ID: 955710336

View in Genome Browser
Species Human (GRCh38)
Location 3:61772178-61772200
Sequence CTGGGAAATTATACAGTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 182}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955710330_955710336 3 Left 955710330 3:61772152-61772174 CCAACCAGGGACAAACTCAGGAC 0: 1
1: 0
2: 2
3: 14
4: 201
Right 955710336 3:61772178-61772200 CTGGGAAATTATACAGTTGAGGG 0: 1
1: 0
2: 2
3: 17
4: 182
955710320_955710336 28 Left 955710320 3:61772127-61772149 CCTTCTTTGCCAATTCCCATCGG 0: 1
1: 0
2: 0
3: 8
4: 100
Right 955710336 3:61772178-61772200 CTGGGAAATTATACAGTTGAGGG 0: 1
1: 0
2: 2
3: 17
4: 182
955710331_955710336 -1 Left 955710331 3:61772156-61772178 CCAGGGACAAACTCAGGACTTCC 0: 1
1: 0
2: 0
3: 12
4: 149
Right 955710336 3:61772178-61772200 CTGGGAAATTATACAGTTGAGGG 0: 1
1: 0
2: 2
3: 17
4: 182
955710327_955710336 13 Left 955710327 3:61772142-61772164 CCCATCGGGGCCAACCAGGGACA 0: 1
1: 0
2: 0
3: 5
4: 53
Right 955710336 3:61772178-61772200 CTGGGAAATTATACAGTTGAGGG 0: 1
1: 0
2: 2
3: 17
4: 182
955710328_955710336 12 Left 955710328 3:61772143-61772165 CCATCGGGGCCAACCAGGGACAA 0: 1
1: 0
2: 0
3: 2
4: 76
Right 955710336 3:61772178-61772200 CTGGGAAATTATACAGTTGAGGG 0: 1
1: 0
2: 2
3: 17
4: 182
955710324_955710336 19 Left 955710324 3:61772136-61772158 CCAATTCCCATCGGGGCCAACCA 0: 1
1: 0
2: 0
3: 6
4: 60
Right 955710336 3:61772178-61772200 CTGGGAAATTATACAGTTGAGGG 0: 1
1: 0
2: 2
3: 17
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955710336 Original CRISPR CTGGGAAATTATACAGTTGA GGG Intronic
901900698 1:12359281-12359303 CTGGGAAATTATATACTGAAAGG - Intronic
902868277 1:19295609-19295631 GTGGGAATTTTTACAGTTCAAGG - Intergenic
903666360 1:25009927-25009949 CTGGGCAGTGATACAGCTGAAGG + Intergenic
905756094 1:40510238-40510260 CTGTGAAATTAGCCATTTGATGG + Intronic
908080054 1:60567360-60567382 CTTGAAGATTATACAGTTGATGG - Intergenic
908670218 1:66538374-66538396 ATGAGAAATTACACAGGTGATGG - Intronic
908822961 1:68106509-68106531 CTGGGAAAGTATACGGTTATTGG + Intronic
911187670 1:94919691-94919713 CTGGAAAATTATCCAGCAGAGGG + Intronic
916330065 1:163605590-163605612 TGGTGTAATTATACAGTTGATGG + Intergenic
919661682 1:200253846-200253868 CTTGGACATTACACGGTTGAGGG + Intergenic
921733743 1:218602907-218602929 CTGGAATATTATAAAATTGAAGG - Intergenic
923269854 1:232345945-232345967 CTGGGACATTTTATATTTGAAGG + Intergenic
924726809 1:246678824-246678846 CTTAGAAATTGTACAGATGAGGG - Intergenic
1065737120 10:28764319-28764341 CTGGGACATGATCCTGTTGAAGG + Intergenic
1065764631 10:29016396-29016418 CGGGGACATTATGCAGTTAAAGG - Intergenic
1066446182 10:35485900-35485922 CTGGGAAATACTACATTAGAGGG - Intronic
1069352046 10:67539286-67539308 ATGGGAAATTAAACAGGAGATGG - Intronic
1071308642 10:84322995-84323017 CTGGGAAATTGGGCAGTTAATGG - Intergenic
1072202572 10:93174294-93174316 CTGTGAAATTACAAAGTTCATGG - Intergenic
1072433446 10:95394197-95394219 CTGGGTAATTTTCCTGTTGACGG + Intronic
1072941133 10:99765123-99765145 GTGGGAAATTATACTGCTGAAGG + Intergenic
1075772086 10:124947651-124947673 CTGGGAAAAAATAGATTTGAAGG - Intronic
1079137162 11:17782043-17782065 CAGGGTAATCATACAGTTGCAGG - Exonic
1079388712 11:20002658-20002680 CTGGGAAATCCTATCGTTGAAGG + Intronic
1080294990 11:30716216-30716238 CTTGGAAATTATATAGATGTGGG + Intergenic
1082229089 11:49742339-49742361 ATGGGAAATTTTATAGTTCAGGG - Intergenic
1084871403 11:72100887-72100909 CTGGGAGTTTATAGAGGTGATGG - Intronic
1085232732 11:74987165-74987187 CTGGGTAACTAAATAGTTGATGG - Intergenic
1086620994 11:88886803-88886825 ATGGGAAATTTTATAGTTCAGGG + Intronic
1087072132 11:94091477-94091499 CTTGGAAATCATACAGTCTAGGG + Intronic
1088638478 11:111847886-111847908 GTGGAAAATTATACCTTTGAAGG - Intronic
1089804749 11:121074927-121074949 CTGCAAAATTTTACAATTGAGGG - Intronic
1090292082 11:125554456-125554478 GTGGGAAGTTTTACAGTTCAGGG - Intergenic
1094725774 12:33114227-33114249 CTGGGAAATCATCCATTTCAAGG - Intergenic
1095666492 12:44807296-44807318 ATAGGAATTTATACATTTGATGG + Intronic
1096656759 12:53097161-53097183 TTGGGAAATTCTACTGCTGATGG - Intergenic
1097162245 12:57055443-57055465 CTGGGAAATCATCCAGTCCAAGG + Intergenic
1101776668 12:107801017-107801039 CTGAGAAATTATACACATGTGGG + Intergenic
1104601841 12:130160416-130160438 TTGGGAAATAACACAGTTGAAGG + Intergenic
1105261103 13:18779927-18779949 CTGGGAAATGTTAAAGTTGGGGG - Intergenic
1105809136 13:23979419-23979441 CTGGGAAATTTTAAAGGAGATGG + Intergenic
1105953282 13:25253359-25253381 CTGGGAAATTAAACAGCATAAGG + Intronic
1106662549 13:31815136-31815158 GTGGGAAATTATTCAGTTAGAGG + Intergenic
1107679005 13:42828489-42828511 CGGGGAAATTGTACATTTAATGG + Intergenic
1110105591 13:71671636-71671658 GTGGGAAAATTTACAGCTGATGG + Intronic
1110272450 13:73605853-73605875 GTGGGAAATAATACATTTAAGGG - Intergenic
1112213376 13:97403797-97403819 TTGGGAATTAATACAGTTGATGG + Intergenic
1113346286 13:109481795-109481817 CTGGAAAATGATTCAGTTGATGG + Intergenic
1115798757 14:36968806-36968828 CTGGGAAAGAATACACTTTATGG - Intronic
1116104026 14:40476464-40476486 GTGGGAAGTTTTACAGTTCAGGG - Intergenic
1117539112 14:56729474-56729496 CTGGGAAATTCTAAGGTAGAAGG + Intronic
1123159679 14:106266270-106266292 CGGGGAAATTTTACAATTGCAGG - Intergenic
1124868655 15:33519067-33519089 CTGGGAAAAGATGCAGTTAATGG - Intronic
1124877357 15:33607688-33607710 ATGGGAAATTATAGCATTGAGGG - Intronic
1124933028 15:34142275-34142297 TTTGTAAATTATACAGTTCAGGG + Exonic
1127276798 15:57453314-57453336 CTGGGATAGTAGACAGTGGAAGG + Intronic
1128829634 15:70755840-70755862 CTGTGAAATTATACAGCTGAGGG - Intronic
1129514019 15:76145576-76145598 CTGGGAAATGATACAGTTCAAGG - Intronic
1132044817 15:98554730-98554752 CTGGGAAAATAAACAGATGCTGG + Intergenic
1132138186 15:99365200-99365222 CAGGGAAATTAAACAGTAAATGG - Intronic
1133421652 16:5651632-5651654 CTGGGAATTCACACAGCTGATGG - Intergenic
1133727160 16:8548273-8548295 CTGTGAAATGATTCATTTGAAGG + Intergenic
1134221737 16:12360362-12360384 CTGGGAAAACCTACAGTTCAAGG - Intronic
1134239981 16:12498579-12498601 GTGGGAAATTAAACAGTTAAGGG + Intronic
1140710354 16:77671799-77671821 CTGGGAATTTACACCGTGGAAGG + Intergenic
1143657003 17:8300874-8300896 CTGGGAATTTATACAGGTTTTGG - Intergenic
1144466565 17:15502175-15502197 CTGAGTGATTATACCGTTGAAGG - Intronic
1149293136 17:55236388-55236410 CTGGGAAGGTATACAGTAGAGGG + Intergenic
1151543662 17:74778609-74778631 CTGAGAAATTACACAGGTGATGG - Intronic
1153166599 18:2268710-2268732 CTGGGATATTATTCTGTTGCAGG - Intergenic
1155263854 18:24072661-24072683 ATGGGAAATTAAAGAGATGATGG - Intronic
1156411457 18:36832109-36832131 TTGGGAAATTCTAGATTTGAAGG + Intronic
1157784726 18:50471257-50471279 CTGAGACATCTTACAGTTGATGG - Intergenic
1159194416 18:65093994-65094016 CTGAGAAATTTTATAGATGACGG - Intergenic
1159981289 18:74783942-74783964 CTGGAAAATTATACTGCTGCTGG - Intronic
1160299196 18:77664624-77664646 ATAACAAATTATACAGTTGAGGG + Intergenic
925472332 2:4175773-4175795 GTGGGAAGTTTTACAGTTCAGGG - Intergenic
926663027 2:15489602-15489624 CTGCCAAATTATCCAGTTTAAGG + Intronic
927975561 2:27335837-27335859 CTGGGAATTCTTAGAGTTGAAGG - Intronic
928039492 2:27860810-27860832 CAGGGAAAGTCTACAGTTAAGGG - Intronic
928787929 2:34913227-34913249 TTGGGAAAATATTCAATTGAAGG - Intergenic
935016908 2:99191492-99191514 CTGGGAAATTAGATAGAGGATGG - Intronic
935456813 2:103279117-103279139 CTGAAAAAGAATACAGTTGAAGG + Intergenic
935863778 2:107363005-107363027 CTGGGAAATTACACGCTTGGAGG + Intergenic
936175095 2:110212674-110212696 CTGGGAAAGTCTTCAGTTGAAGG - Intergenic
939352833 2:141062478-141062500 TGGGGAAATTTTACAGTTGTTGG - Intronic
943920268 2:193698492-193698514 CTGTTAGATTATGCAGTTGATGG + Intergenic
945586410 2:211669465-211669487 CTGGGAAATCAGACAGTTTCAGG - Intronic
947227956 2:227858164-227858186 CTGTTAAATCATACAGTTGATGG - Intergenic
1171208648 20:23300484-23300506 GTGGGAAGTTTTACAGTTCAGGG - Intergenic
1177036708 21:16053456-16053478 CTTTGAAATTATACATTTGTTGG + Intergenic
949182008 3:1143822-1143844 CTATGAAATTATACACTGGATGG + Intronic
951143381 3:19195659-19195681 CTGGGTAATTATCAAGTAGATGG - Intronic
951540930 3:23781216-23781238 CTGGGAAATTTTACTTTTGTGGG - Intergenic
955557326 3:60151883-60151905 CAGGGAAATTATATAGTTGCAGG - Intronic
955710336 3:61772178-61772200 CTGGGAAATTATACAGTTGAGGG + Intronic
955730729 3:61982826-61982848 CTGGGAAATTAGACAGATAATGG + Intronic
956088840 3:65642179-65642201 CTGGGTAATTATCTCGTTGATGG + Intronic
957756125 3:84490660-84490682 CTTGGAAAATATACAGTTGGGGG - Intergenic
960143171 3:114171127-114171149 CATGGAAAATATACATTTGAGGG + Intronic
964918342 3:161863846-161863868 ATTGGATATTAAACAGTTGATGG + Intergenic
965586507 3:170323438-170323460 CTGGGAAATCAGACAGATCACGG + Intergenic
965950076 3:174298322-174298344 CTGGGAACTTATACTCTGGAAGG - Intergenic
966563944 3:181355236-181355258 CTGGGAAATGATGAAGTTCAAGG - Intergenic
967054346 3:185815816-185815838 CAGGAAAAGTTTACAGTTGAGGG + Intronic
967850343 3:194077707-194077729 CTGGGAAGTTGTTGAGTTGATGG + Intergenic
971699168 4:29946793-29946815 ATTGGAAATAATACAGTTAAAGG - Intergenic
972120393 4:35694623-35694645 CTGATAAATTATACAGTGGCAGG + Intergenic
973203602 4:47533846-47533868 CAGTGAAATTACACAGTGGAGGG - Intronic
975771514 4:77728531-77728553 CTTGGAAAAAATACAGTTGTAGG - Intronic
978286260 4:107081022-107081044 CTGAAAAATAATACAGATGATGG + Intronic
978996624 4:115163879-115163901 CTGGAAGATAATACATTTGATGG + Intergenic
979846543 4:125520358-125520380 CTGGAAAATTATTCATTTGCTGG - Intergenic
979949961 4:126880015-126880037 CTGATAAATTATAAAGTTAATGG + Intergenic
981409190 4:144408076-144408098 CTGGGATATTCTACAATAGAGGG + Intergenic
981691764 4:147516567-147516589 CTTGGAAATTATAAATATGAGGG + Intronic
981701113 4:147608493-147608515 CTGGGATAATATACACTGGATGG + Intergenic
982246203 4:153354257-153354279 TAGGGAAATTATACATTTCATGG - Intronic
984183567 4:176514804-176514826 CTGGGAGATAATACAGTCTATGG - Intergenic
986423533 5:7608255-7608277 CAGGGAAATAACACAGTTGGAGG + Intronic
988196546 5:28012615-28012637 GCGGGAAATTTTACAGTTCAGGG + Intergenic
991075692 5:62534313-62534335 CTGAAAAATTTTACAGTTAAAGG - Intronic
991343351 5:65636436-65636458 CTAGGACATGATACATTTGAGGG + Intronic
994787034 5:104178977-104178999 GTGGGAAGTTTTACAGTTCAGGG + Intergenic
995581381 5:113606518-113606540 GTGGGAATTTTTACAGTTCAGGG + Intergenic
995977193 5:118053593-118053615 CTGGGAAATAGTGCAGATGATGG + Intergenic
998784226 5:145691312-145691334 CTGGGAATATATACACTTAAAGG + Intronic
1000241708 5:159414756-159414778 CTGTAAAATTCTACAGTTCAAGG - Intergenic
1000396197 5:160777048-160777070 ATGGCAAATTATAAAGTTGGGGG + Intronic
1000800173 5:165715876-165715898 CTTGTCATTTATACAGTTGAGGG - Intergenic
1000850463 5:166333662-166333684 CTGGGTAAAAATACTGTTGATGG - Intergenic
1004340939 6:14806854-14806876 CTGGGAAAAGAAACAGTTGGAGG + Intergenic
1004794522 6:19066544-19066566 CTGGCAAATGCTACAGATGAGGG - Intergenic
1007560957 6:42807907-42807929 CTGGGAAATTGTAAATTTGTAGG + Intronic
1008031867 6:46705879-46705901 CTGGGACATTTGACACTTGATGG + Intronic
1009657805 6:66568698-66568720 GTGGGAAGTTTTACAGTTCAGGG - Intergenic
1010160207 6:72845026-72845048 CTGGGAAATCATACCTTGGATGG + Intronic
1010238447 6:73594605-73594627 AGGCGAAATTATACAGTGGATGG + Exonic
1010574355 6:77512971-77512993 GTGGGAAATTTTACAGTTCAGGG - Intergenic
1010833483 6:80558276-80558298 CTGAGAAAATATACATATGATGG + Intergenic
1011041321 6:83032952-83032974 CTGGGAAATTATAAAGAAAAAGG - Intronic
1011179098 6:84598993-84599015 CTGAGAAATTAAACAGGTGATGG - Intergenic
1012405320 6:98889896-98889918 GTGGGAAGTTATAAAGTTTATGG - Intronic
1013573118 6:111449888-111449910 CCAGGAAATGATACAGATGATGG + Intronic
1013606074 6:111749965-111749987 CAGGGAAATTCTACAGATGTGGG - Intronic
1015041446 6:128725170-128725192 CAGGGAAATCTTACATTTGAAGG - Intergenic
1016316504 6:142794461-142794483 CTTGGAATCAATACAGTTGAAGG - Intronic
1018608062 6:165620100-165620122 CAGGGAAATAATACAATTAATGG - Intronic
1020605895 7:10336402-10336424 CAGGTAAATTATACATTTGCAGG + Intergenic
1026072520 7:67134717-67134739 CTGAGTTTTTATACAGTTGAGGG - Intronic
1026704376 7:72677526-72677548 CTGAGTTTTTATACAGTTGAGGG + Intronic
1027749928 7:82130224-82130246 CTGGGAACTTATACTCTTGAGGG + Intronic
1027756162 7:82214473-82214495 CTGGGATTTTTAACAGTTGATGG - Intronic
1027893914 7:84015835-84015857 CAGGGAAATTATACAGATTCTGG + Intronic
1028251915 7:88547126-88547148 GTGGGAAGTTTTACAGTTCAGGG - Intergenic
1030236078 7:107263993-107264015 GTGGGGAGTTATAAAGTTGATGG + Intronic
1030695894 7:112584782-112584804 CTGGGAGTTTATACAGAAGAGGG - Intergenic
1031211050 7:118826659-118826681 CTAGAAAATTATCCATTTGAGGG + Intergenic
1032480310 7:132240781-132240803 CTGGGCAATCATACATTGGAGGG - Intronic
1033013295 7:137645016-137645038 TTGGGACATTATCCAGTTCATGG - Intronic
1034842489 7:154412255-154412277 CTGGGACAGAATACAGTTCAGGG + Intronic
1034854675 7:154531298-154531320 CTGGGAAATAATTCAATTAATGG + Intronic
1036499271 8:9298288-9298310 CTGGGACATGAAACAGCTGATGG - Intergenic
1037932891 8:22893480-22893502 CTGGGAAATGATACAGACAATGG + Intronic
1039183393 8:34891149-34891171 TTGGGAAGTTTTACAGTTCAGGG + Intergenic
1039572456 8:38598650-38598672 AGGAGAAATTATCCAGTTGAGGG - Intergenic
1039663913 8:39498699-39498721 CTGTAAAATTACACAGTTTAAGG + Intergenic
1040397527 8:47013834-47013856 GTGGGAATTTTTACAGTTCAGGG - Intergenic
1040526011 8:48225879-48225901 GTGGGAAGTTTTACAGTTCAGGG + Intergenic
1041341607 8:56852118-56852140 TTGGGAGATTCAACAGTTGATGG + Intergenic
1041561197 8:59220187-59220209 CCGGGAAATAATAAAGGTGATGG + Intergenic
1042568177 8:70133911-70133933 CTTGGAAATTGTCCAGCTGAGGG + Intronic
1043471527 8:80567637-80567659 CTGGGAAATTTTACAGAGGGAGG + Intergenic
1044724775 8:95184588-95184610 CTCGGATATTATAGAATTGAAGG + Intergenic
1045426111 8:102067401-102067423 CTTTAAAAGTATACAGTTGAAGG - Intronic
1048527267 8:135214522-135214544 CTGGGAAAAAATACAGTCCATGG - Intergenic
1049047249 8:140162571-140162593 CTGCAAAATAATTCAGTTGAGGG + Intronic
1049944219 9:579149-579171 CTGGGGAGGTATTCAGTTGAGGG + Intronic
1051426140 9:16933440-16933462 CTGAGAAATGTTACAGTTAAGGG + Intergenic
1052215824 9:25964609-25964631 ATGGGAAGTTTTACAGTTCAGGG - Intergenic
1053131913 9:35620162-35620184 CTGGGACATTCTACAGTTTGTGG - Intronic
1055927592 9:81526558-81526580 CTGGGGAATTTTAGAGTAGAGGG - Intergenic
1056627167 9:88263422-88263444 CTGGGAAATTTTACAAATTATGG + Intergenic
1058061660 9:100503646-100503668 CTGGGCTAGTATACAGATGACGG - Intronic
1059557764 9:115298530-115298552 TTGGGAAGATATACAGTAGAGGG - Intronic
1203357950 Un_KI270442v1:179663-179685 CAGGGCAATTATACAGGAGAAGG + Intergenic
1186319060 X:8404284-8404306 CTGGGAAATTTTCAAGATGAGGG + Intergenic
1187006583 X:15238876-15238898 GTGAGAATTTATACACTTGAAGG + Intronic
1187921096 X:24202650-24202672 CTGGGGAATGCCACAGTTGAAGG - Intronic
1188105091 X:26139642-26139664 CTGGGAAATTATGAATATGATGG + Exonic
1188858392 X:35225642-35225664 CTGATCAAATATACAGTTGAAGG + Intergenic
1189544088 X:42023793-42023815 CTGGGAAATTTTAAAGGTGTAGG - Intergenic
1189635639 X:43005457-43005479 CTGTGAAATTAAAAAGTTGCTGG - Intergenic
1189676156 X:43462678-43462700 GGGGGAAATTATACAGGAGAGGG + Intergenic
1191204751 X:57822017-57822039 GTGGGAATTTTTACAGTTCAGGG - Intergenic
1191737741 X:64405204-64405226 GTGGGAAATAATTGAGTTGAAGG - Intergenic
1193921125 X:87427761-87427783 CTGACAAATTACACTGTTGATGG - Intergenic
1196993065 X:121348727-121348749 CTGGGAATTTATAGAGATCATGG - Intergenic
1198299248 X:135318254-135318276 CTGGGATTTTACACAGGTGAAGG + Intronic
1199447200 X:147939115-147939137 TTGGGAAATAATACAGTTAAAGG + Intronic
1199851219 X:151726043-151726065 ATGGGAAATAATTCAGTGGAGGG - Intergenic
1200917568 Y:8584742-8584764 CTGGGAAATTTTATTGTGGAAGG - Intergenic