGCATGGTCTCCAGGGAGG + Intergenic
969870811 4:10103654-10103676 GGGCTGCATGTGGCCCCGGATGG - Intronic
970031037 4:11675072-11675094 GGACAGCATGAACCCCAGATAGG + Intergenic
970035995 4:11736772-11736794 GTGCTGCATGTGGCCCAGGATGG - Intergenic
970164038 4:13217435-13217457 GGCCAGTATGTGCTCCAGGAAGG - Intergenic
970480881 4:16472620-16472642 GGGCCACATGCAGCCCAGGATGG - Intergenic
971936113 4:33149879-33149901 GTGAAGCATGTGACCCAGGAGGG - Intergenic
973248290 4:48034234-48034256 GGGCTGCATGTGGCCCAGGACGG + Intronic
973560428 4:52130031-52130053 GGGGAGCATAAACCCCAGGCAGG - Intergenic
973597839 4:52510839-52510861 TGGCTGCATGTGGCCCAGGATGG + Intergenic
973664775 4:53147857-53147879 GGGCTGCATGTGGCCCAGGATGG - Intronic
974968257 4:68791830-68791852 GAGCTGCATGCAGCCCAGGATGG - Intergenic
975003386 4:69255146-69255168 GGGCTGCATGCAGCCCAGGATGG - Intergenic
975011673 4:69362509-69362531 GGGCTGCATGCAGCCCAGGACGG - Intronic
976844553 4:89473225-89473247 GGGCTACATGTGGCCCAGGACGG - Intergenic
977237949 4:94531593-94531615 AGGCTGCATGTGGCCCAGGATGG - Intronic
978007914 4:103640661-103640683 AGGCTGCATGTGGCCCAGGATGG + Intronic
978083668 4:104623775-104623797 GGGCTGCATGTGGCCTAGGATGG - Intergenic
978150820 4:105432638-105432660 GGGCAGCATGCAGCCCAGGATGG + Intronic
978455537 4:108886365-108886387 GGGCCACATGCAGCCCAGGATGG + Intronic
978489026 4:109290832-109290854 AGGCTGCATGTGGCCCAGGATGG - Intronic
979550318 4:121983680-121983702 GGGCCACATGCAGCCCAGGATGG - Intergenic
981154420 4:141417189-141417211 AGGCCGCATGTGGCCCAGGAGGG - Intergenic
981342051 4:143632881-143632903 GGGCTACATGCAGCCCAGGATGG - Intronic
981344396 4:143658633-143658655 GGGCGGCATGCGGCCCAGGATGG + Intronic
981361864 4:143855168-143855190 GAGCTGCATGAAGCCCAGGAAGG + Intergenic
981372492 4:143974963-143974985 GGGCAACATGCAGCCCAGTATGG - Intergenic
981372598 4:143976072-143976094 GAGCTGCATGAAGCCCAGGAAGG + Intergenic
981420994 4:144550164-144550186 GGGCTGCATGTGGCCCAGGACGG - Intergenic
981751606 4:148097657-148097679 GGGCTGTATGTGGCCCAGGACGG + Intronic
981828566 4:148973647-148973669 GGGCCGCCTGTGACCCAGGATGG + Intergenic
981881199 4:149614800-149614822 GGGCCACATGTGGCCCAGGATGG - Intergenic
982160658 4:152565701-152565723 GGGCCGCATGTGGCTCAGGATGG + Intergenic
982550862 4:156797701-156797723 GGGCCCCATGTGGCCCAGGACGG - Intronic
983628165 4:169824185-169824207 GGGTTGCATGCAGCCCAGGATGG + Intergenic
985292345 4:188399589-188399611 GGGCCACATGCAGCCCAGGATGG + Intergenic
985546896 5:514434-514456 GGGCAGGGTGGGCCCCAGGAAGG - Intronic
985559065 5:572932-572954 GGGCCACATGTGGCCCAGGATGG + Intergenic
985749590 5:1666870-1666892 GGGCAGCATGCGGCCCAGGATGG - Intergenic
985838995 5:2291537-2291559 GGGCAGCCTGAGCACCAGGAAGG + Intergenic
985925862 5:3017939-3017961 GGGCTGCATGCCGCCCAGGATGG + Intergenic
987152384 5:15056160-15056182 TGGCAGCAAGTACTCCAGGATGG + Intergenic
987882237 5:23763055-23763077 AGGCTGCATGTAACCCAGGATGG + Intergenic
988527347 5:31998807-31998829 GGCCTGCATGTGGCCCAGGATGG - Intronic
989142614 5:38216914-38216936 AGGCTGCATGTGACCCAGGACGG - Intergenic
989817566 5:45754798-45754820 GGGCTGCATGAGGCCCAGGATGG - Intergenic
990409234 5:55524337-55524359 AGGCTGCATGCAACCCAGGATGG - Intronic
991097904 5:62758761-62758783 GGGCCACATGCAGCCCAGGATGG + Intergenic
991412819 5:66361778-66361800 GGGCTGCATGCAGCCCACGATGG + Intergenic
991431010 5:66546526-66546548 GGGCTGCATGCAGCCTAGGATGG - Intergenic
991484617 5:67121752-67121774 GAGCTGCATGCAACCCAGGATGG - Intronic
992075393 5:73188232-73188254 AGGCTGCATGTGGCCCAGGATGG - Intergenic
992087660 5:73292335-73292357 GGACCGCATGCACCCCAGGATGG - Intergenic
992195327 5:74333562-74333584 GGGTAGCAGATAACCCAGGAAGG - Intergenic
992643656 5:78792411-78792433 GGGCTGCACGTGGCCCAGGATGG - Intronic
993499716 5:88651661-88651683 GGGCTGCATGTGGCCCAGGATGG - Intergenic
993548983 5:89250154-89250176 GGGCCACATGTGGCCCAGGATGG - Intergenic
993719804 5:91311223-91311245 GGGCCACATGTGGCCCAGGATGG - Intergenic
993729508 5:91405661-91405683 GGGCCACATGTAGCCCAGGATGG - Intergenic
994082534 5:95723266-95723288 GGGCCGCATGTGGCCCAGGATGG - Intronic
994475564 5:100264224-100264246 GGGCTGCATGTGGCCCAGGATGG + Intergenic
995014214 5:107291734-107291756 GGGCTGCATGCGGCCCAGGATGG - Intergenic
995227654 5:109720749-109720771 GGGCTGCATGTGGCCCAGGACGG - Intronic
995408612 5:111830070-111830092 AGGCTGCATGTGGCCCAGGATGG + Intronic
995418407 5:111935430-111935452 GGGGAGGATGTACCCCTGCAGGG + Intronic
995727792 5:115200760-115200782 GAGCTGCATGCAGCCCAGGATGG + Intergenic
996563429 5:124855190-124855212 GGGCCACATGTGGCCCAGGATGG - Intergenic
996606235 5:125326868-125326890 AGGCTGCATGCAGCCCAGGATGG + Intergenic
996687493 5:126299671-126299693 GGGTCGCATGTGGCCCAGGATGG - Intergenic
996833394 5:127764813-127764835 GGGCCACATGTGGCCCAGGATGG - Intergenic
997217825 5:132129165-132129187 GGGCAGAATTTACCACAGCATGG - Intergenic
997309574 5:132868603-132868625 GGGCAGCAAGCAGCCCAGGATGG - Intergenic
998078350 5:139254723-139254745 TGGCAGCATGTTCTCCAAGAAGG - Intronic
998618439 5:143767564-143767586 GAGCTGCATGCAGCCCAGGATGG + Intergenic
998949821 5:147382044-147382066 GGGCCACATGTGCCTCAGGATGG - Intronic
999207541 5:149860563-149860585 GGGCCACATGCAGCCCAGGACGG + Exonic
1000218777 5:159191156-159191178 GGGCTGCGTGTGGCCCAGGATGG - Intronic
1000219228 5:159196156-159196178 GGGCTACATGTGGCCCAGGATGG + Intronic
1000339319 5:160265222-160265244 GGGCAGCAGGTAGCCCTGAATGG - Intronic
1000351425 5:160355723-160355745 GGGCCGCATGCACCCCAGGATGG + Intronic
1002197598 5:177509718-177509740 GGGCAGCCAGAACCCCAGGGAGG - Intronic
1003354294 6:5352049-5352071 AGGCAGCCTGTGGCCCAGGATGG + Intronic
1003403416 6:5809428-5809450 AGGCAGCATTATCCCCAGGAGGG - Intergenic
1003943654 6:11053209-11053231 GGGCCACATGCAGCCCAGGATGG - Intergenic
1004067626 6:12264689-12264711 GGGCAGCATGTGGTCCAGGATGG - Intergenic
1004609177 6:17222858-17222880 GGGCTGCATGCAGCCCGGGATGG - Intergenic
1004652179 6:17620600-17620622 AGGCCACATGTAGCCCAGGATGG + Intronic
1004922599 6:20390675-20390697 GGGCGGCATGTGGCCCAAGACGG - Intergenic
1005654028 6:27913724-27913746 GGGCTGCATGCAGCCCAGGATGG + Intergenic
1007163849 6:39814068-39814090 GGGCTGCATGCGGCCCAGGATGG + Intronic
1007264562 6:40586948-40586970 AGGCAGCATCTACCCCCGGCTGG + Exonic
1007488970 6:42203027-42203049 GGGCTGCATGCGGCCCAGGACGG + Intergenic
1007686210 6:43668734-43668756 GGGCAGCACCTAGCCCAGGCAGG + Intronic
1008394412 6:50990318-50990340 GGGCCACATGTGGCCCAGGATGG + Intergenic
1008424246 6:51338366-51338388 GGGTTGCATGCAGCCCAGGATGG - Intergenic
1009658013 6:66570464-66570486 AGGCTGCATGTGACCCAGGACGG - Intergenic
1009966469 6:70583769-70583791 GGGCTGCATGTGGCCCAGGATGG - Intronic
1010583328 6:77626686-77626708 GGGCCACATGCAGCCCAGGATGG + Intergenic
1010746017 6:79562890-79562912 AGGCTGCATGCAGCCCAGGATGG - Intergenic
1012316884 6:97791632-97791654 GGGTAGCCTCTACCCCAAGACGG + Intergenic
1013789613 6:113822187-113822209 GGGCTGCATGTGGCCCAGAATGG - Intergenic
1013916322 6:115341822-115341844 GGCCTGCATGTGGCCCAGGATGG + Intergenic
1014101895 6:117520298-117520320 GGGCCACATGCAGCCCAGGATGG - Intronic
1014540835 6:122674151-122674173 GGGCACCATGTACCACGTGAAGG + Intronic
1014554985 6:122835087-122835109 GGGCTGCATGCAGCCCAGGATGG - Intergenic
1014739954 6:125137649-125137671 GGGCCGCATGCTGCCCAGGAAGG - Intronic
1014927035 6:127284801-127284823 GGGCCACATGTGGCCCAGGATGG + Intronic
1016247257 6:141997274-141997296 GGGCTGCATGCAGCCCAGGATGG - Intergenic
1016595934 6:145801312-145801334 AGGCAGCATGTGGCCCAGGACGG + Intronic
1017246370 6:152231020-152231042 GGGCTGCATGCGGCCCAGGACGG - Intronic
1017370227 6:153696781-153696803 GGGCCGCATGCAACCCGGGAAGG + Intergenic
1017538627 6:155376237-155376259 GGTCTGCATGTGGCCCAGGATGG + Intergenic
1018371671 6:163174292-163174314 GGGCTGCATACAGCCCAGGATGG - Intronic
1018729112 6:166635808-166635830 AGGCTGCATCCACCCCAGGAGGG + Intronic
1019262665 7:90342-90364 GGGCAGCAGGGCCCCAAGGAAGG + Intergenic
1019287535 7:231224-231246 GGGCAGCGAGGACCCCTGGAGGG + Intronic
1019306036 7:336150-336172 GGGCTGGATGTCCCCCATGATGG - Intergenic
1019563616 7:1669480-1669502 GGGCAGCCTGGACCCCCGGCAGG - Intergenic
1019715645 7:2538111-2538133 GGCCAGCATGTCCTGCAGGAGGG + Exonic
1020089765 7:5332621-5332643 GGACAGGAAGGACCCCAGGAAGG - Exonic
1020339131 7:7090271-7090293 AGGCAGCATGTAAGCCAGGAAGG - Intergenic
1020354632 7:7263212-7263234 GGGCTGCATGTGGCCCAGGACGG + Intergenic
1022087543 7:27083268-27083290 GGGCTGCATGTAGCACAGGATGG - Intergenic
1022462503 7:30624025-30624047 AGGCTGCATGTGGCCCAGGATGG + Intronic
1022849558 7:34246232-34246254 GGGCATCATGGATCCCAGAATGG + Intergenic
1023040911 7:36172544-36172566 AGGCTGCATGCAGCCCAGGATGG + Intronic
1023200622 7:37693642-37693664 TGGCAGCAAGTACCCCAGAATGG + Intronic
1023428567 7:40065543-40065565 GGGCTGCATGCAACCCAGGATGG - Intronic
1023721148 7:43096106-43096128 GGGCCCCATGCAGCCCAGGATGG - Intergenic
1024012241 7:45278839-45278861 GTGCAGCATGTGCCACTGGAGGG + Intergenic
1024635939 7:51290615-51290637 GGGCAGTAGGGAGCCCAGGAAGG - Intronic
1027241329 7:76331464-76331486 AGGCTGCATGTAGCCCAGGATGG + Intronic
1027601399 7:80245499-80245521 GGGCAGCTGCTACCCCATGAGGG - Intergenic
1027775540 7:82460132-82460154 GGGCTGCATGTGGCTCAGGACGG - Intergenic
1028386512 7:90260003-90260025 GGGCTGCATGCTGCCCAGGATGG + Intronic
1030307992 7:108038575-108038597 GGGCCACATGTGGCCCAGGACGG + Intronic
1031603094 7:123737222-123737244 GGGCTGCATGTGGCCCAGGACGG - Intronic
1031670366 7:124535573-124535595 GGGCCGCATGCAGCGCAGGACGG + Intergenic
1032223347 7:130010653-130010675 GGGCTGCATGTGTCCCAGGGTGG + Intergenic
1032376016 7:131418573-131418595 GGGCTGCATGAGGCCCAGGATGG - Intronic
1032773875 7:135090235-135090257 TGGCAGCAAGTACCCCAGTGTGG + Intronic
1032903583 7:136338556-136338578 TGACAGCAGATACCCCAGGAAGG - Intergenic
1033285479 7:140037492-140037514 GAGGAGAATGGACCCCAGGAGGG - Intronic
1033344124 7:140514044-140514066 GGGCCACATGCAACCCAGGACGG - Intergenic
1033969416 7:147021118-147021140 AGGCTGCATGCAGCCCAGGATGG + Intronic
1035317520 7:158006092-158006114 GGGCAGCAGGTGCCCCAAGAAGG - Intronic
1035460694 7:159036792-159036814 GGGGAGCATGGCCACCAGGAGGG + Exonic
1036413123 8:8520803-8520825 GGGCCACATGTGCCCCAGGATGG - Intergenic
1036475933 8:9093314-9093336 GGGCCACATGCAGCCCAGGACGG - Intronic
1037142489 8:15535916-15535938 GGGTTGCATGTAACCCAGGACGG + Intronic
1037243922 8:16808949-16808971 AGGCTGCATGAAGCCCAGGACGG + Intergenic
1037256589 8:16962171-16962193 GGGCTGCATGCATCCCGGGACGG + Intergenic
1038341990 8:26693903-26693925 GGACAGCATGTACCCAGGGCAGG - Intergenic
1039830008 8:41205767-41205789 GGGCCACATGTGGCCCAGGATGG - Intergenic
1041079366 8:54202051-54202073 TGGCAGTAAGTACCCCAGAATGG + Intergenic
1041188633 8:55329297-55329319 CAGCTGCATGTAGCCCAGGACGG + Intronic
1041644728 8:60239565-60239587 GGGCCACATGCAGCCCAGGATGG - Intronic
1042105508 8:65322134-65322156 GGTCATCAAGTACCCCAGCAGGG - Intergenic
1042366333 8:67940928-67940950 GGGCCACATGCAGCCCAGGATGG + Intergenic
1042690872 8:71497288-71497310 GGGCTGCATGCGGCCCAGGATGG - Intronic
1042951916 8:74209261-74209283 GGGCTACATGTGACCCAGGATGG + Intergenic
1044079365 8:87864879-87864901 GGGCTGCATGTGACCCAGGATGG - Intergenic
1045050231 8:98317937-98317959 GGGCCACATGCAGCCCAGGATGG - Intergenic
1045367030 8:101485728-101485750 GGGCCACATGTGGCCCAGGATGG + Intergenic
1046094954 8:109546550-109546572 GGGCCTCATATAGCCCAGGATGG + Intronic
1047654030 8:126955864-126955886 GGGCTGCATGTGGCCCAGGATGG + Intergenic
1047848830 8:128834086-128834108 GGGCTGCGTGCAGCCCAGGATGG + Intergenic
1048136405 8:131750564-131750586 AGGCTGCATGCAGCCCAGGATGG + Intergenic
1049421955 8:142520972-142520994 GGTGAGGATGGACCCCAGGAGGG + Intronic
1049427985 8:142545748-142545770 GGGCAGCCTGAACCCCCGAAGGG + Intergenic
1049540679 8:143207481-143207503 GGGCAGCATCTCACCCAGGCTGG + Intergenic
1049731407 8:144180452-144180474 GGGCAGCAGGGAGCTCAGGACGG - Exonic
1049913190 9:290195-290217 GGGCAACATGGAGCCCAGGATGG + Intronic
1050825571 9:9941148-9941170 AGGCAGCATGCGGCCCAGGACGG - Intronic
1051389610 9:16550182-16550204 GGGCTGCATGTGGCCCATGAAGG + Intronic
1051446244 9:17142169-17142191 GGGCCGCATGCAGCCCAGGATGG + Intronic
1052035063 9:23671134-23671156 GGGCCGCTTGCAGCCCAGGATGG - Intergenic
1052768761 9:32668521-32668543 GGGCAGCATGCAGCCCAGGATGG - Intergenic
1053234259 9:36438333-36438355 GGGCTGCATGCAGCCCAGGAAGG + Intronic
1054855534 9:69895279-69895301 GGCCAGCAAGTAACTCAGGAAGG - Intronic
1056370233 9:85946595-85946617 GGGCTGCATGTGGCCCAGGATGG + Intronic
1057205101 9:93167107-93167129 GGGGAGCATCTGCCCCAGGCAGG + Intergenic
1058023207 9:100112747-100112769 GGGCCACATGTAGCCCAGGAAGG - Intronic
1058072993 9:100620126-100620148 GGGCTGCATGTGGCCCAGGACGG - Intergenic
1058727003 9:107813966-107813988 GGGCCGCATGCAGCCCAAGATGG - Intergenic
1058797591 9:108513427-108513449 GGGCCACATGTGGCCCAGGATGG + Intergenic
1060057491 9:120427327-120427349 GGGCTGCATGCAGCCCAGGACGG - Intronic
1060200589 9:121649916-121649938 CGGCTGCATGTGGCCCAGGATGG + Intronic
1060457293 9:123810664-123810686 GGGCTGTATGTGGCCCAGGATGG - Intronic
1061060017 9:128245454-128245476 AGGGAGGAGGTACCCCAGGATGG - Intronic
1061472884 9:130841463-130841485 GGGCTGCATATGGCCCAGGACGG - Intronic
1062034588 9:134377284-134377306 GGACAGCATGTGGCCCAGGGAGG - Intronic
1062389671 9:136328898-136328920 GGGCCGCATGTGCTCCAGGGCGG + Intronic
1186344188 X:8674668-8674690 GGGCCGCATGAGGCCCAGGACGG - Intronic
1186939829 X:14494151-14494173 GGGCAGCATTTACCCTTGGCAGG + Intergenic
1187143196 X:16614178-16614200 GGGCTGCATGCAGCCCAGGGTGG - Intronic
1187345736 X:18461996-18462018 GGGCTGCATGTGGCCCAGGATGG + Intronic
1187993043 X:24896361-24896383 GGGCTGCATGTGGCCCAGGACGG + Intronic
1188359827 X:29239638-29239660 GGGCTGCATGCAGCCCAGGATGG + Intronic
1188918963 X:35948172-35948194 GGGCCACATGCAGCCCAGGACGG - Intronic
1189427485 X:40914116-40914138 GGGCTGCATGCAACCCAGGACGG + Intergenic
1189775757 X:44469170-44469192 GGGCCGCATGCACCCCAGGATGG + Intergenic
1190069404 X:47267014-47267036 GGGCCACATGTGGCCCAGGACGG + Intergenic
1190149603 X:47933181-47933203 GGGCCACATGCAGCCCAGGATGG - Intronic
1190251651 X:48731437-48731459 GGGCCACATGCAGCCCAGGACGG + Intergenic
1190477316 X:50840880-50840902 GGGCTGCATGTGACCCAGGATGG + Intergenic
1190635107 X:52425615-52425637 GGACACAATGTTCCCCAGGAGGG + Intergenic
1190699896 X:52979807-52979829 GGACACAATGTTCCCCAGGAGGG - Intronic
1192180194 X:68911426-68911448 GGACAGAATGTACCCCCAGAAGG - Intergenic
1192181260 X:68917144-68917166 GGGCAGCGGGAATCCCAGGAGGG + Intergenic
1193121211 X:77824502-77824524 GGGCCGCATGCAACCCAGGATGG - Intergenic
1193418376 X:81252692-81252714 GGGCCACATGTGGCCCAGGACGG - Intronic
1194136302 X:90147884-90147906 GGGCCGCATGCAGACCAGGACGG - Intergenic
1194649647 X:96499756-96499778 GGGCCGCATGCATCTCAGGATGG - Intergenic
1195068346 X:101257113-101257135 TGGCAGCAGGTACCTAAGGAGGG + Intronic
1195675152 X:107502331-107502353 TAGCAGCAAGTACCCCAGGTGGG + Intergenic
1195777937 X:108428243-108428265 GGGCCGCATATGGCCCAGGACGG - Intronic
1195870440 X:109479934-109479956 AGCAAGCATGTACCTCAGGAGGG + Intronic
1196158229 X:112454301-112454323 GGGCCACATGCAGCCCAGGATGG - Intergenic
1196895033 X:120327537-120327559 GGGCTGCATGCAGCCAAGGAAGG + Intergenic
1198230801 X:134687308-134687330 GGGCCACATGTGGCCCAGGATGG + Intronic
1198256424 X:134927666-134927688 GGGCTGCATGCAGCCCAGGATGG + Intergenic
1199034311 X:143032775-143032797 GGGAAGCAAGTACCTCAGAAGGG + Intronic
1200090732 X:153634697-153634719 GGGCAGCGTGTACAGCAGGAGGG + Intergenic
1200124645 X:153807522-153807544 TGGCTGCATGTTGCCCAGGAAGG - Intronic
1201293247 Y:12442152-12442174 GGGCAGGCTGTTCCCCATGAAGG + Intergenic