ID: 955714213

View in Genome Browser
Species Human (GRCh38)
Location 3:61811401-61811423
Sequence CTGTGGGACCAAAAGCAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 1, 2: 1, 3: 48, 4: 264}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955714213 Original CRISPR CTGTGGGACCAAAAGCAAGA GGG (reversed) Intronic
901159455 1:7163751-7163773 CTGCGGGACCCAAAGCAACATGG + Intronic
903331541 1:22599555-22599577 CTGTGACAACAAAAGAAAGAAGG + Intronic
904828851 1:33293970-33293992 CTGTGGGAAAAACAACAAGATGG - Intronic
904926482 1:34052953-34052975 CTGGGGGACAAAGAGCAAGCTGG + Intronic
906236401 1:44213816-44213838 CTCTGGGACCATCAGCAAGAAGG + Exonic
907983594 1:59508730-59508752 CTGTGGTTCCAAATGAAAGATGG + Intronic
910689618 1:89952792-89952814 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
911809808 1:102261444-102261466 CTGTAGGCCCAAAAGGAAAAGGG - Intergenic
913045338 1:115069178-115069200 CTGTGACACCAAGAGCAAGCAGG + Intronic
913082804 1:115404672-115404694 CTGTAGGTCAAGAAGCAAGAGGG + Intergenic
914985173 1:152450090-152450112 CAGTGGCACCACCAGCAAGAAGG - Intergenic
916895892 1:169161625-169161647 CTGTGAGGCCAGAAGCAAGATGG - Intronic
917722965 1:177803516-177803538 CTGTGAGGCCAGAAGCAAGGTGG - Intergenic
918378914 1:183935546-183935568 CTGTAGCACAAAATGCAAGATGG + Intronic
918889526 1:190247705-190247727 ATGTGGGACGAAAAGAAAAAAGG - Intronic
921134822 1:212250624-212250646 CTGTGAGACAAAGAGAAAGATGG - Intergenic
922190560 1:223315101-223315123 CTGTAAGACTAGAAGCAAGATGG - Intronic
922334129 1:224605359-224605381 CTGTGGGGCTAGAAGCAAGATGG - Intronic
922587035 1:226741362-226741384 CTGTGCCACCAAGAGCAACAGGG + Intergenic
923697410 1:236267080-236267102 CTGTTGGACCAAAAGAAGGAAGG - Intronic
924105513 1:240645291-240645313 CTGTGAGACTAGAAGCAAGGTGG + Intergenic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
924775729 1:247113452-247113474 CTGTGGGACCCACAGCAGGAGGG + Intergenic
924807768 1:247374794-247374816 CTGTGAGGCTAAAAGCAACATGG - Intergenic
1064376355 10:14800061-14800083 CTGAGGGACCAATGGCAAGGAGG + Intergenic
1064376471 10:14800996-14801018 CTGAGGGACCAATGGCAAGGAGG - Intergenic
1064648242 10:17482094-17482116 CTGTGAGGCTAGAAGCAAGACGG + Intergenic
1066061555 10:31727965-31727987 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1066162132 10:32745464-32745486 GTGAGGGAGCAAAAGAAAGATGG + Intronic
1067542514 10:47166215-47166237 GTGTGTGAGCAAAAGCCAGAAGG + Intergenic
1067777095 10:49171687-49171709 CTGGGGGACCATAAGACAGAGGG - Intronic
1068073441 10:52224392-52224414 GTGTGGGAACAAAAACCAGAGGG - Intronic
1068439522 10:57032888-57032910 CTGTAAAATCAAAAGCAAGATGG - Intergenic
1068542953 10:58315995-58316017 CTGTGGGAACAAAAACAGTAGGG + Intergenic
1069136603 10:64773982-64774004 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1069806450 10:71128161-71128183 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1070016730 10:72541106-72541128 CTATGAGACTAGAAGCAAGATGG - Intronic
1070637727 10:78142549-78142571 CTGTAAAACCAAAAGCAAGTTGG - Intergenic
1072537411 10:96373988-96374010 TTGCTGGACCAAAAGCAAGGCGG - Intronic
1073034875 10:100557009-100557031 CTGGGGCAGGAAAAGCAAGATGG + Exonic
1073526153 10:104184142-104184164 CTGTGAGACTAGAAACAAGATGG - Intronic
1073676651 10:105654952-105654974 TGGTGGGAGCAGAAGCAAGAGGG - Intergenic
1075936695 10:126348494-126348516 ATGTGGGAACAAATGCAAGAGGG + Intronic
1076136610 10:128049507-128049529 CTGTGGGATCAAAAGAAACATGG - Intronic
1077222635 11:1424349-1424371 GTGTGGGGGCAAAAGGAAGAAGG + Intronic
1077789960 11:5428676-5428698 CTGTGAGGCTAGAAGCAAGATGG - Intronic
1078444130 11:11391462-11391484 CTATGGGACCAAGGGCAAGAGGG + Intronic
1081406737 11:42707218-42707240 CTGTAGGACCGAAAGCAACATGG + Intergenic
1082019954 11:47524068-47524090 CTGTGGGGCCCAAAGCAACAGGG + Intronic
1085218802 11:74855096-74855118 TTGTGGGACAAAAGGCAATATGG - Intronic
1085376601 11:76068191-76068213 CTTTGGGAGCAAGACCAAGATGG + Intronic
1085489926 11:76906036-76906058 CTGTGAGGCTAGAAGCAAGATGG - Intronic
1085621637 11:78042125-78042147 CTGTGACACCAGAAGCAAGATGG - Intronic
1086123370 11:83325073-83325095 CAAACGGACCAAAAGCAAGAGGG - Intergenic
1086221494 11:84450434-84450456 CAGCAGGAGCAAAAGCAAGAAGG + Intronic
1089121285 11:116137427-116137449 CTTAGGGACCAAAAGCACCAAGG + Intergenic
1089405250 11:118192264-118192286 CTGTGAAATCAAAAGCAAGCTGG - Intergenic
1089595848 11:119579632-119579654 CTGGGGGGCTAGAAGCAAGAGGG - Intergenic
1089720313 11:120412484-120412506 ATGTGAGACAAACAGCAAGAAGG - Intronic
1089956647 11:122577315-122577337 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1090266907 11:125359071-125359093 CTGTGGGAGCAAAGGCAGGAAGG + Intronic
1090288340 11:125519675-125519697 CTGTGAGGCTAAAAGCAAGATGG - Intergenic
1090700433 11:129290136-129290158 CTGTGGGGTCAAGAGCAATAGGG + Intergenic
1090887897 11:130895310-130895332 CTGGGGGACCAGAAGCAAAATGG - Intronic
1091333769 11:134751593-134751615 TTGTGAGATCAGAAGCAAGATGG - Intergenic
1091757358 12:3062913-3062935 CTGTGAGGCCAGCAGCAAGATGG - Intergenic
1091843143 12:3634507-3634529 CTCTAGGACAAAAAGCAAGCAGG + Intronic
1092938145 12:13383166-13383188 CTGTGAGGCTAGAAGCAAGATGG - Intronic
1096522263 12:52191164-52191186 CTGTGGGACCAGAGGCTTGAGGG + Intronic
1096975725 12:55698391-55698413 CTGGGGGACCTCAACCAAGATGG - Exonic
1097036699 12:56129037-56129059 GAGTGGCACCAAAAGCAAGAGGG - Intronic
1098077965 12:66753660-66753682 CTCTGGGAACAAAATGAAGAGGG - Intronic
1098289606 12:68945335-68945357 CTGTGAGACTAGAAGCAAGATGG + Intronic
1098291874 12:68964276-68964298 CTGTGAGGCTAGAAGCAAGATGG - Intronic
1098921392 12:76305426-76305448 CTGTGAGGCTAAAAGCAAGATGG - Intergenic
1100284255 12:93149817-93149839 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1100773427 12:97948962-97948984 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1101896538 12:108761332-108761354 GTGTGGGACCAAATGCAGGAAGG + Intergenic
1103257007 12:119550489-119550511 CTTTGGGAGGAAAAGAAAGAAGG + Intergenic
1103267908 12:119646474-119646496 TTGCTGGACCAAAATCAAGATGG + Intergenic
1104391181 12:128391716-128391738 CTGTGTGACCTAAAGCAAGGAGG - Intronic
1106612967 13:31301031-31301053 CTGTGAGACTAGAAGCAAGATGG + Intronic
1108352925 13:49603507-49603529 CTGTGAGACTGGAAGCAAGATGG + Intergenic
1110734156 13:78915241-78915263 CTATGGGACACTAAGCAAGAGGG - Intergenic
1110879462 13:80553375-80553397 CGATGGGAACAAAAGAAAGAAGG - Intergenic
1111829712 13:93311876-93311898 CTGAGGGTACAAAGGCAAGATGG + Intronic
1111989971 13:95106776-95106798 GTTTGGGAACAAAAGAAAGATGG + Intronic
1113220905 13:108100814-108100836 TTGTGGGACCAAAATCCAGATGG + Intergenic
1115023144 14:28707571-28707593 CAGTGGGACCAAAAGCAAGAAGG + Intergenic
1115402991 14:32984404-32984426 CTTTGGGAAAAAAAGTAAGAGGG + Intronic
1115712572 14:36067182-36067204 CTGTGGGGGCAAAAGCAAGTTGG - Intergenic
1116594152 14:46819095-46819117 GGGTGGGACAAAAAGGAAGAGGG + Intergenic
1117549266 14:56817574-56817596 GTGTAGGACCCCAAGCAAGAGGG - Intergenic
1119103308 14:71900393-71900415 CTGGGAGACCAAAAGCCAGTAGG - Intergenic
1119513275 14:75228350-75228372 CTGTGGGAACAAAGGGAAAAAGG - Intergenic
1121104028 14:91269350-91269372 CAGTGGGACCAAAAGCCGGCTGG + Intergenic
1121711987 14:96045358-96045380 CTGTGTGCACAAAGGCAAGAAGG + Intronic
1122482746 14:102058023-102058045 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1122789970 14:104180049-104180071 CTGTAGCACCAAATGCAAAAGGG - Intronic
1125918810 15:43512167-43512189 CTGTGGGAGAAAAACAAAGAAGG - Intronic
1126305046 15:47246344-47246366 CAGTGGGAGCTAAAGCATGAGGG + Intronic
1127042071 15:54988075-54988097 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1127051115 15:55085129-55085151 CTGTAAAACCAAAAGCAAGTTGG - Intergenic
1127537239 15:59901245-59901267 CTATGGGACAAAAGGGAAGAGGG - Intergenic
1127892691 15:63269262-63269284 CTGTGAGACCAAGAGGAAGGAGG - Intergenic
1128479345 15:68023839-68023861 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1132375345 15:101325047-101325069 CTGTAGGAGCAAAGGCAGGAGGG + Intronic
1132390808 15:101436963-101436985 CTGTGGGATCCAGGGCAAGATGG - Intronic
1132991339 16:2796696-2796718 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1136003930 16:27315481-27315503 CTGCAGGACCACAAGCCAGAGGG + Intronic
1136462524 16:30420536-30420558 TGGGGGGACAAAAAGCAAGAGGG + Intronic
1139143145 16:64292681-64292703 CTGTGAGGCTAAAAGCAAGATGG - Intergenic
1139307862 16:66003205-66003227 CTGTGGCATCCATAGCAAGAAGG - Intergenic
1140866345 16:79065820-79065842 CCGTGGGGCTAGAAGCAAGATGG + Intronic
1141104743 16:81224262-81224284 CTGGGGGACTCAAAGTAAGATGG - Intergenic
1142534551 17:605445-605467 CTGAGGGACAGAAAGGAAGATGG + Intronic
1148087485 17:45003091-45003113 CTGGTGGACAGAAAGCAAGAGGG + Intergenic
1148385462 17:47231289-47231311 CTGTGAGAACAAAGCCAAGAAGG + Intergenic
1148642381 17:49197769-49197791 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1149336522 17:55641670-55641692 CTGTGGGAGGGAAAGAAAGAAGG - Intergenic
1149725558 17:58890418-58890440 CTGTGAGAGCTAAAACAAGAAGG + Intronic
1151000613 17:70370955-70370977 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1152466177 17:80467868-80467890 CTGTGTTATCAAAAGCAAGAAGG + Exonic
1152768471 17:82153476-82153498 CTGTGGGGTCAACAGCAAGAAGG - Intronic
1153831826 18:8930506-8930528 CTGTGAGGCCAGCAGCAAGATGG + Intergenic
1153832234 18:8934050-8934072 CTGTGAGGCCAGCAGCAAGATGG + Intergenic
1155216547 18:23648209-23648231 CTGTGGGACTAAGAGCGAGAAGG + Intronic
1156398632 18:36721011-36721033 CAGTGGGACCAAGAGAAGGAGGG - Intronic
1159855164 18:73578431-73578453 CTGAGGGCCAGAAAGCAAGAGGG - Intergenic
1163765265 19:19160295-19160317 CTGGGAAACCAAAAGGAAGAAGG + Intronic
1164798152 19:31053229-31053251 CTGTGAAACCAAAGACAAGAAGG - Intergenic
1166502915 19:43354360-43354382 CTGTGGGGCCCAAAGCGGGAGGG - Exonic
925824404 2:7833298-7833320 ATGTGGGAGCAAAAGGAAAATGG + Intergenic
926007532 2:9384308-9384330 CTGTGAGGCCAGAAGCAAGATGG + Intronic
927594954 2:24388086-24388108 CTATGAGGCTAAAAGCAAGATGG + Intergenic
928853340 2:35775213-35775235 ATTTGGGACCAAAAACAAGATGG + Intergenic
928931194 2:36626103-36626125 CTGTGAGACTAGAAGCAAGATGG + Intronic
929735453 2:44543448-44543470 CTGTGGGACCTATATCTAGAAGG + Intronic
930506938 2:52294307-52294329 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
931264853 2:60651686-60651708 AGGTGGGACCATAAGAAAGAAGG + Intergenic
931440374 2:62286041-62286063 CTGCGAGGCTAAAAGCAAGATGG + Intergenic
931441111 2:62291259-62291281 CTGTGAGGCCAGAAGCAAGATGG - Intergenic
931706705 2:64952215-64952237 CTGTGGGACCCAGAGAAAGTGGG + Intergenic
932344413 2:70986197-70986219 CTCTGTGACCAAAAGAAAGGAGG + Exonic
933902612 2:86860851-86860873 CTAGGGGACAAAAAGCAAGTGGG - Intronic
935156266 2:100486214-100486236 CTGTGGGGTTAGAAGCAAGATGG + Intergenic
935777936 2:106488417-106488439 CTAGGGGACAAAAAGCAAGTGGG + Intergenic
936287118 2:111189400-111189422 CTGTGGGACCCAAGGCAGGAGGG - Intergenic
937010578 2:118559383-118559405 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
937211330 2:120273690-120273712 CTGTAAGACCAGAGGCAAGATGG + Intronic
938020945 2:127905428-127905450 CTGTGTGAGGAACAGCAAGAAGG - Intergenic
938242938 2:129757166-129757188 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
938372476 2:130780484-130780506 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
938472973 2:131582789-131582811 CTTTGAGAAGAAAAGCAAGATGG + Intergenic
938870743 2:135473750-135473772 CTGGGGGTCTAAAAGAAAGATGG - Intronic
941960116 2:171245222-171245244 CTGTGAGACTAGAAGCAAGATGG - Intergenic
942766206 2:179460277-179460299 CTGTGAGAATAGAAGCAAGATGG - Intronic
942999754 2:182311511-182311533 CTGTAGGACCAGAAGTAGGAAGG - Intronic
943101073 2:183487189-183487211 CTTTGAGACCACCAGCAAGAAGG - Intergenic
944083065 2:195811855-195811877 CTGTGAGGCCAGAAGCAAGATGG - Intronic
944981413 2:205124947-205124969 TTGGGATACCAAAAGCAAGAGGG + Intronic
946013883 2:216588432-216588454 TTGTGAGGCCAAAAGCAAAATGG - Intergenic
947264931 2:228267940-228267962 CTGTTGGACAAAAGGAAAGAAGG + Intergenic
948539578 2:238679612-238679634 TTGTCATACCAAAAGCAAGAAGG - Intergenic
1169546345 20:6654790-6654812 CTGTGAAACCAAAGGCAAAATGG - Intergenic
1171324220 20:24276610-24276632 CTCTGGGGCAAAAAGTAAGAAGG + Intergenic
1171398216 20:24854056-24854078 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1172801007 20:37576202-37576224 CAGTGAGACCAAGAGCAAGGAGG - Intergenic
1173140008 20:40473599-40473621 CTCTGGGACAAGAAGCAAGGAGG - Intergenic
1173597045 20:44265257-44265279 CTGTGGGAGCAAAAGCATGGAGG - Intronic
1174271315 20:49371389-49371411 CTGTTGGACTAAAAGCAGGCAGG + Exonic
1174424227 20:50420699-50420721 CTCTGGGACCCAGAGCAAGGTGG - Intergenic
1175054413 20:56185213-56185235 TTGTGGGAACAGGAGCAAGAAGG - Intergenic
1176899444 21:14421084-14421106 CTGAGCTACCAAAAGCTAGAGGG - Intergenic
1177549429 21:22600644-22600666 CTGTGAGACTACAAGCAAGATGG + Intergenic
1178111847 21:29376776-29376798 CTGTTGTACCCAAAACAAGAAGG - Intronic
1178307924 21:31506057-31506079 CTGTGGGACCTTGAGCAAGTTGG - Intronic
1179524109 21:41964508-41964530 CTCTGGGACCAGCTGCAAGAAGG + Intergenic
1181395771 22:22620275-22620297 CTGTGGGTCCTAGAGCAGGAAGG - Intergenic
1181494309 22:23279406-23279428 CAGTGGGACCAGGAGCAAGGAGG - Intronic
1181997999 22:26898097-26898119 CTGTAGGGCCAGGAGCAAGATGG + Intergenic
950193550 3:10993636-10993658 CGCAGAGACCAAAAGCAAGAAGG - Intronic
953961915 3:47273111-47273133 CTGAAAGATCAAAAGCAAGAAGG - Intronic
954665453 3:52249041-52249063 CTGTGGCACAGAGAGCAAGAAGG - Exonic
954748727 3:52802020-52802042 CTGTTGGAATGAAAGCAAGAAGG - Intronic
954776507 3:53023752-53023774 CTGTAGGAACAAAAGGGAGAAGG - Intronic
955320000 3:57967639-57967661 CTGAGGGGCAAAAGGCAAGAAGG + Intergenic
955714213 3:61811401-61811423 CTGTGGGACCAAAAGCAAGAGGG - Intronic
956135739 3:66096760-66096782 CTGTGAGGCTAGAAGCAAGAAGG + Intergenic
960829952 3:121835456-121835478 CTGTGGGAACAAAACCCAGAGGG - Intronic
961104278 3:124227967-124227989 CTGTGGGACAACAAACCAGAAGG - Intronic
961264742 3:125632798-125632820 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
966476524 3:180354609-180354631 CTGTGGGGACAAAGGCAAAATGG - Intergenic
966937825 3:184725414-184725436 CTGTGGAGCCAAAGGCCAGATGG + Intergenic
972137445 4:35909165-35909187 CTGTAAGATCAAAAGCAAGTTGG - Intergenic
973074039 4:45900587-45900609 CTGTGAGTCTAGAAGCAAGATGG + Intergenic
974416078 4:61607940-61607962 CTGTGAGGCTAGAAGCAAGATGG + Intronic
974527648 4:63063911-63063933 CTGTGGGACAAAAAAAAAAACGG - Intergenic
975615483 4:76242324-76242346 CAGTGGGAGCAAGAGAAAGAGGG - Intronic
975851054 4:78572965-78572987 CTGTGAGGCTAGAAGCAAGATGG + Intronic
976511321 4:85912386-85912408 CTGTGGGAGAAAAAGCACAATGG + Intronic
978337732 4:107687903-107687925 CAGAGGGACCATAAGGAAGATGG - Intronic
978376506 4:108079653-108079675 CTGTTGCAGCAAAAGCTAGATGG + Intronic
978445696 4:108777960-108777982 TTGTGGGGCTAGAAGCAAGATGG + Intergenic
979350902 4:119643452-119643474 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
981362959 4:143868406-143868428 CTTTGGGCCAAAAAGAAAGAAGG - Intergenic
981373688 4:143989213-143989235 CTTTGGGCCAAAAAGAAAGAAGG - Intergenic
981382787 4:144092468-144092490 CTTTGGGCCAAAAAGAAAGAAGG - Intergenic
982106067 4:152013123-152013145 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
982208868 4:153019106-153019128 CTGGGGGACTAAAAGGCAGAGGG + Intergenic
983110603 4:163744963-163744985 CCAAGGGACCAAAAGCAAAAGGG + Intronic
983626328 4:169805291-169805313 CTGTGAGGCTAGAAGCAAGAAGG - Intergenic
984185055 4:176533552-176533574 CTCTATCACCAAAAGCAAGATGG + Intergenic
984434716 4:179694855-179694877 CGGAGGGACTAACAGCAAGAAGG + Intergenic
984463434 4:180065771-180065793 CTATGGGATCAAAACCAAAAAGG + Intergenic
985100482 4:186453257-186453279 CTGTGGGGCTAGAAGCAAGATGG + Intronic
985663838 5:1171697-1171719 CTGTAGGACCAAGAACAAGGGGG - Intergenic
987491264 5:18582908-18582930 CTGTGAGGCCAGGAGCAAGATGG + Intergenic
987733411 5:21806776-21806798 CTGTGAGGCTAGAAGCAAGATGG - Intronic
988217954 5:28301390-28301412 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
988473533 5:31563355-31563377 CTGTGAGGCTAGAAGCAAGACGG - Intergenic
989322359 5:40151199-40151221 CTGGAGGAGCAAAAGGAAGAAGG - Intergenic
990325545 5:54671880-54671902 CTGTGAGACTAGAAGCAAGATGG - Intergenic
990928005 5:61051556-61051578 ATGTGGGAGAAAAAGAAAGAAGG - Intronic
992703364 5:79362901-79362923 ATATGGGACCAAAGACAAGATGG - Intergenic
992959025 5:81940269-81940291 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
993918906 5:93775680-93775702 CTGTGGGAAAACATGCAAGATGG - Intronic
995545738 5:113228550-113228572 CTGGGGCAGCAAAAACAAGAAGG + Intronic
995893560 5:116984924-116984946 CGGTGGGACAAAAAGAAAAAAGG - Intergenic
997632253 5:135377777-135377799 CTGTGGTACCAAAGGCCAGCTGG - Intronic
998772154 5:145557949-145557971 CTGTGAGAACAAAAGTAAGATGG + Intronic
999194774 5:149774480-149774502 TCGTGGGACCAGAAGCCAGAAGG - Intronic
1001348001 5:170925322-170925344 CTGTGTGACTTAACGCAAGATGG - Intronic
1001515716 5:172354006-172354028 CTGTGGGGACAAAAGGAAGCTGG + Intronic
1002069106 5:176668312-176668334 CTCTGGGACCACAGGCAGGAAGG - Intergenic
1004232691 6:13847303-13847325 CTGTGAGATTAGAAGCAAGATGG - Intergenic
1004279922 6:14271929-14271951 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1005277892 6:24239265-24239287 CCTTTGGACCAAAAGGAAGAAGG + Intronic
1005572387 6:27157780-27157802 CTTTGGCAACAAAAGGAAGAGGG - Intergenic
1008103412 6:47416897-47416919 CTGTGAAGCCAAAAGCAAGATGG + Intergenic
1009443469 6:63711301-63711323 CTGTGGCACCCAAAGGAATAAGG - Exonic
1009861093 6:69333320-69333342 CTTTGTGACCAAAACCAGGAAGG - Intronic
1009956456 6:70460722-70460744 TAGTGTGACCAAGAGCAAGAAGG + Intronic
1011022859 6:82833646-82833668 CTGTGAGACTAGCAGCAAGATGG + Intergenic
1011043567 6:83057605-83057627 CTGTGGGTGGAAAAGAAAGAAGG + Intronic
1012248336 6:96952452-96952474 CTGTGAGGCTAGAAGCAAGATGG - Intronic
1013067505 6:106698092-106698114 CTGTGAGTCTAGAAGCAAGATGG + Intergenic
1013582354 6:111548780-111548802 CTGTGGGATAGAAAGCAAGAAGG + Intergenic
1015700732 6:136033499-136033521 CTGTGGGAGCAACAGCAGAAGGG - Intronic
1017039610 6:150297077-150297099 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1018759502 6:166879084-166879106 CTGTGGGATAAAAACCAAGGAGG + Intronic
1018922353 6:168184116-168184138 CTCTGGGACCAGAAGGAGGAAGG + Intergenic
1020450980 7:8320154-8320176 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1021121450 7:16800382-16800404 CTGTGGGAGGAACAGCACGAAGG + Intronic
1021341344 7:19466322-19466344 CTGTGGCACAAAAAGAAAAATGG + Intergenic
1021420963 7:20444251-20444273 CTGTGAGACTAGAAGCAAGAAGG - Intergenic
1021822982 7:24516457-24516479 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1023069444 7:36414428-36414450 CTGTGTGACGAAAAGGAAGGAGG + Intronic
1026128927 7:67604603-67604625 CTGTGAGGTTAAAAGCAAGATGG - Intergenic
1027161360 7:75804843-75804865 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1027533001 7:79358745-79358767 CTCTGGAACCAACAGCAAGAAGG + Intronic
1029493211 7:100883536-100883558 CCGTGGGAAGATAAGCAAGACGG - Intronic
1030382884 7:108833181-108833203 ATGTGGGAGCAAAATAAAGATGG - Intergenic
1030468739 7:109936800-109936822 TTGTGAGGCCAGAAGCAAGATGG - Intergenic
1031047111 7:116903723-116903745 CTGTGGGCCCAGAGGCAAGGTGG + Intronic
1031308949 7:120169408-120169430 CTGTGGGACCAAATTCTTGAAGG - Intergenic
1031325728 7:120394733-120394755 CTGTGAGACTAGAAGTAAGATGG + Intronic
1033074949 7:138240118-138240140 CTGTGCGGCCAGAAGGAAGATGG + Intergenic
1033077101 7:138259851-138259873 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1034645256 7:152640575-152640597 CGGTGGGACCGAAAGGGAGAAGG + Intergenic
1036010120 8:4712758-4712780 CAGTGGTCCCAAAAGAAAGAAGG - Intronic
1038280180 8:26156905-26156927 CTGTGCAGCCAGAAGCAAGATGG + Intergenic
1038329151 8:26593910-26593932 CTGTGAGACAAAAATCAAAAGGG + Intronic
1039303153 8:36231879-36231901 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1039305199 8:36254595-36254617 CCGTGAGGCCAGAAGCAAGATGG - Intergenic
1039600126 8:38829514-38829536 ATGTGGGAGCAAAAGCATGCTGG - Intronic
1039727306 8:40232736-40232758 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1039789857 8:40866673-40866695 ATGTGCAACCAAATGCAAGAGGG + Intronic
1041055277 8:53979465-53979487 CTGTGACACTAGAAGCAAGATGG - Intronic
1041860949 8:62511651-62511673 CTGTGGTAGAGAAAGCAAGAGGG - Intronic
1041861155 8:62513966-62513988 TTGTGGCACAGAAAGCAAGAAGG + Intronic
1043379969 8:79691997-79692019 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1043572816 8:81624452-81624474 CAGTGAAACTAAAAGCAAGAAGG + Intergenic
1044233103 8:89801464-89801486 CTGTGAGACTAGAAGCAAGAGGG - Intergenic
1044573812 8:93747482-93747504 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1045229041 8:100283043-100283065 CTGTGGTTCCAAAAACAAAAAGG + Intronic
1045734196 8:105276142-105276164 CTGTGAGGCTAGAAGCAAGATGG - Intronic
1047527019 8:125642167-125642189 CTGTGGGAGCACAAGGAAGGAGG - Intergenic
1047625575 8:126652754-126652776 CTGTGGGGGCAAGAGAAAGAAGG - Intergenic
1048639059 8:136332552-136332574 CTGTGGTACCAAAAGGCAGGAGG + Intergenic
1049950013 9:634741-634763 CTGTGAGGCCAGAAGCAAGATGG + Intronic
1050168665 9:2792933-2792955 CTGTGAGGCTATAAGCAAGATGG + Intronic
1050983078 9:12045873-12045895 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1051153098 9:14106809-14106831 CTTTGGGAACAAAAGAAAGAAGG + Intronic
1052203696 9:25812598-25812620 CTGTGGGAGTGACAGCAAGAAGG - Intergenic
1052863263 9:33449723-33449745 CAGAGGGACCAAAAGAGAGAAGG + Intergenic
1054764300 9:69030356-69030378 CTATGAGACTAGAAGCAAGATGG + Intergenic
1055520899 9:77080161-77080183 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1056782051 9:89557774-89557796 CTGTGGGAGCTGCAGCAAGAAGG - Intergenic
1058791808 9:108454474-108454496 CTGTGGGACAAGAAGCAAGATGG + Intergenic
1059697748 9:116744880-116744902 CTGTGAGACCCACAGGAAGATGG + Intronic
1061763541 9:132867512-132867534 CTGTGGGACCAAAACCAGCCAGG - Intronic
1185644034 X:1604355-1604377 TTTTGGGACGAGAAGCAAGAGGG + Intergenic
1187112715 X:16318061-16318083 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1187344798 X:18453152-18453174 TTGTGTGACCAAAAAGAAGAGGG - Intronic
1187720362 X:22144051-22144073 CTATGGGACCTCAGGCAAGATGG + Intronic
1190043078 X:47087641-47087663 CTGTGAGACAAAAATAAAGATGG + Intronic
1193910541 X:87300935-87300957 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1197347750 X:125345272-125345294 CTGTGAGGCTAGAAGCAAGAAGG + Intergenic
1197652627 X:129082368-129082390 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1198040582 X:132847675-132847697 CAGAGGGACCAAAAGGGAGAGGG + Intronic
1199787471 X:151117833-151117855 CTGTGAGCCCACAGGCAAGAAGG - Intergenic
1201339713 Y:12921392-12921414 CTGTGAGACCAAGTGCAAAACGG - Intergenic
1201642031 Y:16190397-16190419 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1201660784 Y:16394924-16394946 CTGTGAGGCTAGAAGCAAGATGG + Intergenic