ID: 955706547

View in Genome Browser
Species Human (GRCh38)
Location 3:61733338-61733360
Sequence CTCTATCTGTTTAGAGTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 137}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955706541_955706547 22 Left 955706541 3:61733293-61733315 CCTCACACTTAATTAGGGGGTCC 0: 1
1: 0
2: 0
3: 2
4: 34
Right 955706547 3:61733338-61733360 CTCTATCTGTTTAGAGTGTCTGG 0: 1
1: 0
2: 0
3: 11
4: 137
955706539_955706547 24 Left 955706539 3:61733291-61733313 CCCCTCACACTTAATTAGGGGGT 0: 1
1: 0
2: 0
3: 3
4: 60
Right 955706547 3:61733338-61733360 CTCTATCTGTTTAGAGTGTCTGG 0: 1
1: 0
2: 0
3: 11
4: 137
955706544_955706547 0 Left 955706544 3:61733315-61733337 CCAGTGGAGCTTCCTTTCCGTTT 0: 1
1: 0
2: 1
3: 7
4: 151
Right 955706547 3:61733338-61733360 CTCTATCTGTTTAGAGTGTCTGG 0: 1
1: 0
2: 0
3: 11
4: 137
955706543_955706547 1 Left 955706543 3:61733314-61733336 CCCAGTGGAGCTTCCTTTCCGTT 0: 1
1: 0
2: 0
3: 5
4: 131
Right 955706547 3:61733338-61733360 CTCTATCTGTTTAGAGTGTCTGG 0: 1
1: 0
2: 0
3: 11
4: 137
955706540_955706547 23 Left 955706540 3:61733292-61733314 CCCTCACACTTAATTAGGGGGTC 0: 1
1: 0
2: 1
3: 1
4: 44
Right 955706547 3:61733338-61733360 CTCTATCTGTTTAGAGTGTCTGG 0: 1
1: 0
2: 0
3: 11
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955706547 Original CRISPR CTCTATCTGTTTAGAGTGTC TGG Intronic
903327095 1:22575547-22575569 TTCACTCTGTTGAGAGTGTCTGG + Intronic
910514305 1:88041088-88041110 CTCTATGTGTTTTGATTCTCTGG - Intergenic
911882479 1:103258544-103258566 CCCTATTCGTTTAGAATGTCTGG + Intergenic
912531440 1:110326398-110326420 CTCTTGCTGTTTCTAGTGTCTGG - Intergenic
913079629 1:115370487-115370509 ATTTATGGGTTTAGAGTGTCAGG + Intergenic
915303571 1:154965397-154965419 CTCTTGCTCTTTAAAGTGTCTGG - Intronic
917206517 1:172578787-172578809 CTCTAACTCTTTAGAGTCACAGG - Intronic
917623689 1:176824270-176824292 CTGTATCTATTTTGAATGTCTGG + Intronic
920692775 1:208159503-208159525 CTCTTTCTGTCTTGAGAGTCTGG + Intronic
920714824 1:208330000-208330022 CTCCAACTGATAAGAGTGTCAGG - Intergenic
921534764 1:216332885-216332907 CACTATGTGTTTAAAATGTCTGG + Intronic
922829180 1:228542568-228542590 GTCTCTCTGTTTAGAATGACTGG + Intergenic
923676398 1:236084252-236084274 CTTTATCTGTTTGCATTGTCTGG - Intergenic
923879881 1:238091960-238091982 CTCTATTTGTTAAGACTGTGGGG + Intergenic
924482204 1:244446399-244446421 CTCTTGCTGTCTAGTGTGTCTGG - Intronic
1064064626 10:12170762-12170784 CTTTGTCTGTTTAGAGTTTGTGG - Exonic
1064436582 10:15316267-15316289 TATTTTCTGTTTAGAGTGTCAGG + Intronic
1064851250 10:19711214-19711236 CACTATCTGTTTATTGTGTTGGG + Intronic
1065875918 10:29996825-29996847 CTCTATCTGGGGAGAGTGTCTGG + Intergenic
1066380193 10:34894707-34894729 CTGTATCTGTTTATATTCTCTGG - Intergenic
1073115012 10:101087077-101087099 CTCTATCTACTTAGAGAGTATGG + Intergenic
1079155845 11:17947371-17947393 CTGTTTCTGTTTACAGTGGCGGG - Intronic
1079179615 11:18178375-18178397 CACTATCTGTTTGGATTGCCTGG - Intronic
1080382238 11:31784969-31784991 TTCTATTTTTTTAGAATGTCGGG + Exonic
1081142891 11:39524814-39524836 TTCTTTCTCTTTAGAGTGTATGG + Intergenic
1091550997 12:1534812-1534834 CTCGAGCTGTTCAGAGTGACAGG - Intronic
1092458094 12:8662588-8662610 CTCTGTCTCTTTAGGGTTTCAGG + Intronic
1095497874 12:42804415-42804437 CTCAATCTGTTTAAAGCGTATGG - Intergenic
1096366117 12:51029747-51029769 CTGTAACTGTTATGAGTGTCAGG + Intergenic
1102058385 12:109913911-109913933 GCCTAACTGTTGAGAGTGTCAGG + Intronic
1102858775 12:116317664-116317686 CTCTAAATGATTAGATTGTCAGG - Intergenic
1105707900 13:22979929-22979951 ATCTATCTGTTTAGAGAGTGAGG - Intergenic
1107762057 13:43690146-43690168 CTCTCTCTCTTTAGAATGTAAGG + Intronic
1109230857 13:59755988-59756010 CTTTATCTGTTTTGAGTATTTGG - Intronic
1111490498 13:88967565-88967587 TTCAATCTGTCTAGATTGTCTGG + Intergenic
1111636940 13:90917486-90917508 CTCTATGTGCTAAGAGTGTAAGG - Intergenic
1114887700 14:26874495-26874517 CCATATATGTTAAGAGTGTCTGG - Intergenic
1118073598 14:62273108-62273130 CTCCATCTGTTTAGTGGTTCAGG + Intergenic
1118671191 14:68129312-68129334 CTCTATGAGTTTAGAGTTTGGGG + Intronic
1124470333 15:29978602-29978624 CTCTGTCTGGTTTGAGTGTGTGG - Intergenic
1129051607 15:72785876-72785898 ATCTATCTGTTCAGAGAGTCTGG + Intergenic
1131828608 15:96340404-96340426 TTGTATATGTTTAGAGTGGCCGG + Intergenic
1132088061 15:98923928-98923950 CTCCATCTTTTTAAAGTGGCCGG + Exonic
1132101335 15:99025477-99025499 CTCTCCCTGTTTAGAATGTGTGG - Intergenic
1132120286 15:99169842-99169864 CTCTGTCTGGTTAGAGTTTAGGG - Intronic
1132343890 15:101095667-101095689 CTCTATCTATTGAGAGGTTCGGG - Intergenic
1140868848 16:79088375-79088397 CTTTATCTGATCAGAGTCTCAGG - Intronic
1146609459 17:34291383-34291405 CTCTATCTCTTTAGACTTGCAGG - Intergenic
1147053372 17:37814974-37814996 CTCTCTCTGTTGAGAGGGTGAGG - Intergenic
1150475700 17:65472728-65472750 CTCTAGCTGAGTGGAGTGTCGGG + Intergenic
1154470479 18:14695243-14695265 CTCTATCTGATGAGAGTTTCAGG + Intergenic
1157311441 18:46556390-46556412 GTCCATCTGTTTAGAGAGACAGG - Intronic
1158339612 18:56451042-56451064 CTCCATCTTTTTAGACAGTCAGG - Intergenic
1159000898 18:62974298-62974320 CCCTATCTGTTAAGAGGGTACGG + Intronic
1159382997 18:67686966-67686988 CTCTAGCTATTTTGAATGTCTGG + Intergenic
1159712060 18:71773247-71773269 CTCTATCAGTTTACATTGCCAGG - Intronic
1161251116 19:3280907-3280929 CTCCATCTGTTTTGAGTGTGTGG + Intronic
1163360287 19:16841715-16841737 CACAATCTGTTTCCAGTGTCGGG + Intronic
1166248324 19:41546732-41546754 CTGTGTCTGTTTAGGGTGTTAGG - Intergenic
1202646844 1_KI270706v1_random:149874-149896 CTCTATCTGATGAGAGTTTGGGG - Intergenic
925485400 2:4323271-4323293 CTCAATATGCTTAGAGTGTGAGG + Intergenic
926719349 2:15947861-15947883 CTATTTCTCTTTTGAGTGTCAGG + Intergenic
927603021 2:24461077-24461099 TTCTCTCAGTTTGGAGTGTCAGG - Intergenic
929620485 2:43349307-43349329 CTCTCTGTGTTTAGAGTGGAGGG - Intronic
930694629 2:54398805-54398827 TTCTATTTGTTTAGATTGTAAGG + Intergenic
932964675 2:76457888-76457910 CTCTTTGTGTTCAGACTGTCAGG + Intergenic
934509781 2:94928342-94928364 CTCTATCTGATGAGAGTTTTGGG - Intergenic
934510008 2:94930320-94930342 CTCTATCTGATGAGAGTTTTGGG - Intergenic
935811410 2:106801061-106801083 CGCTTTCTGTTTAGAATGTGAGG - Intergenic
944338075 2:198561513-198561535 CTATTTCTGTCAAGAGTGTCTGG - Intronic
944655984 2:201877170-201877192 CTGTGTTTGTGTAGAGTGTCTGG - Intronic
944745800 2:202654341-202654363 CTCTATCTGTTTGGAGGCTCTGG + Intronic
946513095 2:220381626-220381648 CTTTATCTGTTTTCAGTATCAGG + Intergenic
948452789 2:238087672-238087694 CTTTATCTGGTTTTAGTGTCAGG - Intronic
1176804006 21:13462624-13462646 CTCTATCTGATGAGAGTTTCAGG - Intergenic
1180355069 22:11832592-11832614 CTCTATCTGATGAGAGTTTGGGG + Intergenic
1180383181 22:12159739-12159761 CTCTATCTGATGAGAGTTTGGGG - Intergenic
1181433213 22:22895291-22895313 CTCTCTCTGTCTAAAGTCTCTGG - Intronic
1181541067 22:23573646-23573668 CTCTCTCTGTCTAAAGTCTCTGG + Intronic
1181550968 22:23639003-23639025 CTCTCTCTGTCTAAAGTCTCTGG + Intergenic
1181797314 22:25319684-25319706 CTCTCTCTGTCTAAAGTCTCTGG - Intergenic
1182793183 22:32970334-32970356 CTCTATGTCTTTAGACTGTCTGG - Intronic
1183442752 22:37832540-37832562 CTCTTTCTGATACGAGTGTCTGG + Intronic
1183657307 22:39194933-39194955 TTCTATCTGTTTCCATTGTCTGG - Intergenic
950994029 3:17475139-17475161 CTCTACATGTTAAGAGTATCCGG + Intronic
954115565 3:48465268-48465290 ATCTATCTGTTGAGTGTGCCTGG + Intronic
955706547 3:61733338-61733360 CTCTATCTGTTTAGAGTGTCTGG + Intronic
957577014 3:82021199-82021221 CTTTATCTGTTTGGAATGTTAGG - Intergenic
959754112 3:109875967-109875989 ATTTATCTGTTCAGAGTTTCAGG - Intergenic
960527251 3:118723946-118723968 CTCTTTCTGTTCAGAGAGTGAGG - Intergenic
962261736 3:133914271-133914293 ATATATCTATTTAGAGTTTCTGG + Intergenic
963843997 3:150136458-150136480 CACTATCTGTACAGATTGTCTGG + Intergenic
963886892 3:150593102-150593124 CTGTATTTTTTTAGAGTCTCAGG + Intronic
964589065 3:158340645-158340667 CTCTTTCTGTTCCCAGTGTCGGG + Intronic
966566711 3:181390700-181390722 CTCTATGTGTTCAGATTGTTCGG + Intergenic
972310148 4:37873919-37873941 CTCTCTCTGTTGAGTGTGTGTGG + Intergenic
973373097 4:49268038-49268060 CTCTATCTGATGAGAGTTTGGGG - Intergenic
973387905 4:49527061-49527083 CTCTATCTGATGAGAGTTTGGGG + Intergenic
975201402 4:71594119-71594141 CTCTTTCTATTTATACTGTCTGG + Intergenic
976282682 4:83340818-83340840 ATCTATCTGGTTAGAGTGTGTGG - Intergenic
988163915 5:27558507-27558529 CTTTATCTGGTTTGGGTGTCAGG - Intergenic
994106964 5:95960061-95960083 CTCTATGTATTTAAAGTGCCTGG + Intronic
996683442 5:126253907-126253929 CTCTATCTGTCTAGTTTTTCAGG - Intergenic
998187695 5:139995339-139995361 GTCTATCTAATTAGAGTGCCAGG - Intronic
999927807 5:156398155-156398177 CTCTATCACTTCAGACTGTCAGG - Intronic
1000182520 5:158825429-158825451 CCATATCTGTTTTCAGTGTCAGG + Intronic
1000945241 5:167414600-167414622 CTCTATCTGATTGTTGTGTCTGG + Intronic
1008578818 6:52886661-52886683 CTCTATCTGTTTAAAGAATTTGG - Intronic
1011276011 6:85632252-85632274 CTGTTTCTCTTTTGAGTGTCTGG - Intronic
1016258621 6:142140589-142140611 CTCTATGTTTTTGGAGTGCCAGG - Intergenic
1022999389 7:35792263-35792285 GTTTATCTGTTTATAGTGTTTGG + Intergenic
1023790411 7:43749505-43749527 CTCTCTCTGTTGAGAGCTTCAGG - Intergenic
1024842443 7:53603028-53603050 CTCTATCAGTTTAGAGGCCCTGG - Intergenic
1024869765 7:53950327-53950349 CTATATCTGTTTAGAGAGGATGG - Intergenic
1026945746 7:74314876-74314898 TGCTATCTGTTTAGGGGGTCAGG - Intronic
1029299747 7:99571024-99571046 CTGTCTCTGTGTAGAGTGTGAGG + Intronic
1031047130 7:116903850-116903872 CTCTAACAGTTTACAATGTCTGG - Intronic
1032946825 7:136863576-136863598 CTCTATTTCTTGAGAGTGACTGG - Intergenic
1033005717 7:137559467-137559489 CTCTAGCAGTTTAGAGTGGCTGG - Intronic
1034360083 7:150487822-150487844 CTCTTACTGTGTAGAGTGTCAGG - Intergenic
1044709450 8:95041911-95041933 CTCTACATGTGTAGAGTATCTGG + Intronic
1050862829 9:10457847-10457869 CTCTATTTGTTTAGTTAGTCTGG - Intronic
1051890184 9:21933382-21933404 CTCCATTGGTTAAGAGTGTCTGG - Intronic
1053116752 9:35511043-35511065 CTCAAGCTGTTTGGAGTTTCAGG - Intronic
1053655622 9:40215904-40215926 CTCTATCTGATGAGAGTTTTGGG + Intergenic
1053905763 9:42843189-42843211 CTCTATCTGATGAGAGTTTTGGG + Intergenic
1053905985 9:42845125-42845147 CTCTATCTGATGAGAGTTTTGGG + Intergenic
1054351790 9:64023996-64024018 CTCTATCTGATGAGAGTTTTGGG + Intergenic
1054352018 9:64025938-64025960 CTCTATCTGATGAGAGTTTTGGG + Intergenic
1054367740 9:64362134-64362156 CTCTATCTGATGAGAGTTTTGGG + Intergenic
1054528984 9:66160383-66160405 CTCTATCTGATGAGAGTTTTGGG - Intergenic
1054529216 9:66162351-66162373 CTCTATCTGATGAGAGTTTTGGG - Intergenic
1054675126 9:67849917-67849939 CTCTATCTGATGAGAGTTTTGGG + Intergenic
1054675357 9:67851874-67851896 CTCTATCTGATGAGAGTTTTGGG + Intergenic
1055600242 9:77909041-77909063 CACTTTCTGTTTATAGAGTCTGG + Intronic
1055856413 9:80693033-80693055 CTCAATCTTGTTAGAGTATCAGG + Intergenic
1056139089 9:83657080-83657102 CTATAGCGGTTTAGAGTGTTGGG - Intergenic
1062009025 9:134257204-134257226 CTCTCTCTGCTGGGAGTGTCTGG + Intergenic
1203696809 Un_GL000214v1:106043-106065 CTCTATCTGATGAGAGTTTGGGG - Intergenic
1203552404 Un_KI270743v1:174986-175008 CTCTATCTGATGAGAGTTTGGGG + Intergenic
1185536211 X:863415-863437 CTCTCTCTGTGCAGAGTGACAGG - Intergenic
1186006826 X:5081263-5081285 CTCTGTCTGTTTTTAGGGTCAGG - Intergenic
1189454733 X:41175699-41175721 CTCTAACTGCTTAGAGAGCCAGG - Intronic
1189578784 X:42383785-42383807 TTCTTTCTGTTTATAGTGACGGG + Intergenic
1191586492 X:62833054-62833076 CTCTATCTGTTGAGGGCCTCAGG + Intergenic
1196086490 X:111688848-111688870 TTCTTTCTGATTAGAGTGTGTGG + Intronic
1198219044 X:134583194-134583216 CTCTCTCTTTTTAAAATGTCTGG + Intronic
1198442995 X:136682888-136682910 CTTTATCTGTTGAGAATTTCTGG + Intronic
1201153682 Y:11110549-11110571 CTCTATCTGATGAGAGTTTTGGG + Intergenic