ID: 955713966

View in Genome Browser
Species Human (GRCh38)
Location 3:61809324-61809346
Sequence GAGAAAAATGTGATCACTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 417
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 390}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955713966 Original CRISPR GAGAAAAATGTGATCACTGA TGG Intronic
902218378 1:14949303-14949325 AAAGAAAATGTGCTCACTGAGGG + Intronic
902244823 1:15113931-15113953 GAGAAAAATGGGCTCAGAGAGGG + Intronic
902775704 1:18673379-18673401 GACAAAAATGTGTTCACTTAAGG - Intronic
903554010 1:24180316-24180338 AAAAAAAGTGTGATCATTGAGGG + Intronic
905049938 1:35041789-35041811 GTGGAAAATGAGATCACTGTAGG - Intergenic
905373247 1:37498813-37498835 CAGAACAATGTGATCACTTATGG + Intronic
906334988 1:44921678-44921700 GTCAAAAATGAGTTCACTGAAGG + Intronic
907375830 1:54038799-54038821 AAGTCAAATGGGATCACTGAAGG + Intronic
907650240 1:56287868-56287890 GAGAACAATGTCATCATTGATGG + Intergenic
909044879 1:70698113-70698135 GAGAAAAATGTGCACTCAGAGGG + Intergenic
910102723 1:83595850-83595872 GACAAAAATGGCATCAGTGAGGG + Intergenic
910351193 1:86299602-86299624 GACAAAAATGAGTTCACTGTAGG + Intergenic
910955787 1:92703038-92703060 CAGAAAAATTTGCTCACTGTAGG + Intronic
911757002 1:101570208-101570230 AAGAAAAATGTGTTAAATGATGG + Intergenic
912233655 1:107824304-107824326 GAGAATAAGGTGATAACTAACGG + Intronic
914438765 1:147682602-147682624 GAGAAACATGTCATCACCAATGG + Intergenic
917002943 1:170380402-170380424 GTGAAAAATGAGTTCACTGTAGG + Intergenic
917489398 1:175485067-175485089 AAGACAAATGTCTTCACTGAAGG + Intronic
917701326 1:177584582-177584604 GTGAATAATGTGTTCACTGGTGG - Intergenic
918002106 1:180507322-180507344 TAGTAAAAAGTGATCACTCATGG + Intergenic
919260320 1:195184498-195184520 CAGAAAAATGCAATCACTTAAGG + Intergenic
919325622 1:196102746-196102768 GTCAAAAATGAGTTCACTGAAGG - Intergenic
919572117 1:199261739-199261761 CAGAAAAATCTGGTCTCTGAAGG - Intergenic
920230477 1:204466688-204466710 GAGAACAGAGTGGTCACTGAAGG + Intronic
920827100 1:209432365-209432387 GAGAGAAATGTGATCAATGAAGG + Intergenic
921454817 1:215358060-215358082 GAGAACAATGTGCTCTCTGTGGG - Intergenic
921770251 1:219028252-219028274 GAGAAACATGTGAACACACAGGG - Intergenic
922752081 1:228074991-228075013 GAGAAAAATTTGAGGACAGAGGG + Exonic
924075907 1:240336411-240336433 CAGACAAATGTGATCATTGTTGG - Intronic
924204635 1:241698982-241699004 GAGAAGAATGAGAAAACTGAGGG + Intronic
924327537 1:242910863-242910885 GTGGAAAATGTGATAAATGATGG + Intergenic
924520958 1:244805703-244805725 CAGAAAAATGTGTACACTGTAGG - Intergenic
1063617116 10:7610018-7610040 GAGAAAAATGTAATCAGGGAAGG - Intronic
1064540962 10:16404693-16404715 GAGAATAATGTGAGCATGGAAGG + Intergenic
1065116332 10:22486811-22486833 TAGAAAACTGTGTTCTCTGATGG + Intergenic
1065193958 10:23243375-23243397 ATGAAAAATTTTATCACTGATGG - Intergenic
1065838145 10:29677849-29677871 CATTAAGATGTGATCACTGAAGG - Intronic
1068260652 10:54576982-54577004 GAGAAAAATGTCTACATTGATGG + Intronic
1068888906 10:62127856-62127878 AAGAAAAATGTTAGCAATGAAGG - Intergenic
1070541763 10:77420499-77420521 GAGAAACAAGTGATATCTGAGGG - Intronic
1070855274 10:79603519-79603541 GAGGAACATCTGAACACTGAGGG - Intergenic
1071100621 10:82033092-82033114 GAAAAAAATGTGAAAATTGAAGG + Intronic
1072102064 10:92239146-92239168 GAGAACATTGTGATTACTGGAGG - Intronic
1072309119 10:94137413-94137435 GAAAAAATTGAGATAACTGATGG + Intronic
1073771166 10:106737350-106737372 CAGAAAAATGCAAACACTGATGG - Intronic
1074029089 10:109666115-109666137 GAAATAAATGTGATTACTCAGGG - Intergenic
1076485574 10:130814153-130814175 AAAACAAATGTGGTCACTGAAGG - Intergenic
1076561999 10:131373068-131373090 GAGCAGAATGTTAGCACTGAGGG - Intergenic
1078736338 11:14024352-14024374 CAGAAAAATTTGATCACAGGTGG + Intronic
1079119463 11:17671654-17671676 GAGGAAAGAGTGATCACAGAGGG - Intergenic
1079601026 11:22313658-22313680 GAGAAAAATATGATAAGGGAGGG + Intergenic
1079616539 11:22500950-22500972 GAGCACATTGTGATCACTGTGGG - Intergenic
1080951046 11:37033393-37033415 GAGAAAAATGTGAAAATTCAGGG + Intergenic
1081163227 11:39777175-39777197 CAGAAGAATGTGATCAATAATGG + Intergenic
1081209003 11:40308764-40308786 AAGAAAAATGTCAGCAGTGACGG + Intronic
1082705448 11:56489161-56489183 GAGAAAGAAGTGATCATTGTAGG + Intergenic
1083574810 11:63782586-63782608 GAAAAAAATTTGACCAATGATGG - Intergenic
1083842442 11:65312307-65312329 GAGAGAGATGTGATGACTGAAGG - Intergenic
1084513126 11:69618384-69618406 GAGCTGAATGAGATCACTGAGGG + Intergenic
1085700175 11:78738847-78738869 GAGATAAAGCTGATCACAGAGGG + Intronic
1087709421 11:101532026-101532048 GACCAAAATGAGATCACTCATGG + Intronic
1088436782 11:109822406-109822428 CAGAAAGATGTGTTCACTTATGG + Intergenic
1090631178 11:128650102-128650124 GAGAAAAATGTTAGCCCTCAAGG - Intergenic
1090676445 11:129001900-129001922 GATAAAAATGAGTTCACTGTAGG + Intronic
1091789016 12:3260673-3260695 GGGCAAAATGTGTTCAGTGAGGG + Intronic
1094740882 12:33287116-33287138 CAGAAAAATCTCTTCACTGAAGG - Intergenic
1095256236 12:40040065-40040087 GAAAAAAATCAGATAACTGAAGG + Intronic
1095387064 12:41662935-41662957 GAGAATGGTGTGAACACTGAAGG + Intergenic
1096351524 12:50904915-50904937 GAGAAAAATATGATAAGGGAGGG + Intergenic
1097279150 12:57833783-57833805 GAGAGGAAGGTGAGCACTGAGGG + Intronic
1098110696 12:67118543-67118565 AAGCAAAATGTGATCAAAGATGG + Intergenic
1098250343 12:68562666-68562688 AAGAAAAAAGGGATCACTTAAGG - Intergenic
1098449396 12:70602267-70602289 GAGAACCATGTCAGCACTGAGGG + Intronic
1099040759 12:77651715-77651737 GAGTAAAATGTGACCATTCATGG + Intergenic
1099189486 12:79547770-79547792 GAAAAAAATGTTTTCACTGAGGG + Intergenic
1099619405 12:84982230-84982252 GATAAAAATATCACCACTGATGG + Intergenic
1100574211 12:95874495-95874517 GAGAAGAATGAGATGAATGAAGG + Intronic
1101695128 12:107118574-107118596 GAAATAACTGTGATCACTGATGG - Intergenic
1102820516 12:115905403-115905425 GAGCAAAATGGGAACAATGAGGG + Intergenic
1104029689 12:125055641-125055663 GAAAAAAAAGTGATCAAGGAAGG - Intergenic
1104238294 12:126961157-126961179 CAGAAAAATCAGATCACTGTGGG + Intergenic
1104637528 12:130447490-130447512 GAGGGACAGGTGATCACTGATGG + Intronic
1104637540 12:130447542-130447564 GAGGGACAGGTGATCACTGATGG + Intronic
1104656217 12:130575479-130575501 GAAAGAGATGTGTTCACTGATGG - Intronic
1104959749 12:132483060-132483082 GAGAAGAATGTGAGCGCTCACGG + Intergenic
1106315670 13:28591146-28591168 GAGATAAAACTGACCACTGAGGG - Intergenic
1106506939 13:30378734-30378756 GACAAAATTGTGAGCACTGCTGG + Intergenic
1106679110 13:31992012-31992034 GAAAAAAATGTAATCAATGCTGG - Intergenic
1106963668 13:35033295-35033317 GCGAAAAATGAGTTCACTGTAGG + Intronic
1107061290 13:36162530-36162552 AAGAAAAATGTGATCATACAAGG - Intergenic
1108060365 13:46526994-46527016 TAAAATAATGTGATCACTGGTGG - Intergenic
1108315501 13:49233140-49233162 AAGAAAGATGTAATAACTGAAGG + Intergenic
1108329422 13:49370402-49370424 GTGAAAAATACGACCACTGATGG + Intronic
1108513868 13:51179104-51179126 AAGAGAAGTGTGTTCACTGAAGG - Intergenic
1109153999 13:58881627-58881649 CAGAAAAATCTGAACACTAAAGG - Intergenic
1109246318 13:59958126-59958148 TGGAAAAATTTTATCACTGAGGG - Intronic
1109928780 13:69184738-69184760 TAGAAAAATGTGATTACTCTAGG + Intergenic
1110414576 13:75238080-75238102 GAGAAACATCTGTCCACTGAGGG - Intergenic
1110478210 13:75942915-75942937 GAGAACCATGTGAAAACTGAAGG + Intergenic
1111664276 13:91247343-91247365 GAGAAAAATCTCATTACTAAAGG + Intergenic
1112597331 13:100819763-100819785 GAAAAAAAAATGATCACAGAAGG + Intergenic
1112839322 13:103556618-103556640 GAGAAACATGTTCTCTCTGAAGG + Intergenic
1113037573 13:106067838-106067860 GACAAAAATTAGATCAGTGATGG + Intergenic
1113533830 13:111048779-111048801 GACAAGGATGTGCTCACTGATGG - Intergenic
1114036340 14:18632518-18632540 GATAAAAATGTTTTCCCTGAAGG - Intergenic
1114122295 14:19682515-19682537 GATAAAAATGTTTTCCCTGAAGG + Intergenic
1114241363 14:20871426-20871448 GAGAAAAATATGATTACCAAGGG + Intergenic
1114691048 14:24582001-24582023 GAGAAAAAAATTATAACTGACGG - Intergenic
1115651813 14:35407751-35407773 GAGAAAAATCTGAGTGCTGAAGG - Intergenic
1116168171 14:41361330-41361352 TAGAAAAATGTGCTAACTGGTGG + Intergenic
1116333289 14:43622868-43622890 GATAGAAATTTTATCACTGAGGG - Intergenic
1116377641 14:44224288-44224310 AAGGAAAATGTGTCCACTGAAGG - Intergenic
1116446905 14:45021473-45021495 GAGAAAAATATGATAAGGGAGGG + Intronic
1116503341 14:45647810-45647832 GAGAAAAATATAAGCACAGAGGG - Intergenic
1116526319 14:45910338-45910360 GAGAAAACTGTTCTCACTTAGGG - Intergenic
1117584312 14:57184601-57184623 GAGAAAAAAGAAATAACTGAAGG - Intergenic
1118055367 14:62074248-62074270 GAGAAAAGTGTGGAGACTGAAGG + Intronic
1118433246 14:65743866-65743888 AAGAAAAATGTCATCTCTGTAGG + Exonic
1120315648 14:82889218-82889240 GAGAATGATGGGATCGCTGATGG - Intergenic
1121257939 14:92544886-92544908 GAGAAAAATAGGATCAGGGAGGG - Intronic
1121996928 14:98609825-98609847 GAGAAAAAGCTGTTCCCTGAGGG + Intergenic
1126409493 15:48357408-48357430 CAGAAACATGAAATCACTGAAGG + Intergenic
1128912351 15:71527414-71527436 GTGAAAAATGTGACAACAGAAGG + Intronic
1129618601 15:77121512-77121534 GAGTGAAATCTGATCAGTGAGGG + Intronic
1131632517 15:94194330-94194352 GAAAAAAAAGTGTCCACTGAGGG - Intergenic
1131973615 15:97918443-97918465 GAGAACAATGTGGTTGCTGATGG + Intergenic
1133427907 16:5709067-5709089 GAGTAGAATGTGATGACTCACGG - Intergenic
1133709321 16:8385903-8385925 GAGAAAAAAATCATCCCTGAGGG + Intergenic
1135532894 16:23269776-23269798 GACCAACATGTGATCAGTGAGGG - Intergenic
1136969673 16:34959792-34959814 GAGTCAAATGGAATCACTGAAGG - Intergenic
1137396780 16:48121715-48121737 GAGAAAAGTATGATCACCAAAGG - Exonic
1139021652 16:62757405-62757427 GATAAAAATGAGATCATTCAGGG - Intergenic
1141670153 16:85487500-85487522 GGGAATAATGTGGTCACTGTGGG - Intergenic
1141710654 16:85697082-85697104 GAGAAAAGTGTGAAAACAGATGG - Intronic
1143206684 17:5146211-5146233 GAGAAAAATGTCATCTTTGAAGG - Intronic
1144175310 17:12699422-12699444 GAGAAATATATGATCAAAGAAGG - Intronic
1144320539 17:14114161-14114183 GGAAAAAATGGGATAACTGAGGG - Intronic
1146997609 17:37334670-37334692 GAGAAAAATATGATAAGGGAGGG - Intronic
1149484813 17:57034292-57034314 AAGAAAAATGTGGTCACTTCAGG + Intergenic
1149826874 17:59836523-59836545 GAGAAAAGAGAGATCAGTGAGGG - Intronic
1149873719 17:60208000-60208022 GAGAAAAATGTCATCTTTGGAGG + Intronic
1150087502 17:62285260-62285282 GAGAAAAATGTCATCTTTGAAGG + Intergenic
1155260949 18:24041891-24041913 GAGAAAAATGTAATCACGCCGGG - Intronic
1156714363 18:39988924-39988946 GAGAAAACAGTGTTGACTGAAGG - Intergenic
1157666639 18:49492921-49492943 GTGAAAAATGCGCTAACTGAAGG + Intergenic
1157868958 18:51211862-51211884 GAGGAAAATGACATCATTGAAGG + Intronic
1158137365 18:54222805-54222827 CACAAGAATGTGATCACTGCTGG - Intronic
1158174501 18:54639017-54639039 CAGAAAACAGTGATCAGTGAGGG + Intergenic
1158280442 18:55819849-55819871 AGGAAAAATGTGATGACTTAGGG + Intergenic
1159087365 18:63809247-63809269 GAAATAAATGTGATGAGTGAGGG + Intergenic
1161653620 19:5499504-5499526 AAGAAAACTGTAATCACTGCGGG + Intergenic
1162188785 19:8928362-8928384 GACAAAAATGTGATGGGTGAAGG + Intronic
1163195329 19:15715577-15715599 GAGAAATATGTGAGCTTTGAAGG + Intergenic
1163958524 19:20665639-20665661 GAGAAACATGTTATGGCTGAAGG - Intronic
1165186145 19:34023647-34023669 GAGAAAAATGTGAAAAATAAAGG - Intergenic
1165227276 19:34363977-34363999 AAGAAATAAGTGGTCACTGAGGG - Intronic
1165298320 19:34947171-34947193 GAGAAAATTGTCAGAACTGAAGG + Intergenic
1166223808 19:41382631-41382653 GAGAAAAAAGTGTTCAGAGATGG - Intronic
927121951 2:19973720-19973742 GAGAAAAATGAGGTCACTGTGGG + Intronic
928143235 2:28749249-28749271 GAGTAAAATGTGTTTCCTGAAGG - Intergenic
929236281 2:39608550-39608572 GATGAAAATGTGAGCACTGGAGG + Intergenic
930463512 2:51714333-51714355 GTGAAAAATGAGTTCACTGTAGG + Intergenic
931830415 2:66045209-66045231 GAGAAAGCTGCTATCACTGATGG + Intergenic
932939436 2:76145109-76145131 GAGATAAATGGGTTCACTCAAGG + Intergenic
933307424 2:80619309-80619331 AATAAAAATGTGCCCACTGAAGG + Intronic
934500290 2:94855708-94855730 GAATAATATGTGACCACTGAAGG - Intergenic
935617382 2:105100740-105100762 GAGTAGAATGTAATCACTGGGGG - Intergenic
936102545 2:109595553-109595575 GAGAAATTAGAGATCACTGAAGG + Intronic
936228338 2:110678400-110678422 GAGAAAAATGTCTTAACTGGAGG + Intergenic
936927599 2:117753482-117753504 GGGGAGGATGTGATCACTGATGG + Intergenic
937766682 2:125669408-125669430 GAAAAAATTGTAATAACTGAGGG + Intergenic
939661225 2:144892539-144892561 GATTCAAATGTGATCACAGAAGG - Intergenic
939666436 2:144957875-144957897 GAGAAGAATGTAATAATTGATGG + Intergenic
941089132 2:161154291-161154313 GACAAAAGAGTGATCACTTAAGG + Intronic
942369971 2:175273207-175273229 GAAAAATATGTGTTTACTGAGGG + Intergenic
942535149 2:176955586-176955608 AAGAAAAATAAAATCACTGAAGG + Intergenic
942919698 2:181356924-181356946 GAGAAAACTGAAATCACTTATGG - Intergenic
942969150 2:181936295-181936317 TAGAAAAATGTAAACATTGATGG + Intergenic
944050522 2:195463328-195463350 GAGAAATATGGGATGAATGATGG + Intergenic
944571270 2:201046824-201046846 GAGAAAAATGTGATCCCTACTGG + Intronic
944614641 2:201448030-201448052 AATAAAGATTTGATCACTGAAGG + Intronic
945118246 2:206430729-206430751 CAGAACAATGTTATAACTGAGGG + Intergenic
945171401 2:207000517-207000539 GAGAAAAATGTGAATTTTGATGG - Intergenic
945713839 2:213333702-213333724 GTCAAAAATGTGTTCACTGTAGG - Intronic
946115041 2:217453856-217453878 GCTAAAAATGAGCTCACTGAGGG - Intronic
946443867 2:219721071-219721093 CAGTAAAATGTGATCTCTGGCGG - Intergenic
946651826 2:221899616-221899638 GAGAAAAGTGTAATAACTAATGG + Intergenic
947891693 2:233627920-233627942 GAGTAAAAAGTGATCTCTCATGG - Intronic
1168887161 20:1267474-1267496 TAGAAAAAGGTGATCTCTGCAGG + Intronic
1169723390 20:8703041-8703063 GAGAGAAAGGTGAACACAGAAGG + Intronic
1170027225 20:11902524-11902546 CAGTAAAATGTGATCTCTGGTGG - Intronic
1170299162 20:14863176-14863198 AAGAAAAACGAGATCCCTGAAGG + Intronic
1170771229 20:19334499-19334521 GTGAAAAAGATGATCACTTATGG - Intronic
1172353749 20:34264407-34264429 CAGTAAAATGTGATCCCTCAAGG + Intronic
1173380329 20:42534009-42534031 GAGATCCATGTGAACACTGAAGG + Intronic
1173470441 20:43319537-43319559 GAGAAAAATGTGCAAACTCAGGG - Intergenic
1173949725 20:46980776-46980798 GAGTAGACTGTGATTACTGAAGG - Intronic
1173965263 20:47107876-47107898 GAGAAAAATGTGGCCAGGGAAGG + Intronic
1175747632 20:61469850-61469872 GTCGAAAATGTGTTCACTGAAGG + Intronic
1177827394 21:26099360-26099382 AAGAAAAATGTCATAACTGAGGG + Intronic
1178662704 21:34520898-34520920 GACAAAAGTGTGAGCACTGCGGG - Intronic
1180460466 22:15559578-15559600 GATAAAAATGTTTTCCCTGAAGG - Intergenic
1181122171 22:20678272-20678294 GAGAAAAAGATCATCAATGAAGG + Intergenic
1182878517 22:33713035-33713057 GAGCAAAATCCCATCACTGAAGG + Intronic
949229445 3:1733332-1733354 GATAAAAATGTTATAACTGGAGG + Intergenic
949852616 3:8434157-8434179 GAGAAAAATAAGAAAACTGAGGG + Intergenic
949902295 3:8826426-8826448 GAGAAAAATGTAATCAGAGCGGG + Intronic
951689400 3:25380126-25380148 GAGAAAAATCTGACAACTAATGG + Intronic
951838211 3:27005036-27005058 GAGAAAAATATGATAAGGGAGGG - Intergenic
952066020 3:29571564-29571586 GTGAAAAATGAGTTCACTGTAGG + Intronic
954259571 3:49428939-49428961 AGGAAAAATGTGTTAACTGAAGG + Intronic
954484047 3:50829513-50829535 GAGAAAAATGTTGACATTGAGGG - Intronic
955713966 3:61809324-61809346 GAGAAAAATGTGATCACTGATGG + Intronic
956310870 3:67878313-67878335 GAGAAAAATGTCATAAATAATGG + Intergenic
956570895 3:70693493-70693515 AAGAAAACTGTGATCCCTGAAGG - Intergenic
956848686 3:73207786-73207808 GTGAAGAATGTGATCACCCAGGG - Intergenic
957267796 3:77989149-77989171 GTCAAAAATGTGTTCACTGTAGG + Intergenic
957279084 3:78126868-78126890 GATAAAAATGGCATGACTGAAGG - Intergenic
957555441 3:81760808-81760830 GAGAAAAAATTGATCAATGTAGG + Intronic
958574431 3:95929636-95929658 GGGAAAAATGGGATGACTGCAGG - Intergenic
958629505 3:96668803-96668825 GAGAAAAATATGATAAGGGAGGG + Intergenic
958806337 3:98815349-98815371 GAGAAAAATAAGAAAACTGAAGG + Intronic
959102871 3:102033385-102033407 GAGATGAATGTGATGACTGATGG + Intergenic
959556705 3:107728051-107728073 GAGAAAGATGTTGTCAGTGAAGG + Intronic
960008767 3:112810493-112810515 GAGAAATATATGACCACTAAAGG - Intronic
960277708 3:115746123-115746145 GAGAAAAATGTGACAAGGGAGGG - Intergenic
960328398 3:116325789-116325811 AATAATAATTTGATCACTGAGGG - Intronic
960848145 3:122023375-122023397 AAGAAAAATGTGATGGCTGGTGG - Intergenic
961948258 3:130716988-130717010 CACGAAAATGTGATAACTGAAGG - Intronic
961951639 3:130755745-130755767 CATAAAAATGTGTTCAATGATGG - Intergenic
962352285 3:134664901-134664923 GAGAAAAATATCTTCACTGGGGG - Intronic
963381328 3:144534118-144534140 GAGAGAAGTGTGAACAGTGAAGG + Intergenic
964936219 3:162091516-162091538 GTGAAAAATGAGTTCACTGTAGG + Intergenic
965026535 3:163309258-163309280 GTCAAAAATGTGTTCACTGTAGG - Intergenic
965407756 3:168291734-168291756 GAAAAAATTGTGATCACTGTGGG + Intergenic
965767101 3:172142403-172142425 GATTAAAATGTCATCTCTGAAGG + Intronic
967328218 3:188263749-188263771 AAGAAAAATGCTATCAGTGATGG - Intronic
967772973 3:193355301-193355323 GGGAATAATGTGATGATTGAAGG - Intronic
968345537 3:198002127-198002149 GAGAAAAAAGAAAGCACTGATGG - Intronic
969319231 4:6401658-6401680 GATAAAATTGTGATGACAGAGGG - Intronic
969352444 4:6605549-6605571 TAGAAAAAAATGAGCACTGAGGG + Intronic
970693658 4:18648820-18648842 GTGAAAAATGAGTTCACTGCAGG - Intergenic
970865525 4:20754480-20754502 AGGAAGAATGTGATCTCTGATGG - Intronic
970991894 4:22222282-22222304 AAGAAAGATGTGTTCACTTAAGG - Intergenic
971560107 4:28068380-28068402 GAGAAAAAAGTAATCCCAGAAGG + Intergenic
971831527 4:31701702-31701724 GGGAAAAATGAGATCACACATGG - Intergenic
972203946 4:36748137-36748159 GAGAATAAAGAGATGACTGATGG + Intergenic
973296131 4:48522615-48522637 CAAAAATATGTTATCACTGAAGG + Intronic
974325302 4:60406677-60406699 GAGAAAAATGAGAACTCAGAAGG - Intergenic
974347692 4:60703205-60703227 GAGAAAACTGAAATGACTGATGG - Intergenic
974503510 4:62736674-62736696 AAGATAAATTGGATCACTGAGGG + Intergenic
975313505 4:72928082-72928104 GAGAAAAATATGATAAGGGAGGG + Intergenic
975872093 4:78791006-78791028 GAGAAAAATCAAATAACTGATGG - Intronic
976348577 4:84033701-84033723 GAAAAAAATGTGCTCAGGGAAGG + Intergenic
976417494 4:84795269-84795291 TAGAACAATTTCATCACTGAAGG + Intronic
978586243 4:110278901-110278923 GAGAAAAATATGATAAGGGAGGG + Intergenic
978724966 4:111958854-111958876 GACAAAAATGTAAACACTCATGG - Intergenic
978743059 4:112160756-112160778 GTCAAAAATGTGATCACTATAGG - Intronic
980524220 4:133968544-133968566 GAGAAAGATTTGATCTTTGAAGG + Intergenic
981125028 4:141095799-141095821 GAGAAAAATATAATCACTGAGGG + Intronic
981212918 4:142130104-142130126 GAGAAGACTGTGTTCACTCATGG + Intronic
981620425 4:146691506-146691528 GAGAAAAATGGGATTATGGAGGG - Intergenic
981714791 4:147742243-147742265 AAGAAAAATGTAGGCACTGAAGG - Intronic
982741890 4:159066015-159066037 GAGAAAGAAGTGAACAATGAGGG - Intergenic
983832349 4:172342924-172342946 GATATAAATGAGAACACTGATGG - Intronic
984535106 4:180964595-180964617 GAGTAAAAAGTGATCTCTCACGG - Intergenic
986469109 5:8056949-8056971 GAGGTAAATGTGTTCACTTAGGG - Intergenic
986888446 5:12269950-12269972 GAGAAAAATGGAATTACAGAAGG + Intergenic
987745742 5:21969354-21969376 AAGAAAGCTGGGATCACTGAGGG - Intronic
987792721 5:22588860-22588882 GAGAAAAAGGTGATAACTGCAGG - Intronic
987996459 5:25287904-25287926 GAACAAAATTTGATCTCTGATGG - Intergenic
988181645 5:27802657-27802679 GAGAAAACTGTGAACAGTGGAGG - Intergenic
989111510 5:37911104-37911126 GTGAAAAATGAGTTCACTGTAGG - Intergenic
989204354 5:38796763-38796785 AAGGAAAATGTCAACACTGATGG - Intergenic
989489001 5:42028626-42028648 GAGAAAAACATGCTCACTAAAGG - Intergenic
990617449 5:57521996-57522018 GAGAAAAATATGATAAGGGAGGG + Intergenic
991490167 5:67174875-67174897 GAGACAAATTTGAGCACGGATGG - Intergenic
992095382 5:73357915-73357937 GAGGGAAATCTGATCTCTGAGGG + Intergenic
992548408 5:77838238-77838260 GAGAAAAATATGTTCATTGTTGG + Intronic
993784630 5:92114598-92114620 GAAAAAAATGTGATCATATAAGG + Intergenic
993906128 5:93625011-93625033 GAAAAAAATATCATAACTGATGG + Intronic
994234776 5:97349417-97349439 GAGAAAAATGTGTTTTCTGTGGG + Intergenic
994863758 5:105235645-105235667 TATAATAATGTGTTCACTGAAGG + Intergenic
995125861 5:108576542-108576564 GAGAAAAATATGATAAGGGAGGG + Intergenic
995615931 5:113964394-113964416 GAGGAAAAGGTGAACATTGATGG - Intergenic
996418061 5:123231139-123231161 AAGAATAATGTAATCATTGAAGG + Intergenic
1000774533 5:165402533-165402555 TAGAAAAATGTTATCACACATGG - Intergenic
1001259253 5:170213126-170213148 GAGAAAAATGTCTGTACTGAGGG + Intergenic
1001818096 5:174688381-174688403 AATAAAAATGTGATCACTCTCGG + Intergenic
1003494310 6:6650754-6650776 AAGAAAAATGTATTCAGTGATGG - Intronic
1004785640 6:18964654-18964676 GAGGAAAGTGTGACCACAGAAGG + Intergenic
1006003385 6:30984071-30984093 GAGAGAAATGTGACCACTACTGG + Intronic
1006803986 6:36776897-36776919 GAGAACAGGGTGGTCACTGAGGG - Intronic
1006808819 6:36806648-36806670 GAGATAAATTTTATCAGTGAGGG - Intronic
1008613706 6:53206713-53206735 GGGTAAACTGTGATCAGTGATGG - Intergenic
1010600399 6:77818583-77818605 GAAAAAAATGTGAACTATGATGG - Intronic
1011771829 6:90681986-90682008 GAGAAAAATGTAATCTGAGAGGG - Intergenic
1012044169 6:94248362-94248384 AAGTAAAATGTGATCATTAATGG - Intergenic
1012170527 6:96012355-96012377 TACAAAAATGTGATTCCTGAAGG - Intergenic
1012374947 6:98550594-98550616 GAGAAAAATCTGATAACAAAAGG + Intergenic
1012711059 6:102605578-102605600 AAGAAACATCTGATCAATGATGG + Intergenic
1013022535 6:106233772-106233794 GAGAAAAATATGATAAGGGAGGG - Intronic
1013257123 6:108398739-108398761 GTCAAAAATGTGTTCACTGTAGG + Intronic
1013855318 6:114565273-114565295 GAGAAAAATGTATTCTCTTATGG - Intergenic
1014255734 6:119158743-119158765 GAGAAATATGGGGTCATTGAAGG - Intergenic
1014808073 6:125853977-125853999 TAGAAAAATGAGATAACTGTAGG - Intronic
1015142655 6:129952982-129953004 GAGAGTAATGTGATCAAGGAGGG + Intergenic
1015142705 6:129953794-129953816 GAGAGGAATGTGATCAAGGAGGG + Intergenic
1015306797 6:131717493-131717515 GAGTCAAATTTGATCTCTGAAGG - Intronic
1015854186 6:137605973-137605995 GAGAAATCTGTGAGCCCTGAAGG + Intergenic
1015872009 6:137785741-137785763 GAGAAAAATGTCATCAGTAGTGG + Intergenic
1016130312 6:140460297-140460319 GAGAAAAATGGGAGTAATGATGG - Intergenic
1016370374 6:143367392-143367414 GAGAAATTTGTGAACACTGAGGG + Intergenic
1017284842 6:152662412-152662434 GAGAAAAAGGTGATTAAGGAAGG + Intergenic
1018101616 6:160445702-160445724 GGGCAAGATGGGATCACTGATGG + Intronic
1018281164 6:162187219-162187241 GAGAAAGAAGTGATCACCGGAGG + Intronic
1018655377 6:166029274-166029296 GAAAAAAATGTAATCCCTGCAGG + Intergenic
1019855207 7:3598719-3598741 GACAAAAATGTGATCCCAAAAGG - Intronic
1020255223 7:6499299-6499321 GAGAAAACTGGGCTCACAGAGGG + Intronic
1020490334 7:8774841-8774863 TAGAAAAATATCATCTCTGAAGG + Intergenic
1020982932 7:15094738-15094760 GAGAAAAATGTGAACATGAAGGG + Intergenic
1021392396 7:20109429-20109451 GGGAAATAGGTGATGACTGAAGG - Intergenic
1021396329 7:20153076-20153098 GAGATAAATGTAGTCTCTGAGGG + Intronic
1021402246 7:20222672-20222694 GAGAGAGATGTGATGACGGAAGG - Intergenic
1021581041 7:22153698-22153720 TTGAAAAATGTGAGCACTGTGGG - Intronic
1022299627 7:29091003-29091025 GAGAAGAATGTGGTCACAAAGGG + Intronic
1023665471 7:42518447-42518469 AAGAAAGATGTGATCACTAAGGG + Intergenic
1024616159 7:51114232-51114254 GAGAAAAAAGTCATCCCTGGGGG - Intronic
1024730143 7:52244628-52244650 CAGAAACATGTGAAAACTGAGGG - Intergenic
1024751532 7:52471388-52471410 GAGAAAAAAATGATGAATGAAGG + Intergenic
1026734219 7:72939038-72939060 GACACAGATGTGATCCCTGAGGG - Intronic
1026784552 7:73293944-73293966 GACACAGATGTGATCCCTGAGGG - Intergenic
1027109519 7:75425984-75426006 GACACAGATGTGATCCCTGAGGG + Intronic
1027822499 7:83064873-83064895 GAGAAAAATGTGACTATTAAAGG - Intronic
1028365460 7:90024464-90024486 GAGAAAACTGTGTTTACTAAAGG + Intergenic
1028588018 7:92470355-92470377 GAGAAAAATATGATAAGGGAGGG + Exonic
1029727134 7:102414289-102414311 GAGAAAAAGGTGATCAATTCAGG - Intronic
1030006169 7:105122671-105122693 AAGAGAAATGTGAGAACTGAGGG - Intronic
1030611613 7:111695932-111695954 GAGAAAAAGGGGATCACATAAGG - Intergenic
1030628466 7:111869758-111869780 CAGGAAAATGTGAGAACTGATGG - Intronic
1030823566 7:114125826-114125848 AACAACAATGTGATCACTGTAGG - Intronic
1032654197 7:133909887-133909909 AAGAAAAATCTGAACATTGACGG + Intronic
1032846538 7:135756327-135756349 GAAAAAACTGTAATCTCTGAGGG - Intergenic
1033492875 7:141861742-141861764 GAGAAAAATGTGATTATATAAGG + Intergenic
1033579782 7:142721735-142721757 GAAAAAATTCTGATCACAGAAGG + Intergenic
1034736937 7:153438182-153438204 TACAAAAATGTGCTCACTTACGG + Intergenic
1035458577 7:159025137-159025159 AAGAAAAATGAGAGCTCTGAAGG - Intergenic
1035985850 8:4430982-4431004 GAGAAAAGTGGCATAACTGAGGG - Intronic
1035991590 8:4496830-4496852 TAGAAAAATGAGTTCACAGAAGG + Intronic
1036039008 8:5053501-5053523 GAGAAAAATGTGTTTCCTGAAGG + Intergenic
1037873485 8:22522692-22522714 GAGAAAATTGTAATAAGTGATGG - Exonic
1038631607 8:29250336-29250358 GAGAGAAACGTGAATACTGAAGG - Intronic
1038996101 8:32925100-32925122 GAGCATATTGTGACCACTGAAGG + Intergenic
1039185815 8:34915057-34915079 GGTAAACATATGATCACTGAGGG + Intergenic
1039997620 8:42547500-42547522 AAAAAAAATGTGCTCAATGAAGG - Intronic
1041356961 8:57011408-57011430 GAGAAAAATGTTATCAGAAAAGG - Intergenic
1043087987 8:75860564-75860586 TAGAAAAATGTATTCACTGTAGG - Intergenic
1043161897 8:76855983-76856005 GGAGAAAATGTGATCTCTGATGG - Exonic
1045870837 8:106925147-106925169 GGGGGAAATGTGATCACTAATGG + Intergenic
1046298034 8:112247578-112247600 GAGACAAAGGTGGTTACTGAAGG + Intronic
1046399356 8:113684573-113684595 GAGAAAGAAGTGTTTACTGATGG + Intergenic
1047040139 8:120984463-120984485 AAGAAAAATGCAATCACTGGCGG - Intergenic
1047314001 8:123715689-123715711 GAGAAAAAGGTGACCCTTGAGGG - Intronic
1047478481 8:125258213-125258235 GAGATAAGTTTGTTCACTGAGGG + Intronic
1048700783 8:137086957-137086979 GATAAAAATGTTTTCATTGATGG + Intergenic
1048768080 8:137866241-137866263 GAGTGAATTGTGAACACTGAGGG - Intergenic
1049598595 8:143496694-143496716 GGGAAAAGTGTGAGGACTGAGGG - Intronic
1050620200 9:7444204-7444226 GAGAAAAATGTTTTCAATGAAGG + Intergenic
1051038920 9:12782528-12782550 GTGAAAAATGAGTTCACTGTAGG + Intronic
1051276426 9:15403388-15403410 AGGGAAAATGTGATCACTGGAGG + Intergenic
1053656879 9:40224836-40224858 GAATAATATGTGACCACTGAAGG + Intronic
1053907246 9:42854123-42854145 GAATAATATGTGACCACTGAAGG + Intergenic
1054368997 9:64371111-64371133 GAATAATATGTGACCACTGAAGG + Intronic
1054527720 9:66151393-66151415 GAATAATATGTGACCACTGAAGG - Intronic
1054676628 9:67860865-67860887 GAATAATATGTGACCACTGAAGG + Intronic
1054821917 9:69531358-69531380 GAGAAAATTCTGATAATTGAAGG - Intronic
1054944137 9:70776684-70776706 GAGAGAAATGTGGTGATTGATGG + Intronic
1055342122 9:75294981-75295003 GTGAAAAATGAGTTCACTGTAGG + Intergenic
1056469136 9:86887700-86887722 GAGAAATATTTAATCTCTGAAGG - Intergenic
1057873218 9:98733517-98733539 GAGAAAAAGGTGACCACCAAGGG + Exonic
1059058870 9:111014317-111014339 GAGAGAAATGGCAGCACTGATGG - Intronic
1059700890 9:116774785-116774807 GAGGAAAATGAGATGTCTGATGG - Intronic
1059804802 9:117787140-117787162 CAGAAAACTGTAATCACTCACGG + Intergenic
1060023273 9:120150377-120150399 GGGAAAAATGTGATATCTCAAGG + Intergenic
1060879608 9:127108838-127108860 GAGAAGGCTGGGATCACTGATGG - Intronic
1061380332 9:130252762-130252784 CAGAAAACTGTGCTCACTGAGGG - Intergenic
1186286215 X:8046637-8046659 GAAAAAAATTGGATCACTGGTGG + Intergenic
1186613062 X:11157381-11157403 GAGAAACTTTTCATCACTGATGG - Intronic
1187105671 X:16239000-16239022 GACATAAATTAGATCACTGAGGG + Intergenic
1187453098 X:19416422-19416444 TAGTAAAAAGTGATCACTCACGG + Intronic
1188256433 X:27966823-27966845 AAGACAAGTGTAATCACTGATGG + Intergenic
1188594887 X:31887706-31887728 AAGAAAAAAGTAATAACTGACGG - Intronic
1188605741 X:32027309-32027331 GAGAAAAATGAGTTAACAGAAGG - Intronic
1188957563 X:36451563-36451585 GTCAAAAATGAGTTCACTGAAGG - Intergenic
1189377111 X:40474728-40474750 CAGAAAAATGTGGACACAGAGGG - Intergenic
1189397740 X:40638514-40638536 GAAGAAAATGTGAACACTGATGG - Intronic
1189459912 X:41231789-41231811 CAGAAAAATGAGAGCACTGTAGG + Intronic
1190650745 X:52566198-52566220 GAGAAAAGAGTGATCATTGCAGG - Intergenic
1191130973 X:57010384-57010406 GAGCAATAAGTGATCACTGAAGG - Intergenic
1191650745 X:63535240-63535262 GTCAAAAATGTGTTCACTGTAGG - Intergenic
1193664919 X:84304314-84304336 GACAAAAATGAGTTCACTGTAGG - Intergenic
1194521820 X:94928801-94928823 GTGAAAAATGCAATCACTGTAGG + Intergenic
1195171797 X:102275964-102275986 GTCAAAAATGAGATCACTGTAGG + Intergenic
1195187063 X:102411129-102411151 GTCAAAAATGAGATCACTGTAGG - Intronic
1195393570 X:104387854-104387876 GAGAAAAAGGAGAGCAGTGAGGG - Intergenic
1195630894 X:107054108-107054130 GAGAAAAATATGATAAGGGAGGG + Intergenic
1196127936 X:112119356-112119378 GAGAGAAAAGGGATCATTGATGG + Intergenic
1196205861 X:112938558-112938580 GTCAAAAATGAGTTCACTGAAGG - Intergenic
1196241833 X:113351541-113351563 GAGAAAAGTCAGATCACTGTGGG + Intergenic
1197658801 X:129147839-129147861 GAGAACAATGTAATCAGTGAAGG + Intergenic
1198395817 X:136218404-136218426 CAGAAAAATTTGAGGACTGATGG + Exonic
1198656217 X:138915929-138915951 GAATTAAATGTGATCAGTGAAGG - Intronic
1198954233 X:142110134-142110156 GAGAAAATTGTGTTGATTGAAGG - Intergenic
1198977046 X:142347927-142347949 GAAAAAAATGTGGACACTCAGGG - Intergenic
1199277883 X:145967886-145967908 GTTAAAAATGAGTTCACTGAGGG - Intergenic
1199722506 X:150552032-150552054 GAGAAAAATGTGCTCCATAATGG + Intergenic
1201224950 Y:11809777-11809799 GTGGAAAATGTGATAAATGATGG + Intergenic