ID: 955707051

View in Genome Browser
Species Human (GRCh38)
Location 3:61738220-61738242
Sequence TACCCAACCACATTTAAATA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 160}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955707042_955707051 14 Left 955707042 3:61738183-61738205 CCACCGCGCCCGGCCTATGCTGA 0: 2
1: 25
2: 249
3: 1497
4: 7222
Right 955707051 3:61738220-61738242 TACCCAACCACATTTAAATAGGG 0: 1
1: 0
2: 1
3: 11
4: 160
955707045_955707051 6 Left 955707045 3:61738191-61738213 CCCGGCCTATGCTGAGGTTTTAA 0: 1
1: 1
2: 12
3: 71
4: 564
Right 955707051 3:61738220-61738242 TACCCAACCACATTTAAATAGGG 0: 1
1: 0
2: 1
3: 11
4: 160
955707044_955707051 11 Left 955707044 3:61738186-61738208 CCGCGCCCGGCCTATGCTGAGGT 0: 1
1: 1
2: 14
3: 106
4: 725
Right 955707051 3:61738220-61738242 TACCCAACCACATTTAAATAGGG 0: 1
1: 0
2: 1
3: 11
4: 160
955707046_955707051 5 Left 955707046 3:61738192-61738214 CCGGCCTATGCTGAGGTTTTAAA 0: 1
1: 0
2: 4
3: 49
4: 380
Right 955707051 3:61738220-61738242 TACCCAACCACATTTAAATAGGG 0: 1
1: 0
2: 1
3: 11
4: 160
955707047_955707051 1 Left 955707047 3:61738196-61738218 CCTATGCTGAGGTTTTAAAATGG 0: 1
1: 0
2: 0
3: 23
4: 234
Right 955707051 3:61738220-61738242 TACCCAACCACATTTAAATAGGG 0: 1
1: 0
2: 1
3: 11
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955707051 Original CRISPR TACCCAACCACATTTAAATA GGG Intronic
901211633 1:7529762-7529784 AACCCAACCACATCTTTATAAGG - Intronic
901361448 1:8704177-8704199 TACCCACCCACAATTAATTCTGG + Intronic
906859171 1:49340700-49340722 TACCCAGCCCCGTTTCAATATGG - Intronic
917591702 1:176482906-176482928 TACCCAACTACATGTAATGAGGG + Intronic
919615583 1:199804641-199804663 TACACAAAGACATTTACATAAGG + Intergenic
920667677 1:207976360-207976382 CAACAAACTACATTTAAATATGG + Intergenic
921315886 1:213890109-213890131 TACTCATGCACATATAAATAGGG - Intergenic
923618927 1:235561316-235561338 CAACCAACCACATTAAAAAATGG - Intronic
1063581253 10:7309679-7309701 TACCCTACTACATTTTTATAAGG + Intronic
1064229655 10:13519012-13519034 TAAACAACCACATTTCAATGTGG + Intronic
1064256275 10:13745256-13745278 TAGCCAACCACAGTGAAATGAGG + Intronic
1068568470 10:58602437-58602459 CAGCAAACCACCTTTAAATATGG - Intronic
1071844770 10:89510492-89510514 TTCCCAGCACCATTTAAATAGGG - Intronic
1073197099 10:101700831-101700853 TACCCAGCCTTATTTAAATAAGG - Intergenic
1073527444 10:104197836-104197858 TACCCAATAACATATAAATGGGG + Intronic
1073595777 10:104798679-104798701 TACCCAAACACATTGAAAATGGG + Intronic
1073660318 10:105468712-105468734 TTCCCAACAAAATTAAAATAGGG + Intergenic
1076224140 10:128759747-128759769 TTCCCAGCCACATTTAATTGAGG - Intergenic
1080374140 11:31687545-31687567 TAACCAACTACATGTAATTAAGG - Intronic
1084880913 11:72171212-72171234 TACCAATACATATTTAAATAAGG + Intergenic
1086900076 11:92357401-92357423 TACCCAACTACACTGAAATTTGG + Intronic
1087802134 11:102516019-102516041 TTCCCAATCTCATTTAAATAAGG + Intergenic
1088011511 11:105007107-105007129 TACCCAAACACTTCTCAATATGG - Exonic
1088348598 11:108859070-108859092 AATCTAACCACATTTGAATAAGG - Intronic
1088362437 11:109005152-109005174 TACTCACCAACACTTAAATATGG - Intergenic
1095172453 12:39051880-39051902 TGCCCAAAGACATTTGAATAAGG + Intergenic
1098921265 12:76304316-76304338 TACCCAGCCACTTTTCAAGATGG + Intergenic
1099636576 12:85221527-85221549 TACCTAACCTAATTTAAATAAGG + Intronic
1100242406 12:92722674-92722696 TAACCAACCACTTTTAACTGGGG + Intronic
1100387418 12:94116630-94116652 TACCCAACACCATTTATTTAAGG + Intergenic
1100865003 12:98847901-98847923 TATCCAAACAAATTTAAATTAGG - Intronic
1105204671 13:18210786-18210808 AACACAACCCCATTTAAAAAGGG + Intergenic
1107697290 13:43012454-43012476 TACTTAACCACATTAAAAAATGG - Intergenic
1110308227 13:74015697-74015719 TACCCAACCTAATTTTAATCTGG + Intronic
1110720683 13:78758115-78758137 TGCACAACCATATATAAATATGG - Intergenic
1110952608 13:81515523-81515545 TTCCCAAGCATATTTGAATATGG - Intergenic
1111452829 13:88441331-88441353 TAACCAACCACTTATAAATAAGG + Intergenic
1111491431 13:88981043-88981065 TTCCTAACCACATTCAAATAAGG + Intergenic
1112690389 13:101886855-101886877 TAACAAACCCCATTTAAAAATGG + Intronic
1113377457 13:109778714-109778736 TATTCAACAAAATTTAAATATGG + Intronic
1120912356 14:89678805-89678827 TCCCAAACCTCATTTAAAAAGGG - Intergenic
1125120388 15:36151375-36151397 TAAACAACCAGATTTAAAAATGG + Intergenic
1126587836 15:50307294-50307316 TACTCAACTACATTAAAATTGGG - Intronic
1127337598 15:58004807-58004829 TACCTAACAATATTTAATTAAGG + Intronic
1128714166 15:69894915-69894937 TACCCCACCACACTGAATTACGG + Intergenic
1130988360 15:88859433-88859455 TACCTAAGCACATTTAAAGGGGG - Intronic
1131719429 15:95151276-95151298 GACCCAACCATATAAAAATATGG - Intergenic
1132260134 15:100416885-100416907 CAACCAACCACATTAAAAAACGG + Intronic
1132845132 16:1997433-1997455 AACACAGCCACATTCAAATAAGG - Intergenic
1133579352 16:7128301-7128323 TACTTAACCCCATTTTAATATGG + Intronic
1135234742 16:20744680-20744702 AGCCAAACCACGTTTAAATAAGG + Intronic
1135801695 16:25503226-25503248 GACCCCACCACATTTTAAAAGGG + Intergenic
1137298705 16:47124619-47124641 TCCTCATCCACATTTTAATAAGG + Intronic
1139803479 16:69543674-69543696 TGACCAACCAGATATAAATAGGG - Intergenic
1143737550 17:8923692-8923714 AATCCTACCACCTTTAAATATGG + Intronic
1150125912 17:62634776-62634798 TACCCAGCCCCTTTTAAAGATGG + Intronic
1153397941 18:4646191-4646213 TACCCTACCTCCTTTAAAAAGGG - Intergenic
1153931680 18:9884853-9884875 TACCAAAACACATTTTACTAAGG - Intergenic
1155142867 18:23058742-23058764 TACCCCTCCACAATTAAATGAGG + Intergenic
1156010537 18:32492572-32492594 TCCCCATCCCCATTTAAAAATGG + Intergenic
1156725400 18:40120429-40120451 TCCCCAACCAGTTATAAATATGG - Intergenic
1159226423 18:65543694-65543716 GACACATCAACATTTAAATAAGG + Intergenic
1161857460 19:6773771-6773793 CACCCAACCACATTCAAATAGGG - Intronic
1161867262 19:6842296-6842318 TACCAACCCTCATCTAAATATGG - Intronic
1166402932 19:42496909-42496931 TACCCAGCCCCAGTTCAATATGG + Intergenic
1167727663 19:51227550-51227572 AACCCAATCTCATTTAAAAATGG - Intronic
929341200 2:40820248-40820270 TTAGAAACCACATTTAAATATGG + Intergenic
932439927 2:71728027-71728049 TCCCCAACCTTATTTAACTATGG - Intergenic
932525992 2:72469031-72469053 TACCACACCAATTTTAAATAGGG - Intronic
934622137 2:95818750-95818772 TTCCCAGCACCATTTAAATAGGG + Intergenic
934811314 2:97280030-97280052 TTCCCAGCACCATTTAAATAGGG - Intergenic
934826376 2:97427910-97427932 TTCCCAGCACCATTTAAATAGGG + Intergenic
937463261 2:122107921-122107943 TACAAAACCAGATTTAAAAAAGG + Intergenic
940168352 2:150800039-150800061 TGCCCACCCACATTTAAAGTGGG - Intergenic
940734956 2:157440216-157440238 CTCCCACCCACTTTTAAATAAGG + Intronic
941419557 2:165265741-165265763 AAACAAACAACATTTAAATAAGG + Intronic
943158518 2:184216073-184216095 AACCCAACCCCATTAAAATGTGG - Intergenic
944241110 2:197485898-197485920 TACCCAAAGAAATTTAAAAAAGG - Intergenic
944754011 2:202740903-202740925 TACTCAAGAACATTAAAATAAGG + Intronic
945511639 2:210710183-210710205 TAGCCAACCACATCTAATTCAGG - Intergenic
946423368 2:219577745-219577767 TACCCAACAAAATTTAAACTTGG + Intergenic
947674446 2:231964545-231964567 TATCCAACCATGTTCAAATAAGG - Intronic
1172940701 20:38652295-38652317 TACCAAAACACTTTTAAATATGG - Intergenic
1176713312 21:10327314-10327336 AACACAACCCCATTTAAAAAGGG - Intergenic
1180829688 22:18897882-18897904 AACACAACCCCATTTAAAAAGGG - Intergenic
1182201004 22:28569864-28569886 CAACCAACCTCATTTAAAAATGG + Intronic
1183570356 22:38648662-38648684 TACACAACCTGATTTAAAAATGG + Intronic
1184080481 22:42215963-42215985 AACTCAACCAGATTAAAATATGG + Intronic
1203279779 22_KI270734v1_random:123155-123177 AACACAACCCCATTTAAAAAGGG - Intergenic
949620248 3:5802809-5802831 TTCCCAGCACCATTTAAATAGGG + Intergenic
951034938 3:17922417-17922439 TAACAAACAACATTTAAAAAAGG + Intronic
951871120 3:27363468-27363490 TTCCCAATCACATTTAACTTGGG - Intronic
953565137 3:44026068-44026090 TACCCATCCACATTTTACTTAGG - Intergenic
955707051 3:61738220-61738242 TACCCAACCACATTTAAATAGGG + Intronic
955779918 3:62473301-62473323 CACCAACCCACATTTAAAAATGG + Intronic
955967112 3:64399788-64399810 TTTCCAACCACTTTTAAATATGG - Intronic
956365147 3:68493474-68493496 TATCCAAACAAATTTAAATCAGG - Intronic
957329226 3:78738537-78738559 TAACAAATCACATTTATATAAGG - Intronic
957812148 3:85237021-85237043 TATTAAACCATATTTAAATAAGG + Intronic
958665488 3:97131616-97131638 TAGCCATCCACTTGTAAATAAGG - Intronic
959855276 3:111147162-111147184 GAACCAATCACATTTAAAGAAGG - Intronic
962863831 3:139429899-139429921 GACCCTGCCACTTTTAAATAAGG + Intergenic
965164347 3:165176181-165176203 TACCTAATTACATATAAATATGG - Intergenic
965180503 3:165396469-165396491 TACCCCAGCACCATTAAATAGGG - Intergenic
966633217 3:182102307-182102329 GACCCAACAATATTTAAACAAGG - Intergenic
967853257 3:194097874-194097896 TACACAGACACAGTTAAATAGGG + Intergenic
972509900 4:39759070-39759092 TAAACATCCACATTTAAATATGG - Intronic
973129004 4:46625994-46626016 TATCCAAAAAAATTTAAATAAGG + Intergenic
973171381 4:47148263-47148285 TGCCCACCCACCTTTAAATCGGG - Intronic
973733315 4:53844850-53844872 TACCCACCCACATTTAAGTGAGG + Intronic
974270341 4:59642746-59642768 TACCTAAACATATTTAAATGTGG + Intergenic
974623803 4:64396483-64396505 CAAACAACCACATTTAAAAATGG - Intronic
975500532 4:75079881-75079903 TAGCCAACCACAGCTCAATAAGG - Intergenic
976971700 4:91111068-91111090 AATTCAACCACATTTAAAAATGG - Intronic
980824817 4:138060436-138060458 CAACCAACCACATTAAAAAATGG - Intergenic
982678226 4:158400287-158400309 TGTCCAACCACATTTCCATATGG + Intronic
983003136 4:162445602-162445624 CATCAAACCACATTTTAATAAGG + Intergenic
983034256 4:162843334-162843356 TCCCAAACCATATTTACATAGGG + Intergenic
984669924 4:182471206-182471228 TATCTAAACACATTTAAAAATGG + Intronic
987419458 5:17701644-17701666 CAAACAACCACATTTAAAAATGG - Intergenic
987820891 5:22965031-22965053 CACCCAACCCCATTAAAAAATGG - Intergenic
993638649 5:90375840-90375862 AACCCAACTACATTTACACAAGG + Intergenic
995777199 5:115736592-115736614 TACCCACACATATTTAAATATGG + Intergenic
996809321 5:127497232-127497254 TACACAACCAAATTTTAAAATGG + Intergenic
997180462 5:131823694-131823716 GACCCCACCAGATCTAAATAAGG - Intronic
1004341981 6:14816037-14816059 TAGCCAAGGACATTTAAAAAAGG + Intergenic
1007304292 6:40892187-40892209 TCCCCAACCCCCTTTAATTAGGG + Intergenic
1008413516 6:51212419-51212441 AACACAAGCACGTTTAAATATGG - Intergenic
1009548351 6:65052187-65052209 TACCCAACCCCATTTAGTTCTGG + Intronic
1010388960 6:75314463-75314485 CACCCAGCTACATTTAAATCTGG - Exonic
1011525930 6:88264720-88264742 AAACCAACCAGACTTAAATAGGG - Intergenic
1012645434 6:101673170-101673192 TAATCAACCTCATTTAAAAATGG + Intronic
1012900858 6:105004403-105004425 CAGACAACCACATTTAAATTGGG + Intronic
1013939404 6:115644059-115644081 TGTCCAATCACATTTCAATATGG + Intergenic
1015141353 6:129936978-129937000 CAACCAACTACATTTAAAAATGG + Intergenic
1015411170 6:132895366-132895388 TACCCAATCACTTTTCAATTAGG + Intergenic
1016596599 6:145809625-145809647 TACCCATCCCCCTTTGAATAAGG + Intronic
1018648614 6:165972119-165972141 TCCCCAAGCACATTGGAATAAGG + Intronic
1019845595 7:3496915-3496937 TTCACAACCACAATTAAATCAGG - Intronic
1021135073 7:16955460-16955482 TAACCAACAAAATTTAAGTATGG - Intergenic
1021911852 7:25393261-25393283 TACCCAGTCACATTTAATGAAGG - Intergenic
1021952770 7:25791278-25791300 TTCGCCAGCACATTTAAATAGGG + Intergenic
1022579830 7:31540180-31540202 TACCCAACAACATCTACAGACGG - Intronic
1022780433 7:33576814-33576836 TTCCCAGCACCATTTAAATAGGG - Intronic
1024012954 7:45285964-45285986 TACCCAACAACATCAAAATTGGG - Intergenic
1024140626 7:46459848-46459870 TACCCAGCCCCTTTTCAATATGG + Intergenic
1027936355 7:84608642-84608664 TACCAATCCAGATTTAATTATGG - Intergenic
1028605655 7:92652660-92652682 AACCCAACCACATTCCTATAGGG + Intronic
1030959562 7:115899905-115899927 TAAACAACCCCATTTAAAAATGG + Intergenic
1036225305 8:6953005-6953027 TCCCCAAAGACCTTTAAATAGGG - Intergenic
1037828427 8:22173980-22174002 TCCCCAACCACCTTTAAAGGTGG + Intronic
1038260600 8:25990277-25990299 TAACAATCCACATATAAATAGGG - Intronic
1041373667 8:57191043-57191065 CAACCAGCAACATTTAAATAAGG + Intergenic
1041700819 8:60787234-60787256 TGCCCACCCACATTTCAATCAGG - Intronic
1043224293 8:77703090-77703112 GAACCAACCCCATTTAAAAATGG - Intergenic
1044478848 8:92661056-92661078 TACCCACCCATATTTAATTCAGG - Intergenic
1044768409 8:95602701-95602723 CAACCCACCACATTTAAAAAAGG + Intergenic
1046653001 8:116859706-116859728 GACACAACTACATTGAAATAAGG + Intronic
1047976848 8:130139091-130139113 TAGGAAACCACATTTAAAGAAGG + Intronic
1050976739 9:11948779-11948801 TACCCAACAACATTGTAATGGGG - Intergenic
1051719453 9:20020883-20020905 TATTCAACATCATTTAAATAAGG + Intergenic
1057092176 9:92268320-92268342 TAACCAATCACATAAAAATATGG + Intronic
1060565208 9:124584741-124584763 AACCCAACAACATTGAAATTAGG + Intronic
1202796669 9_KI270719v1_random:126554-126576 GACCAAAACACATTTAAATACGG + Intergenic
1186076687 X:5887308-5887330 CACCAAACCACAATTGAATAAGG + Intronic
1186208752 X:7228211-7228233 TACCCAACAGCATTGAAATCAGG - Intronic
1187987150 X:24826582-24826604 TACCCAACCACGTTGCAATGAGG - Exonic
1192272022 X:69589716-69589738 TTCCCAGCCAAATTTAATTATGG - Intergenic
1193160353 X:78221638-78221660 TACCCCACCACAATCAAGTAGGG - Intergenic
1193424296 X:81321966-81321988 TAGCAAACCCCATTTAAAAAGGG - Intergenic
1193854873 X:86587712-86587734 TAAACAACCACATTTATAAATGG - Intronic
1194976723 X:100403485-100403507 TAGCCAAACCCATTTAAATGAGG + Intronic
1201891565 Y:18948490-18948512 TGCCCAACCACCTTCAAATTGGG + Intergenic