ID: 955716620

View in Genome Browser
Species Human (GRCh38)
Location 3:61836456-61836478
Sequence AAAGCTGGCCTCCAGGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 296}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955716620 Original CRISPR AAAGCTGGCCTCCAGGAGAC AGG (reversed) Intronic
906607453 1:47181922-47181944 GAAGCTTCCCACCAGGAGACAGG + Intergenic
907608841 1:55847330-55847352 AGAGATGGCCTCCAGGAGGCAGG + Intergenic
911978410 1:104533963-104533985 AAAACTGTCTTCCAGGAAACTGG - Intergenic
912629340 1:111233543-111233565 AAAGCTGGCATCCAGGAGGGAGG + Intronic
915490360 1:156247091-156247113 TGTGCTGGCCTCCAGGAGTCAGG - Intronic
915562795 1:156697198-156697220 AAAGCAGGCCTCAGGTAGACCGG - Intergenic
915726720 1:158023207-158023229 AGAGCTGGCCCCCAGTGGACTGG + Intronic
916083231 1:161249878-161249900 CAAGCTAGACTCTAGGAGACAGG + Intergenic
916214338 1:162382933-162382955 AGTGCTGGCCTCTAGAAGACAGG - Intronic
916331830 1:163626133-163626155 ACAGCTGGCCACCAGAAGAGAGG + Intergenic
917132568 1:171757474-171757496 AAAACTGGCCTCCAGCTGAGTGG + Intergenic
917477518 1:175381581-175381603 AAGTCTGACCTCTAGGAGACTGG + Intronic
918189869 1:182163809-182163831 ACAGCTGGCCAGCAGGAGACAGG + Intergenic
922455000 1:225767523-225767545 AAAGCTGTCCTCCAGGACCAAGG - Intergenic
922867958 1:228876451-228876473 ATGGCTGGATTCCAGGAGACAGG + Intergenic
924652173 1:245939653-245939675 AACCCTGGCCTAGAGGAGACAGG + Intronic
924868919 1:248018816-248018838 AATGCTGGACCCCAGGGGACCGG - Intronic
1063091237 10:2867673-2867695 ATAGGTGGCCTCCAGAAGGCGGG + Intergenic
1063381575 10:5589223-5589245 GAACCTGCCCTCCTGGAGACTGG - Intergenic
1063978213 10:11433738-11433760 GAAGCTGGTTTCCAGCAGACAGG + Intergenic
1064256809 10:13749288-13749310 AATACTGGCCACCAGGACACTGG + Intronic
1064737144 10:18393664-18393686 CAAGCTGGCCTTCAGTAGACTGG - Intronic
1065660994 10:28004112-28004134 AAAGCTGACCACCAGGATTCCGG - Intergenic
1065921614 10:30398246-30398268 AAAGCTGGAGGCCAGGAAACTGG - Intergenic
1066439159 10:35421381-35421403 CAAGCTGACCATCAGGAGACTGG - Intronic
1067487826 10:46668510-46668532 GAAGCTGCCCTCCAGAAGGCTGG - Intergenic
1067606980 10:47673499-47673521 GAAGCTGCCCTCCAGAAGCCTGG + Intergenic
1069206032 10:65686658-65686680 AAAGGTGTCATCCAGGAGACAGG - Intergenic
1069581933 10:69572447-69572469 AAAGGTGGCCCCCAGCAGCCCGG + Exonic
1070747999 10:78946506-78946528 AAAACTGGGCTCCAGGACAAGGG + Intergenic
1071318550 10:84428185-84428207 AAATTTGTCTTCCAGGAGACTGG - Intronic
1071622540 10:87134858-87134880 GAAGCTGGCCTCCAGAAGGCTGG + Intronic
1074518083 10:114190069-114190091 AAGTTTGGCCTCCCGGAGACAGG - Intronic
1076719331 10:132386403-132386425 GAAGGTGGCCTCCGGAAGACAGG - Intergenic
1077465275 11:2730971-2730993 AAAGCTGGGCTCCCAGAGAGCGG - Intronic
1077898915 11:6474308-6474330 AAAGGGCGCCTCCAGGAGGCAGG - Exonic
1078991103 11:16647485-16647507 AAAGATGGCATATAGGAGACAGG + Intronic
1079316368 11:19411082-19411104 AAAAAAGGCCTCCAGGTGACTGG - Intronic
1079812179 11:25008732-25008754 AAAGCTCGCCACCATGAGAGGGG + Intronic
1080830644 11:35890489-35890511 AAAACTGGCTTCCATGAAACCGG - Intergenic
1080845104 11:36020082-36020104 AAAGCTTGCCTCCAGAACTCCGG - Intronic
1081789192 11:45770916-45770938 AAAGCTGGCTTCAGGGAGAGTGG + Intergenic
1081936783 11:46910013-46910035 TAAGCTGGCCTCTAGGAATCGGG - Intronic
1083828831 11:65218172-65218194 CAAGCTGGCATCCAGGAGCCAGG - Intergenic
1084256651 11:67947262-67947284 AAAGCTGCCCCCCAGAATACAGG + Intergenic
1084475579 11:69386837-69386859 AAGGCTGGCCTTCAGGTGTCTGG + Intergenic
1084639763 11:70418205-70418227 CAAGCTGCCCTCCAGGCCACCGG - Intronic
1084931085 11:72556477-72556499 CAAACTGGCTTCCAGGACACTGG - Intergenic
1084966285 11:72746348-72746370 ACAGCTGGTCTCCAGGTGCCGGG - Intronic
1085009689 11:73129754-73129776 AAAACTGTCTTCCAGGAAACTGG + Intronic
1085449163 11:76621759-76621781 AAACCAGGGCTCTAGGAGACAGG - Intergenic
1085452982 11:76648056-76648078 AAGTCTGCCCTCCAGGAGAAGGG - Intergenic
1085576162 11:77605668-77605690 AAAACTGTCTTCCAGGAAACCGG + Intronic
1089081842 11:115782703-115782725 AATACTGTCCTCCTGGAGACAGG + Intergenic
1089262296 11:117231759-117231781 CAAGCTGGCTTCTAGGAGCCGGG - Intronic
1089290776 11:117436973-117436995 AATGCTGGCCTGCAGGTGAAGGG - Intronic
1089894081 11:121909857-121909879 AAAGCTGGGCTCCAAGGGAGTGG - Intergenic
1091584211 12:1806699-1806721 AAAGGGGCCCTCCAGGTGACTGG - Intronic
1091855129 12:3733174-3733196 ACAGCTGCCCTTCAGGAGGCTGG - Exonic
1091907393 12:4200128-4200150 AAAGCTGGCCTGGGGAAGACGGG + Intergenic
1093944158 12:25087936-25087958 AAAACTGTCTTCCAGGAAACTGG + Intronic
1094245641 12:28289171-28289193 AGAGCTGAACTCAAGGAGACTGG - Intronic
1095859616 12:46902055-46902077 AAGAGTGGCATCCAGGAGACAGG - Intergenic
1096228365 12:49883480-49883502 AAAGCAGGCATCCAGGGGAAGGG + Intronic
1100865732 12:98854716-98854738 AATGCTAGCCTCCAAGAGATGGG + Intronic
1101050024 12:100852409-100852431 AAGGAAGGCCTCCAGGATACAGG + Intronic
1101629631 12:106480462-106480484 TCAGCTGACCTCCAGGAGTCAGG + Intronic
1101954753 12:109203500-109203522 TTATTTGGCCTCCAGGAGACTGG + Intronic
1102778493 12:115542341-115542363 TAAGCTGGCCTCAAGAAGATGGG + Intergenic
1102954991 12:117053349-117053371 ACAGCCGAGCTCCAGGAGACAGG - Intronic
1103064758 12:117888203-117888225 GAATCTGGCCTCCAAGAGAATGG - Intronic
1103198830 12:119069721-119069743 TAAGGTGGCCTCCATGAAACTGG - Intronic
1103440125 12:120956871-120956893 AGAGCTGGTCACCAGGAGCCAGG + Intergenic
1103698313 12:122834942-122834964 AAATCTGGCCTCCATGAGTCTGG - Intronic
1103965680 12:124637941-124637963 AGAGCTGGCCTCCGGGAAACCGG + Intergenic
1105007049 12:132727990-132728012 AAAGCTGCCCTGCGGGTGACAGG + Intronic
1106294393 13:28397253-28397275 AAAGCAGGTCCTCAGGAGACCGG + Intronic
1112426132 13:99303010-99303032 AAAGCAAGCCCCCAGGAGGCAGG - Intronic
1113930752 13:113967707-113967729 AACTCGGGCCTCCAGGAGATGGG + Intergenic
1113969142 13:114175353-114175375 CAAGATGGCCTCCAGGATTCTGG + Intergenic
1114187783 14:20416127-20416149 AAAGCTGGCCTTCAGAAGAAAGG - Intergenic
1117754911 14:58964781-58964803 AAAGGTGGCCTCCACCTGACCGG - Intergenic
1117866408 14:60153963-60153985 AAAGCTGTTCTCCAGGAGTTTGG - Exonic
1119383077 14:74240796-74240818 AAAGTTGGCCTCGAGGAGCGAGG - Intronic
1121149215 14:91615383-91615405 AAAACTGTCCTCCATGAAACTGG + Intronic
1123063720 14:105605988-105606010 CATGCTGGCCTCCAGGGGACAGG - Intergenic
1123103076 14:105818830-105818852 ACAGCTGGCCTCCGGGTGAAAGG - Intergenic
1126410649 15:48369772-48369794 AAAGCTGGCTTCGAGAAGATGGG - Intergenic
1127477373 15:59347359-59347381 AAAGCTGTCTTCCACGAAACCGG + Intronic
1128062231 15:64742458-64742480 AAAGCTGGGTTCCCAGAGACTGG + Intronic
1128939008 15:71771811-71771833 AATGCTTTCCTCCAGGAAACTGG - Intronic
1129030874 15:72616720-72616742 AAAGCTGGAGGCCAGGAAACCGG + Intergenic
1129209509 15:74059505-74059527 AAAGCTGGAGGCCAGGAAACTGG - Intergenic
1129718559 15:77865537-77865559 AATGGTGGCCTCCAAGAGTCTGG - Intergenic
1129792108 15:78348373-78348395 CAAGCTGGGCTCCCGCAGACTGG + Intergenic
1129835779 15:78704518-78704540 AAAGCTGGAGGCCAGGAAACTGG + Intronic
1130377364 15:83341050-83341072 AAGGCTGGCCCCCAGGAAAATGG - Intergenic
1130397908 15:83520511-83520533 AAAGCTGTCTTCCAAGAGATAGG + Intronic
1130460369 15:84155329-84155351 AATGGTGGCCTCCAAGAGTCTGG + Intergenic
1131209663 15:90483435-90483457 TAAGCTGGCCTCCTGCTGACAGG - Exonic
1132309920 15:100849889-100849911 AAACCTGGTCTCCCGGAGCCAGG + Intergenic
1133410648 16:5565773-5565795 AAAACTAGCCTCAAGTAGACTGG - Intergenic
1133528232 16:6627246-6627268 GAAGCTGGCCTCTAGAAGGCGGG + Intronic
1134671676 16:16060333-16060355 CAAGCAGCCCTCCAGGTGACTGG + Intronic
1135753133 16:25073065-25073087 GATGCTGGCCACCAGGACACCGG + Intergenic
1136136313 16:28258843-28258865 ATGGGTGGCCTCCAGGAGAGAGG - Intergenic
1136138292 16:28271579-28271601 ACATCTGGACTCCAGGAAACAGG + Intergenic
1137061980 16:35799112-35799134 AAAGCTGGCCTGCTGGGGAGGGG + Intergenic
1137268350 16:46886154-46886176 AAAGCTGGCCGGGAGGAGGCTGG + Intronic
1138556521 16:57774066-57774088 AGAGCTGACCTCCAGGGGTCTGG - Intronic
1141772496 16:86099148-86099170 AAAGTTGTCTTCCAGGAAACTGG - Intergenic
1142252003 16:88996340-88996362 AAGGCTGGCCTACAGGTGCCGGG + Intergenic
1142548415 17:721835-721857 AAAACTGGTGTCCAGGATACAGG - Intergenic
1143789813 17:9285531-9285553 AAGGCCGGCCTCCAGAAGCCAGG + Intronic
1143988298 17:10934539-10934561 AGTGCTGGCCTCCAGAAGGCTGG - Intergenic
1144172407 17:12670925-12670947 ACAGCTGGACTTGAGGAGACAGG - Intronic
1144388536 17:14772119-14772141 AAAGCTGGAAGCAAGGAGACTGG - Intergenic
1144584538 17:16480295-16480317 AAAACTGTCTTCCAGGAAACTGG + Intronic
1146128877 17:30252741-30252763 TAAGCTGGCCTCCTGGATCCAGG + Intronic
1148033331 17:44638354-44638376 AAAACTGTCTTCCAGGAAACTGG - Intergenic
1148767034 17:50045492-50045514 TAAGATGGCCTCCTGGAGCCAGG - Intergenic
1148835833 17:50465293-50465315 AAAGCTGGCCGCCATTAAACAGG - Exonic
1149647715 17:58252303-58252325 AAAGCTGGCATCCAGGAAGGAGG - Exonic
1150272575 17:63876160-63876182 AACCCTGGGCACCAGGAGACAGG - Intronic
1150273918 17:63883912-63883934 AACCCTGGGCACCAGGAGACAGG - Intergenic
1150276074 17:63898712-63898734 AACTCTGGGCACCAGGAGACAGG - Intergenic
1150278222 17:63913437-63913459 AACCCTGGGCACCAGGAGACAGG - Intronic
1151645752 17:75430339-75430361 GAAGCTGGACTCCAGCAGCCAGG + Intergenic
1151958456 17:77392548-77392570 CAAGCTGGCCTCCTGCGGACTGG + Intronic
1152573334 17:81129920-81129942 GAACCTGTCCTCCAGGAGATGGG + Intronic
1153689834 18:7581140-7581162 AAAGCTGGCCTGCATCAAACAGG + Intronic
1153780316 18:8489846-8489868 AAAGCTGCCCCCCAGGAGCTAGG + Intergenic
1154322828 18:13368403-13368425 AAAGCAGGCATCCCTGAGACAGG - Intronic
1154491199 18:14923531-14923553 AGAGATGCCATCCAGGAGACAGG - Intergenic
1156140085 18:34098279-34098301 GCAGCTGGCTTCCAAGAGACAGG - Intronic
1156361264 18:36386655-36386677 AGTGCTGCCCTCCAGGAGCCTGG - Intronic
1156542416 18:37928118-37928140 AAGGCTGGCATCCAGGAGGGAGG - Intergenic
1157745335 18:50130117-50130139 CAGGCAGGCCACCAGGAGACTGG + Intronic
1159021037 18:63143389-63143411 GAAGCTGGCCTCCTGGGGGCAGG + Intronic
1160536283 18:79596019-79596041 ACAGCCGGCCTCCAGAACACCGG + Intergenic
1162184670 19:8895547-8895569 AAAGATGGAATCCAGGAAACTGG - Intronic
1162407864 19:10486392-10486414 AGAGCAGGCTTCCAGGAGAGAGG - Exonic
1162516163 19:11149127-11149149 GAAGCTGGGCTTCAGGAGGCTGG - Exonic
1163366551 19:16878887-16878909 ACAGCAGGCCCACAGGAGACCGG - Exonic
1164446723 19:28323996-28324018 AAGGTTGGTCTCCAGGAGAATGG + Intergenic
1164836993 19:31362353-31362375 AGAGGTGGCCTCCAGGAGAGGGG - Intergenic
1164926544 19:32135080-32135102 AAAGCTGTCTTCCATGAAACAGG - Intergenic
1165132053 19:33639023-33639045 AAAGGTGGCTTGCAGGTGACAGG + Intronic
1165359903 19:35329770-35329792 AACACTTGCCTCCAGGAGCCGGG - Intronic
1165460011 19:35938856-35938878 AAAGCTGGCCATGGGGAGACGGG - Intronic
1165996401 19:39846835-39846857 AAAGATGAACTCCAGGAGAGTGG - Intergenic
1167287654 19:48607483-48607505 AAGGCTGTCCACCAGGAGCCCGG + Exonic
925198378 2:1946388-1946410 AAAGCTGTCTTCCATGAAACTGG + Intronic
926436112 2:12839737-12839759 ACAGCCAGCCTCCAGGAAACGGG + Intergenic
926484075 2:13433362-13433384 AAAGCTGCTGTGCAGGAGACTGG + Intergenic
926707366 2:15846226-15846248 AGAGCTGGCCTCCAGGAGGCTGG + Intergenic
926930889 2:18039841-18039863 AAAGCTGACCTCCAACTGACAGG - Intronic
927089679 2:19700884-19700906 AAAGCTGGCATGCACGAGGCAGG + Intergenic
927252469 2:21009241-21009263 AAACCTGGCCTACCAGAGACAGG + Exonic
927462415 2:23310534-23310556 AAAGCTGACCTGAGGGAGACTGG - Intergenic
927725276 2:25417360-25417382 AAAGCTAGCCTTGAGCAGACAGG - Intronic
928194455 2:29205051-29205073 AGAGGTGGCCTCAAGGAGATAGG - Intronic
928641369 2:33303253-33303275 AAAACTGGCTTCCACGAAACTGG - Intronic
931226176 2:60333969-60333991 AAAGAGGGGCTCCAGGAGAAGGG + Intergenic
932792048 2:74662314-74662336 AAAGCAGGCCTCCTGAGGACTGG - Intronic
933878683 2:86646080-86646102 AAGGCTGTCCTGCAGGAGAATGG - Intronic
934675492 2:96246835-96246857 GAAGATGGCCACCAGCAGACTGG - Intergenic
934920715 2:98343058-98343080 AAAGCTGACCTGAAAGAGACAGG + Intronic
936098374 2:109552211-109552233 AAAACTGTCTTCCAGGAAACGGG + Intronic
936376639 2:111946868-111946890 AAAGCTGGCTTAAAGTAGACTGG + Intronic
937957465 2:127429460-127429482 ACAGCTGTCCTCCAGGACAGTGG - Intergenic
938066610 2:128285042-128285064 ACCTCTGGCCTCCAGGAAACAGG + Intronic
943768344 2:191687896-191687918 AAAACTGTCTTCCAGGAGACTGG - Intronic
944884277 2:204047196-204047218 AAACCTGTCTTCCAGGAAACCGG - Intergenic
944907996 2:204282013-204282035 AAGGCTGTCCACCAGGAGCCAGG + Intergenic
945176505 2:207048812-207048834 CAACCTGGCCTCCAGGAGATAGG + Intergenic
946459035 2:219852502-219852524 AAAGCTGAGATCCAGGAGAGAGG + Intergenic
947166588 2:227268389-227268411 AAAGCAGCCCCCTAGGAGACAGG - Intronic
947525979 2:230877019-230877041 AGACCTAGCCTCCATGAGACAGG - Intronic
947744174 2:232499192-232499214 CAAGCTGGCCTCCATCTGACTGG - Intergenic
948044830 2:234935657-234935679 AAAGCTGGCCTCCATAAGTATGG - Intergenic
948654702 2:239469375-239469397 AAAGTTGTCCTCCATGAAACCGG - Intergenic
948827612 2:240580398-240580420 GAAGCTGGCCGCTAGGAGAGGGG - Exonic
948839655 2:240642680-240642702 CAGGCTGGCCTCCAGGAGACAGG - Intergenic
1168801867 20:648647-648669 ACACCTGGCCTCCAGCAGGCTGG - Exonic
1168930710 20:1621057-1621079 AAAGCTGGGTTCCAGAAGTCCGG - Intergenic
1169075789 20:2759206-2759228 AAGGCTGGCTGCCAGGGGACAGG - Intronic
1169778010 20:9277067-9277089 GAAGCTGGCTTCCAGGAACCTGG - Intronic
1172652650 20:36515005-36515027 GAAACTGGCATCCAGGAGAGAGG + Intronic
1173471253 20:43325194-43325216 AAAGCTGACCTTCAGGAAAGAGG + Intergenic
1174056133 20:47799900-47799922 CAGGCTGCCCTCCATGAGACAGG + Intergenic
1175503822 20:59468333-59468355 AAATCAGGCCTCCTGGAGGCAGG + Intergenic
1175587006 20:60149054-60149076 AAGGCTGTCTTCCAGTAGACAGG + Intergenic
1179058209 21:37955305-37955327 AAAACTGTCTTCCAGGAAACTGG - Intronic
1179108159 21:38422081-38422103 AAATCAGGCCAACAGGAGACTGG + Intronic
1179439447 21:41382753-41382775 AGAGTTGGACTCCAGGGGACTGG + Intronic
1182361372 22:29748374-29748396 AGAGCAGGGCTCCAGGAGCCTGG + Intronic
1182718503 22:32378620-32378642 CTGGCTGGCCTCCAGGAGGCTGG + Intronic
1183248504 22:36711706-36711728 AATGCTGGCCTGCATCAGACTGG - Intergenic
1183579843 22:38717447-38717469 AGAGGTGGCCTCCTGGAGCCTGG + Intronic
1184342863 22:43895662-43895684 AAAGGTGGAGTCCAGGAGGCAGG - Intergenic
1184886864 22:47351910-47351932 GAAGCTGGCCTGGAGGAGACAGG - Intergenic
1184901281 22:47448087-47448109 AATGCTGTCCACCAGGAGAAGGG - Intergenic
949207153 3:1453958-1453980 AAAACTGTCTTCCATGAGACTGG - Intergenic
950573617 3:13817505-13817527 AAAGCTGTCCTCCAGCAGGCTGG - Exonic
951066184 3:18268334-18268356 AAATCTTGCCTCTAGGAGCCAGG - Intronic
951091477 3:18578601-18578623 AAGTCTGTCCTCCAGGTGACGGG - Intergenic
952715495 3:36476030-36476052 CATGCAGGCCTCCAGGAGTCAGG + Intronic
954405100 3:50341107-50341129 AAAGCTGGCCTCCAGAAACACGG - Exonic
954615027 3:51965062-51965084 CAGGCTGGGCTCCAGGAGAAAGG + Intronic
954842343 3:53522960-53522982 AAAGCTGATCTCATGGAGACAGG - Intronic
954870587 3:53764680-53764702 AAAGCTGGGCCACAGGGGACAGG - Intronic
955716620 3:61836456-61836478 AAAGCTGGCCTCCAGGAGACAGG - Intronic
958039808 3:88213243-88213265 ACAGATGGCCTTCAGGAGAGAGG - Intergenic
958073230 3:88641449-88641471 AAAGCTGGCCAGCAGCAGGCAGG - Intergenic
960156993 3:114306231-114306253 AAGGCAGGCCTCCAGGTGAGTGG + Intronic
961020175 3:123498667-123498689 AAAGCTGTCTTCCATGAAACCGG + Intronic
966560668 3:181316549-181316571 AAAGCTGGCCTTCAAGATATAGG - Intergenic
969029319 4:4198653-4198675 CAAGCAGGCATGCAGGAGACAGG + Intronic
971587123 4:28418375-28418397 AAAACTGGCTTCCATGAAACTGG - Intergenic
972089199 4:35258385-35258407 AAAGCAGGCCTCCAGGATCAGGG + Intergenic
972089283 4:35259621-35259643 AAAGCAGGCCTCCAGGAACTGGG - Intergenic
973060590 4:45719055-45719077 AAATATGGGCTCCAGGAGTCTGG - Intergenic
975096241 4:70460619-70460641 AAAGATGGCCCCCAGGACAAAGG - Intronic
975577361 4:75876375-75876397 CAAGCAGGCCTCCTGGTGACCGG - Exonic
976413364 4:84742790-84742812 AAAACTGTCCTCCATGAAACTGG + Intronic
976445658 4:85127826-85127848 AGAGCTGGCCTGCTGGGGACAGG - Intergenic
977828717 4:101564691-101564713 AAAGATGGCAGCTAGGAGACAGG + Intronic
980823828 4:138050589-138050611 AAAACTGTCTTCCAGGAGACTGG - Intergenic
982324850 4:154119757-154119779 AAAGCTGGCACCCCAGAGACTGG + Intergenic
983742508 4:171152977-171152999 ACTGCTGGCATCCAAGAGACTGG - Intergenic
984708035 4:182862191-182862213 ACAGCGGCTCTCCAGGAGACGGG - Intergenic
984881353 4:184412495-184412517 AAATCTGGCTTCAAAGAGACTGG - Intronic
985671043 5:1206825-1206847 AAAGGTGGCCCCCAGGAGACAGG + Intronic
985918405 5:2946148-2946170 AGTGCTGGTCTCCAGGTGACGGG + Intergenic
987315038 5:16716130-16716152 AAAGTTTGCATCCTGGAGACAGG + Intronic
987582042 5:19806499-19806521 AAAACTGGGCTCTAGGAGGCTGG + Intronic
989213990 5:38884850-38884872 GAACCAGGCATCCAGGAGACTGG - Intronic
989354339 5:40525558-40525580 ATAACTGGCCTCCAGGAGCTCGG + Intergenic
991210230 5:64096032-64096054 GCAGCTGGCCTCTAGAAGACAGG - Intergenic
992411613 5:76510814-76510836 ACACCTGGCCTCCAGCAGGCTGG + Intronic
993361717 5:86985016-86985038 AAGGCTGTCCCCCAGGAGGCAGG - Intergenic
994732621 5:103511220-103511242 ATAGCTGACCTACAGCAGACAGG - Intergenic
995301553 5:110590585-110590607 AAAACTGCCTTCCAGGAAACTGG + Intronic
997294279 5:132760141-132760163 AACACTGGCCTCCTGGAGACTGG - Intronic
998214345 5:140226024-140226046 AAAGCAGGCCTCTTGTAGACAGG - Intronic
999286577 5:150397860-150397882 TGAGCTGGCCTCCAGGGGGCAGG + Intronic
999394780 5:151220615-151220637 AAAGCTGGGCCTCAGGTGACAGG - Intronic
999400266 5:151258874-151258896 ATAGGTGGCCTCCAGGGGGCTGG + Intronic
999623400 5:153494650-153494672 AAAGGTGGCCTCAAGAAGAAGGG + Intronic
1000915357 5:167074875-167074897 GAAGCTGGCCTCCAAGACACTGG - Intergenic
1002105008 5:176875699-176875721 GCAGCTGGCCTGCAGGGGACAGG - Intronic
1002431913 5:179208742-179208764 AAAGGGGGCTTCCAGGACACTGG - Intronic
1002630897 5:180576992-180577014 AAAGCTGTACTTCAGGAGATTGG - Exonic
1003145962 6:3511023-3511045 GAAGCCAGCCTCCAGGAGTCTGG + Intergenic
1004321254 6:14633386-14633408 ACAGCAGGCCTCCCGGGGACTGG - Intergenic
1006358698 6:33575585-33575607 AGTGCTGGGCTCCAGGAGAAGGG + Intronic
1006426269 6:33965025-33965047 AAAGCTGGCACGCAGGAGCCTGG + Intergenic
1007308194 6:40923532-40923554 AGACCTGGCCTACAGGAGGCGGG - Intergenic
1013421673 6:109972726-109972748 AACTCTGGCCTCCAGGACACTGG - Intergenic
1014328477 6:120029081-120029103 AAAACTGCCATCCAGGAGCCAGG - Intergenic
1015519148 6:134114219-134114241 CAAGATAGCCTCCATGAGACAGG - Intergenic
1015578750 6:134701345-134701367 AAAGATGCCATCCAGGAGCCAGG + Intergenic
1016868352 6:148791770-148791792 AAAGCTAACCTCCAGGATCCTGG - Intronic
1017395170 6:153990509-153990531 AAGGCTGGGATCCAGGACACAGG - Intergenic
1017926236 6:158913837-158913859 GGAGCTGGCCCCAAGGAGACAGG - Intergenic
1018900046 6:168046480-168046502 AAAGCTGGACCCCAGCAGCCTGG - Intergenic
1018908673 6:168089479-168089501 GGAGCTGACCTCCAGGACACAGG + Intergenic
1019910945 7:4100297-4100319 AGACATGGCCTCCAGGAGAAGGG + Intronic
1021448731 7:20761052-20761074 AAAACTGTCTTCCAGGAAACTGG + Intronic
1023980361 7:45066206-45066228 GAAGATGGCCCCCAGGACACAGG - Intronic
1024652197 7:51413811-51413833 AACGCTGGCCTCCAGAAAAGAGG - Intergenic
1025037372 7:55604426-55604448 AACGCTGGCCTCCAGAAAAGAGG - Intergenic
1025313563 7:57985916-57985938 AAAGCTGTCCTTCAGAAGAACGG + Intergenic
1026867723 7:73833641-73833663 AAGGCTGCCCTCCAGGTGAAAGG - Intergenic
1026996001 7:74617199-74617221 GCAGCAGGCATCCAGGAGACCGG + Intergenic
1029314488 7:99699204-99699226 AATGCTAGCCTCCCAGAGACGGG + Intronic
1029320129 7:99751664-99751686 AATGCTAGCCTCCCAGAGACGGG + Intergenic
1030685724 7:112485223-112485245 AGAGCTGGACTCCTGGAGGCTGG + Intronic
1031063985 7:117084293-117084315 AGAGATGGCATCTAGGAGACAGG + Intronic
1031842942 7:126768613-126768635 GAAGCTCACCTCCAGAAGACAGG - Intronic
1033405737 7:141070939-141070961 AAAGCTGGAAACCAGGAGACTGG + Intergenic
1035167905 7:157002612-157002634 AAGGCTGGGTTCCAGGGGACAGG + Intronic
1035986059 8:4433295-4433317 AAAACTGGCTTCCACGAAACTGG + Intronic
1038885813 8:31661944-31661966 AAAGATGGCCTTTAAGAGACTGG - Intronic
1039480961 8:37872942-37872964 AAAGCTGGCCTCTCGTAGACAGG - Exonic
1040065730 8:43141983-43142005 AAACATGGGCTCCAGGTGACAGG - Intronic
1040861399 8:52002819-52002841 AAAGCTGGTCTAGAGGAGACAGG - Intergenic
1044701654 8:94970620-94970642 AATGCTGAACACCAGGAGACTGG + Intronic
1046638803 8:116702842-116702864 AAAATTGTCCTCCAGGAAACTGG - Intronic
1047185031 8:122625132-122625154 AAGGCTGACATCTAGGAGACTGG - Intergenic
1047539537 8:125751315-125751337 AGAGCTGGACTCCAGTTGACTGG - Intergenic
1047713739 8:127576668-127576690 AAAGCTGGCCGTCAGGGAACTGG - Intergenic
1047810688 8:128405576-128405598 CAAGCTGGACTTCAGGAGCCTGG + Intergenic
1048067632 8:130986588-130986610 AAAGCAAGCCTCCTGGAGAAAGG + Intronic
1048269908 8:133020318-133020340 GTACCTGGCCTCCAGGTGACAGG + Intronic
1048939392 8:139385211-139385233 AGAGCTGAGGTCCAGGAGACAGG - Intergenic
1049781322 8:144430272-144430294 AAGGCTGGGCTCCATGAGGCTGG - Intronic
1050205446 9:3191561-3191583 AAAGCTAACCTCCAGGATAATGG + Intergenic
1051334248 9:16052317-16052339 AAAGCTGGCCTCACGCAGTCTGG + Intronic
1055845736 9:80560727-80560749 AATGTGGGCCTCCAGAAGACAGG - Intergenic
1056607089 9:88095026-88095048 AAATTTGACCCCCAGGAGACAGG + Intergenic
1056966566 9:91167421-91167443 AGAGATGCCCTCCAGGAAACTGG - Intergenic
1057230659 9:93319589-93319611 AAACCAAGCCTCCTGGAGACAGG - Intronic
1057273784 9:93665569-93665591 CAGGATGGCCTCCAGGAGGCAGG - Intronic
1059898162 9:118891643-118891665 AAAACTGTCTTCCAGGAAACTGG + Intergenic
1060503316 9:124179587-124179609 AAAGCTGTCTTCCATGAAACCGG + Intergenic
1060822999 9:126672146-126672168 CAGGATGGCCTCCAGCAGACAGG - Intronic
1060874378 9:127070049-127070071 AAAACTGTCTTCCAGGAAACTGG - Intronic
1060895430 9:127213946-127213968 AAAGGGAGCCTCCAGGAGCCTGG + Intronic
1061780155 9:132991093-132991115 GAGGCTGGCCTCCAGGTGACAGG - Exonic
1061821987 9:133234018-133234040 AGCGCCAGCCTCCAGGAGACGGG - Intergenic
1062237311 9:135516495-135516517 AGCGCCAGCCTCCAGGAGACGGG + Intergenic
1186326621 X:8484590-8484612 AAAGCTGACCAGCAGGACACTGG + Intergenic
1186514540 X:10156801-10156823 AAACCCGGCGTCCCGGAGACAGG - Intergenic
1188741660 X:33790775-33790797 AAAACTGGCTTCCACGAAACTGG + Intergenic
1189233864 X:39472911-39472933 AGAGCCAGCCTCCGGGAGACTGG + Intergenic
1189382628 X:40512770-40512792 AAAGCTGTCTTCCATGAAACTGG + Intergenic
1194660007 X:96620620-96620642 AAAGCGGGAATCCAGGAGGCAGG + Intergenic
1197766682 X:130063819-130063841 CAAGCTGGACTTCGGGAGACGGG + Intergenic
1198024977 X:132696060-132696082 AATGCTGGCCTCCAGGAAGCTGG + Intronic
1200256702 X:154586188-154586210 AGAGCTGGCCCGCAGGAGCCTGG + Exonic
1200261067 X:154618215-154618237 AGAGCTGGCCCGCAGGAGCCTGG - Exonic
1202378883 Y:24259851-24259873 AATGGTGGCCTCCAAGAGTCTGG - Intergenic
1202491899 Y:25410270-25410292 AATGGTGGCCTCCAAGAGTCTGG + Intergenic