ID: 955719836

View in Genome Browser
Species Human (GRCh38)
Location 3:61869019-61869041
Sequence TTCATAAAGCATTAGGAGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 202}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955719832_955719836 -8 Left 955719832 3:61869004-61869026 CCATAGTTTCCACGCTTCATAAA 0: 1
1: 0
2: 1
3: 4
4: 133
Right 955719836 3:61869019-61869041 TTCATAAAGCATTAGGAGGACGG 0: 1
1: 0
2: 1
3: 20
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955719836 Original CRISPR TTCATAAAGCATTAGGAGGA CGG Intronic
903294987 1:22338024-22338046 TTCCCAAAGCACTAGGAGGATGG - Intergenic
905533890 1:38703439-38703461 ATCATAAAACATTAGCAGGTTGG - Intergenic
905708034 1:40077016-40077038 ATCATAAAGCTGTAGGAAGAAGG + Intronic
910083095 1:83365265-83365287 TTTTTAAAAAATTAGGAGGAAGG + Intergenic
910090631 1:83458934-83458956 TTCATAAAGACTTAGGTGTATGG + Intergenic
912962901 1:114211696-114211718 ATGATAATGCATTAGGTGGATGG - Intergenic
913100953 1:115564964-115564986 TATAAAAAACATTAGGAGGAAGG + Intergenic
913380005 1:118200124-118200146 TACGAAAAGCATGAGGAGGAAGG + Intergenic
915027072 1:152841179-152841201 TGCACTAAGCATTAGCAGGAAGG - Intergenic
917711546 1:177689982-177690004 TTCATAAAACTCTATGAGGAAGG + Intergenic
919684185 1:200466705-200466727 TTTATACAGGATTAGGAGGCTGG - Intergenic
919974077 1:202599561-202599583 TTCCTGAAGCATTGGGTGGAGGG + Intronic
922850149 1:228726083-228726105 ATAATAAAACATAAGGAGGAAGG - Intergenic
1064486272 10:15794146-15794168 TTCTAAAAGCATTCTGAGGAGGG + Intronic
1064768458 10:18698711-18698733 TACAAGCAGCATTAGGAGGATGG - Intergenic
1066381711 10:34907273-34907295 TTTATAAAGAGTTAGGAGGCTGG + Intergenic
1068049392 10:51930081-51930103 TTCATTCAGCCTTAGAAGGAAGG - Intronic
1070644137 10:78189708-78189730 ATCATGGAGCATTAGGAGGAGGG + Intergenic
1071588899 10:86852803-86852825 TTCACAAAGCCATATGAGGAGGG + Intronic
1072568945 10:96641917-96641939 TTCATAAAGAAGTAGGATAAAGG - Intronic
1075175664 10:120158337-120158359 TTCATCAAACATTATGAGAAGGG - Intergenic
1075330091 10:121567611-121567633 TTGCTTAAGCATTAGGAAGAAGG + Intronic
1079134764 11:17770223-17770245 CTCATAGATCATTTGGAGGAGGG - Intronic
1080232729 11:30035729-30035751 CTCATATGGCAGTAGGAGGAAGG - Intergenic
1080711371 11:34751014-34751036 TCCATAAGACATTAGGAGAAGGG + Intergenic
1081169969 11:39855550-39855572 TTCAAAAATCATTAGAATGAGGG + Intergenic
1082163334 11:48908852-48908874 TTGATAAGGCATAAGGAAGAGGG - Intergenic
1083108885 11:60385750-60385772 TTCATGAGCCATTAGGTGGAAGG - Intronic
1086222757 11:84469356-84469378 TCCATAAAACATTAGGCTGATGG + Intronic
1086448519 11:86892650-86892672 CTTATAAAGCCTTAGGAGGTGGG - Intronic
1087155865 11:94902482-94902504 TTCATAAAACTTGAGGAGGAGGG + Intergenic
1088793318 11:113245737-113245759 TTCCTATGGCATAAGGAGGAGGG - Intronic
1093995560 12:25637829-25637851 ATCATTAATCATTAGGAGAATGG + Intronic
1095663879 12:44771666-44771688 TAAACAAAGCATTGGGAGGAGGG - Intronic
1095820105 12:46468708-46468730 TTCAAGAAGGATTGGGAGGATGG - Intergenic
1099555479 12:84104092-84104114 GCCATAAAGCATTAGGAGTTAGG + Intergenic
1100343760 12:93707178-93707200 TTTATAAATGATTGGGAGGAAGG + Intronic
1100469202 12:94874559-94874581 TTCATAAAGCTTTCCGAGGAGGG + Intergenic
1102135874 12:110574372-110574394 TATATAAAGCACTAGAAGGATGG + Intronic
1106390223 13:29328382-29328404 ATCATAAATCAATATGAGGAAGG + Intronic
1106997147 13:35498519-35498541 TTCTTAAAGCACTAGGAGAGTGG + Intronic
1107195801 13:37649866-37649888 TTCATAAATTAGTATGAGGATGG + Intronic
1107752975 13:43589019-43589041 TTCATAAAACATTTGCATGATGG + Intronic
1108257755 13:48627222-48627244 TTCACAAACCATTGGGAGGATGG + Intergenic
1108346489 13:49551602-49551624 TTAAAAAAGCATTAGAAGGCCGG + Intronic
1108470361 13:50761249-50761271 TTTATAGAGCTTTAGCAGGAAGG + Intronic
1109018428 13:57051541-57051563 TTCAAAAATATTTAGGAGGAGGG + Intergenic
1110228226 13:73142111-73142133 ATCAGACAGCATTAGGAGTATGG + Intergenic
1110271104 13:73591973-73591995 GTCATAAAGAATTAAGAGGCCGG - Intergenic
1111722154 13:91959500-91959522 TTCCAAAAACATGAGGAGGAAGG + Intronic
1111857256 13:93654121-93654143 ATCATTCAGCATTAGAAGGAGGG - Intronic
1116966593 14:51021616-51021638 TTGATATGGCATTAGGATGAAGG - Intronic
1118077912 14:62322247-62322269 TTCTGAAAGAATTATGAGGATGG - Intergenic
1119080243 14:71686062-71686084 TTAATAAAGGATTATGCGGAAGG + Intronic
1119333264 14:73811359-73811381 GACATAAAGCAAGAGGAGGATGG - Intergenic
1121763346 14:96464201-96464223 TTCAGAAAGCACAAGGGGGAAGG + Intronic
1124113405 15:26814923-26814945 TTCTTAAAGCTTCAGGGGGAGGG + Intronic
1124713539 15:32034820-32034842 TTCATGAAGCACTAGGCAGAGGG + Intronic
1125282562 15:38058235-38058257 TTCATAAAACATAAGGGGCATGG - Intergenic
1125720452 15:41842688-41842710 TTCAGAGAGCATGAGGATGAGGG - Intronic
1127530481 15:59838905-59838927 TTCATAGAGCAATAAGAAGAAGG + Intergenic
1131804862 15:96110610-96110632 TTCAAAAAACATCAGGCGGAGGG - Intergenic
1131959815 15:97777526-97777548 TTCCAAAACCATAAGGAGGAGGG + Intergenic
1133615039 16:7468510-7468532 TTCATAGAGAAATAGAAGGAAGG - Intronic
1134863688 16:17585121-17585143 TTCATAAAGTATTTGGGGGAAGG + Intergenic
1137659672 16:50193755-50193777 TTCCTGAAGGATGAGGAGGAGGG + Intronic
1138164370 16:54786617-54786639 TTCTTAAAACATTATGAGGTGGG - Intergenic
1139152726 16:64403317-64403339 TTACTAAAGAAGTAGGAGGAGGG + Intergenic
1140973571 16:80037529-80037551 TTGATCAAGAATTAGGAGAAGGG + Intergenic
1144605313 17:16659465-16659487 TTCATAAGGCATGAGGAGAGGGG + Intergenic
1146070565 17:29677253-29677275 TTCTAAAAACATTAGGAGGTAGG + Intronic
1146268110 17:31466393-31466415 CTCATAACACCTTAGGAGGAAGG - Intronic
1147356033 17:39897485-39897507 TTCAGAAAGCAGAGGGAGGAGGG + Intergenic
1147703138 17:42408411-42408433 TTCATGAGGCACTAGGAAGATGG - Intronic
1148972689 17:51498239-51498261 TTCATATAGGAATAGGAGGAAGG + Intergenic
1149600708 17:57891390-57891412 TTCAGAAATCATTTGGAAGACGG - Intronic
1149905521 17:60522980-60523002 ATCGTAAAGCATTAGGAGATGGG - Intronic
1150555047 17:66246882-66246904 TTCAAAAACCATTATGTGGAAGG + Intronic
1151544444 17:74784021-74784043 TTTTTAAAGCATGAAGAGGACGG - Intronic
1155158247 18:23176050-23176072 TTCATAGAGCAGGTGGAGGAAGG + Intronic
1156615077 18:38773206-38773228 TTCAGAAGGCATTAAGAAGAAGG - Intergenic
1156842108 18:41621154-41621176 TTCATAAAGCTGTCTGAGGAAGG - Intergenic
1157112111 18:44830945-44830967 TCCACAAAGCATTGGGAGGATGG + Intronic
1158666360 18:59436359-59436381 TTGATAAAGCGTTAGGAGGGAGG - Intronic
1159167285 18:64720408-64720430 TTCATAAAGATTTAGGAGTTAGG - Intergenic
1159304754 18:66626299-66626321 TTCATAAAGCAACATGAGAATGG + Intergenic
1160121836 18:76137434-76137456 TTCATAGAGGCTTGGGAGGAGGG + Intergenic
1161455791 19:4369197-4369219 TGCTGAAGGCATTAGGAGGAAGG + Intronic
1162312537 19:9915433-9915455 TACATAAGATATTAGGAGGAAGG + Intronic
1164378105 19:27707272-27707294 TCCATAAAGCATTAGGAGTTAGG + Intergenic
1164695020 19:30236921-30236943 TTCAGGAAGCATTTGGAAGATGG - Intronic
1164938813 19:32235480-32235502 TTAATATTGCATTAGTAGGAAGG + Intergenic
1165536215 19:36448020-36448042 CTCACAAAGCATTATGAGGTAGG + Exonic
926766991 2:16330544-16330566 TTCCTAAAGCAGAAGGAGGTGGG - Intergenic
927996359 2:27489572-27489594 AACATAAAGCATAAGGGGGAGGG + Intronic
931821411 2:65955849-65955871 TCAATAAAGCATTTGGAGGTGGG + Intergenic
932537942 2:72619495-72619517 TTTAAAAAGAATGAGGAGGAGGG + Intronic
939895272 2:147784089-147784111 TTTTGAAAGCATTAGAAGGATGG + Intergenic
939896987 2:147803532-147803554 CTCATAAAGTATTAGGAATATGG - Intergenic
941208691 2:162608531-162608553 TTTATTTAGCATTAGGAGAAAGG + Intronic
942476258 2:176325784-176325806 TTTATAAAGCAGTAGAAGGAAGG + Intronic
944353345 2:198756359-198756381 TTCAAAACGCATTAGCAGTATGG + Intergenic
945020570 2:205566994-205567016 TCCATGAAGCATAAGGATGAGGG + Intronic
946151370 2:217774086-217774108 TTCCTAAAGCAGTAGGTGAAAGG + Intergenic
947291403 2:228578877-228578899 CTGATAAAGAATTAGGATGACGG - Intergenic
1169390700 20:5188578-5188600 TTCATAAAGAGTTACGAGGTTGG + Intronic
1169802569 20:9525748-9525770 TTAACAAAGCTTCAGGAGGAAGG - Intronic
1171050422 20:21853366-21853388 TTCATAAATCATGAGGTGGTAGG - Intergenic
1174507986 20:51029192-51029214 TTGATAAAGGCTTAGGATGAGGG - Intergenic
1177382185 21:20359193-20359215 TTCATACAGCATTTGGAGAAAGG - Intergenic
1178445351 21:32635784-32635806 TTCATAATGTATTAGTTGGAAGG + Intronic
1184302598 22:43570993-43571015 TTAACAAAGCAGTATGAGGAAGG + Intronic
952038769 3:29236020-29236042 TTCATAAAACACTAGAAGAATGG - Intergenic
952854002 3:37752602-37752624 TCCATAGAGCATAATGAGGATGG + Intronic
953461189 3:43082373-43082395 TTCAGAATCCCTTAGGAGGAGGG + Intronic
954123168 3:48512422-48512444 ATCATAAGGAATTGGGAGGAGGG - Intergenic
954858571 3:53667894-53667916 TTCATAAAGAGGAAGGAGGAAGG + Intronic
955545201 3:60020738-60020760 TTCACAAAACAATAGCAGGATGG + Intronic
955719836 3:61869019-61869041 TTCATAAAGCATTAGGAGGACGG + Intronic
956530817 3:70216664-70216686 TTCAATAAGCTTTAGGATGAAGG - Intergenic
960009219 3:112815034-112815056 TTTATATAGCAGTGGGAGGATGG + Intronic
960462842 3:117958248-117958270 TTCATAAATGATTTGGAAGAGGG - Intergenic
964588186 3:158330356-158330378 TTCATAGAACATTAGCAAGATGG - Intronic
966248490 3:177835234-177835256 GCCATAAAGCATTGGGAGAATGG + Intergenic
967159752 3:186725217-186725239 TTCATTAAGCATGAAGAGGGAGG - Exonic
967466992 3:189819016-189819038 TGAATAAAGCATTTGGAAGACGG + Intronic
969148895 4:5151357-5151379 TTCATTCAATATTAGGAGGATGG - Intronic
970153379 4:13115406-13115428 TCCATACAGCATTTGGAGGAAGG - Intergenic
973020455 4:45199242-45199264 TTCAGAAACCATGAGGATGAAGG - Intergenic
973031862 4:45353671-45353693 TGAATAAAGCATCAGAAGGATGG + Intergenic
973940426 4:55904088-55904110 TTCTCACAGCATTATGAGGAAGG + Intronic
975409489 4:74032788-74032810 TGCACAAAGTATTAGGAGTAAGG + Intergenic
975712715 4:77176536-77176558 TTCCTAAAGAATTCAGAGGAAGG + Intronic
977379857 4:96258624-96258646 TTCCTAAAGCATTATTATGATGG + Intergenic
977954614 4:103012240-103012262 TTCACAAAGCATTAGGACACAGG + Intronic
978318392 4:107465531-107465553 TTAATACAGTATTAGGAGGTGGG + Intergenic
978913037 4:114088029-114088051 TTCATAAATCATTAGCAGAGAGG - Intergenic
980180507 4:129394686-129394708 TTCAGAAATCATTAGTTGGAAGG + Intergenic
982832467 4:160080520-160080542 TTCATCAAGTATTAGAATGAAGG - Intergenic
982955162 4:161755607-161755629 TTTATAAAGTATGTGGAGGAAGG + Intronic
984629524 4:182046337-182046359 TTCATAAATCAATAGTAGGGAGG - Intergenic
984745131 4:183207932-183207954 TTCTGAAAACATTAGGTGGAGGG - Exonic
988103615 5:26713624-26713646 TTGATAAAGCACTATGATGAAGG - Intergenic
989155203 5:38338335-38338357 TTCAGAAAACAATAGGATGAGGG - Intronic
989318522 5:40108936-40108958 GCCATAAAGCATTAGGAGTTAGG - Intergenic
989711567 5:44403892-44403914 TTCAAAAAGCAGTAGTAGGCTGG + Intergenic
990012487 5:51017092-51017114 TTCATAAAACATTTGGAGAGTGG + Intergenic
992300683 5:75376338-75376360 ATCATAAAGCATCAAGAGGGAGG + Intronic
994932845 5:106211435-106211457 TTCATCAAAGAATAGGAGGATGG + Intergenic
996752101 5:126899188-126899210 TCCATGAAGAATGAGGAGGACGG + Intronic
996767282 5:127047183-127047205 TTCATAAGGCATTAGCTTGAAGG + Exonic
997073973 5:130650093-130650115 TTCCAAAAGCAATAGAAGGAAGG - Intergenic
999528304 5:152433017-152433039 TACACAAAGTGTTAGGAGGATGG + Intronic
1000316404 5:160096614-160096636 TTTATAAATCAGTAAGAGGAAGG - Intronic
1001004262 5:168036155-168036177 ATCATAAGCCATAAGGAGGAGGG + Intronic
1003290967 6:4777190-4777212 TTGATAAAGCATTTGGGAGAGGG + Intronic
1004877679 6:19972149-19972171 TTCATGAACCATTAGGAAGGGGG - Intergenic
1004940152 6:20547811-20547833 TTAATAATGCTTTAGGATGACGG + Intronic
1005353228 6:24957571-24957593 TTCCTAAAGAATGAGAAGGAGGG + Intronic
1005895649 6:30175241-30175263 TACAAAAAGCATTAGGGGCAAGG - Intergenic
1005942937 6:30574575-30574597 TCCTAAAGGCATTAGGAGGAAGG - Intronic
1007220580 6:40275742-40275764 TTTAGATAGCCTTAGGAGGAGGG - Intergenic
1007883644 6:45198428-45198450 ATAACAAAGTATTAGGAGGAAGG - Intronic
1008961206 6:57268101-57268123 TTCCTAAAGTATTAGGTGGTTGG + Intergenic
1013564101 6:111339914-111339936 TTGACAAAGCATTAGGAGGATGG - Intronic
1013859228 6:114614146-114614168 TTCTTACAGCATTAGGAGGTAGG - Intergenic
1015034667 6:128638761-128638783 TTCAAAATACATTAGGACGAAGG + Intergenic
1015804002 6:137090298-137090320 TTCATATAGCAGAAGGGGGAGGG - Intergenic
1018680964 6:166264413-166264435 TGTATAAAGCATTTGGAGGCAGG + Intergenic
1019496287 7:1341974-1341996 TTCATTAGCCTTTAGGAGGAGGG + Intergenic
1020702644 7:11502243-11502265 TTCCAAAAGGATTAGGAGGAGGG + Intronic
1021461946 7:20898623-20898645 GCCCTAAAGCCTTAGGAGGATGG - Intergenic
1021559277 7:21953412-21953434 TTCAGAAAGAAATAGGGGGAAGG - Intergenic
1021696933 7:23285071-23285093 TTCATACAGCATTAAAATGAAGG - Intergenic
1022002242 7:26236847-26236869 TTCTTATAGCATTATGAGAATGG + Intergenic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1022717755 7:32914224-32914246 TCCATAAAGCATTTAGAGCAGGG - Intergenic
1023588179 7:41752516-41752538 TCCCTAAAGCAAGAGGAGGAAGG + Intergenic
1024605386 7:51018594-51018616 TTCTTAAAACATTATGAGGGTGG + Intronic
1026211645 7:68311228-68311250 TTCATAATGCAGGATGAGGATGG - Intergenic
1026511373 7:71029972-71029994 TTCTTAAAACATTATGAGGTCGG - Intergenic
1027299927 7:76821463-76821485 TTTTTAAAAAATTAGGAGGAAGG + Intergenic
1027307479 7:76915397-76915419 TTCATAAAGACTTAGGTGTATGG + Intergenic
1028333933 7:89628377-89628399 TTCATACAGCATAAAGGGGATGG + Intergenic
1030643933 7:112037959-112037981 ATCATAAAAAATTAGGAGGTTGG - Intronic
1031478878 7:122254462-122254484 TACATAAAGCATTTGCTGGAAGG - Intergenic
1033931963 7:146534340-146534362 TTCCTAAAGCCTCAGGAGTATGG - Intronic
1036041918 8:5094024-5094046 TTCATAAAGCATTCTGAGATAGG - Intergenic
1037092545 8:14940306-14940328 TGCATAATGCATTAGATGGATGG - Intronic
1037280571 8:17237296-17237318 TTTAAAAAACATGAGGAGGAAGG - Exonic
1037626917 8:20616143-20616165 TTCATAAAGCATTAGGGTAATGG - Intergenic
1039203516 8:35123436-35123458 TTCCTAAAGCATCATGAGGGTGG - Intergenic
1043112787 8:76209047-76209069 TTAATAAAATATTAAGAGGAGGG - Intergenic
1044398175 8:91738571-91738593 TTCAGAAAGCAGTAGTAGGCAGG - Intergenic
1045062698 8:98423096-98423118 TTCTTGATGCATCAGGAGGAAGG + Intronic
1046021692 8:108672865-108672887 ATCATAAAGAATGAGCAGGATGG + Intronic
1047408163 8:124602494-124602516 TTCTTAAACCATTATGAGGCCGG - Intronic
1048915556 8:139179618-139179640 TGCATTGTGCATTAGGAGGATGG - Intergenic
1049508559 8:143016464-143016486 CTCAGAAAGCAGGAGGAGGAGGG + Intergenic
1050137976 9:2488102-2488124 TTCATAAAGCATTATGAATTAGG - Intergenic
1052008441 9:23378256-23378278 TTCAGCAAACATTAGAAGGAAGG - Intergenic
1052443644 9:28531220-28531242 TTGATAAAGCATTACTATGAGGG - Intronic
1052875511 9:33558929-33558951 ATCATAAATCAATATGAGGAAGG + Intronic
1053900070 9:42786955-42786977 TTCATAAAATATTAGGCGGATGG + Intergenic
1054261566 9:62870637-62870659 TTCATAAAATATTAGGCGGATGG - Intergenic
1057352487 9:94311029-94311051 TTCAAAGAACATTAGAAGGAAGG + Intergenic
1057655153 9:96945044-96945066 TTCAAAGAACATTAGAAGGAAGG - Intronic
1057679897 9:97169840-97169862 ATCATAAATCAATATGAGGAAGG - Intergenic
1060290555 9:122298905-122298927 TTCATGAAGTATTCAGAGGAAGG + Intronic
1186169454 X:6861416-6861438 TTTAGAAAGCATTAGGGGAAAGG - Intergenic
1186262543 X:7794828-7794850 TTCATCAGGCATTATTAGGAAGG + Intergenic
1186369107 X:8928412-8928434 TTCAAAAAGCATTAGGGAGGAGG + Intergenic
1188255981 X:27962212-27962234 TTCACAAATAATTAGGAGGCTGG + Intergenic
1188337839 X:28960278-28960300 TTCAAAAAGCATTAGGAAAAGGG + Intronic
1188912751 X:35869956-35869978 TTCATAAAACAATAGAATGATGG - Intergenic
1192560321 X:72123952-72123974 TTCTTAAAGGCTTAGGAGGGTGG - Intergenic
1193242316 X:79185541-79185563 TTCATAAAGAAAAAGTAGGAGGG + Intergenic
1196468507 X:115997168-115997190 TTCAAAAAAAATTAGGAGGAGGG - Intergenic
1196746701 X:119077633-119077655 TTTCTAAAGCAGGAGGAGGAAGG + Intergenic
1198292051 X:135249191-135249213 TGCATGGAGCATCAGGAGGAAGG - Intronic
1199456780 X:148037950-148037972 TCCAGAAAGCATGAGAAGGATGG + Intergenic
1199715771 X:150506418-150506440 TTTATAAAGAATGTGGAGGAAGG - Intronic
1200958283 Y:8972645-8972667 TTCAGAAATCATGAGGAGGCTGG - Intergenic
1201559788 Y:15303708-15303730 TTTAGAAAGCATTAGGGGAAAGG - Intergenic