ID: 955723762

View in Genome Browser
Species Human (GRCh38)
Location 3:61910742-61910764
Sequence GGTTCTGTGGGGAAAGCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 462
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 427}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955723762_955723774 6 Left 955723762 3:61910742-61910764 CCACCTGCTTTCCCCACAGAACC 0: 1
1: 0
2: 1
3: 33
4: 427
Right 955723774 3:61910771-61910793 CTCTGTTCGGTGCAGCCAGGAGG 0: 1
1: 0
2: 0
3: 4
4: 131
955723762_955723776 29 Left 955723762 3:61910742-61910764 CCACCTGCTTTCCCCACAGAACC 0: 1
1: 0
2: 1
3: 33
4: 427
Right 955723776 3:61910794-61910816 AAATCTGAGCAAGCCCCAGACGG 0: 1
1: 0
2: 2
3: 10
4: 181
955723762_955723772 3 Left 955723762 3:61910742-61910764 CCACCTGCTTTCCCCACAGAACC 0: 1
1: 0
2: 1
3: 33
4: 427
Right 955723772 3:61910768-61910790 TGCCTCTGTTCGGTGCAGCCAGG 0: 1
1: 0
2: 0
3: 11
4: 147
955723762_955723767 -7 Left 955723762 3:61910742-61910764 CCACCTGCTTTCCCCACAGAACC 0: 1
1: 0
2: 1
3: 33
4: 427
Right 955723767 3:61910758-61910780 CAGAACCCCCTGCCTCTGTTCGG 0: 1
1: 0
2: 1
3: 15
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955723762 Original CRISPR GGTTCTGTGGGGAAAGCAGG TGG (reversed) Intronic
900032427 1:381188-381210 GGTTCTCTGTGGCCAGCAGGCGG + Intergenic
900032443 1:381256-381278 GGTTCTCTGTGGCCAGCAGGCGG + Intergenic
900032459 1:381324-381346 GGTTCTCTGTGGCCAGCAGGCGG + Intergenic
900032475 1:381392-381414 GGTTCTCTGTGGCCAGCAGGCGG + Intergenic
900032491 1:381460-381482 GGTTCTCTGTGGCCAGCAGGCGG + Intergenic
900032507 1:381528-381550 GGTTCTCTGTGGCCAGCAGGCGG + Intergenic
900032523 1:381596-381618 GGTTCTCTGTGGCCAGCAGGCGG + Intergenic
900052977 1:609374-609396 GGTTCTCTGTGGCCAGCAGGCGG + Intergenic
900052993 1:609442-609464 GGTTCTCTGTGGCCAGCAGGCGG + Intergenic
900053009 1:609510-609532 GGTTCTCTGTGGCCAGCAGGCGG + Intergenic
900053025 1:609578-609600 GGTTCTCTGTGGCCAGCAGGCGG + Intergenic
900053039 1:609642-609664 GGTTCTCTGTGGCCAGCAGGCGG + Intergenic
900053055 1:609710-609732 GGTTCTCTGTGGCCAGCAGGCGG + Intergenic
900053071 1:609778-609800 GGTTCTCTGTGGCCAGCAGGCGG + Intergenic
900053087 1:609846-609868 GGTTCTCTGTGGCCAGCAGGCGG + Intergenic
900053103 1:609914-609936 GGTTCTCTGTGGCCAGCAGGCGG + Intergenic
900053119 1:609982-610004 GGTTCTCTGTGGCCAGCAGGCGG + Intergenic
900053135 1:610050-610072 GGTTCTCTGTGGCCAGCAGGCGG + Intergenic
900053149 1:610114-610136 GGTTCTCTGTGGCCAGCAGGCGG + Intergenic
900053165 1:610182-610204 GGTTCTCTGTGGCCAGCAGGCGG + Intergenic
900053181 1:610250-610272 GGTTCTCTGTGGCCAGCAGGCGG + Intergenic
900053197 1:610318-610340 GGTTCTCTGTGGCCAGCAGGCGG + Intergenic
900053213 1:610386-610408 GGTTCTCTGTGGCCAGCAGGCGG + Intergenic
900053229 1:610454-610476 GGTTCTCTGTGGCCAGCAGGCGG + Intergenic
900053245 1:610522-610544 GGTTCTCTGTGGCCAGCAGGCGG + Intergenic
900053261 1:610590-610612 GGTTCTCTGTGGCCAGCAGGCGG + Intergenic
900053277 1:610658-610680 GGTTCTCTGTGGCCAGCAGGCGG + Intergenic
900271024 1:1788755-1788777 AGTTCAGAGGGGAAAGCACGGGG + Intronic
900326576 1:2111221-2111243 GGTGCTGTGGGAAAAGAAAGAGG + Intronic
900606112 1:3524289-3524311 GGCTGTGTTGGCAAAGCAGGAGG - Intronic
901027161 1:6284798-6284820 GGTGGGGTGTGGAAAGCAGGGGG - Intronic
901064212 1:6486954-6486976 GGTTCCATGGGGAAAGAGGGTGG + Intronic
901645613 1:10715461-10715483 GGTGCTGTGGGGAGTGGAGGAGG - Intronic
902197103 1:14805836-14805858 GGATCTGGGGGGAAAGGAGGTGG + Intronic
902968908 1:20032505-20032527 TGGTGTGTGGGGAAAGGAGGTGG + Intronic
904401271 1:30258172-30258194 GGTTCTGTGAGTGAAGGAGGAGG - Intergenic
904940721 1:34163868-34163890 GGTGCTGTGGGTAAAGCGGGAGG + Intronic
905323536 1:37134165-37134187 AGGTCTGTCAGGAAAGCAGGAGG - Intergenic
907257551 1:53191273-53191295 GGTCCTGTTGGCATAGCAGGTGG - Intergenic
907538825 1:55193283-55193305 GTATCTGTGGGGAGGGCAGGTGG + Intronic
909326977 1:74363604-74363626 GCTTCATTGGGGAAAGCATGAGG + Intronic
911978813 1:104539383-104539405 GGTTTTGAGGGGAAAAAAGGAGG + Intergenic
912452246 1:109774268-109774290 GGTCCTGAGGGCAAGGCAGGAGG + Intronic
912800753 1:112718683-112718705 GGTGCTGGGGGGAAAGGAGCTGG - Intergenic
913314257 1:117536755-117536777 GCTTCTGTGTGGAAAACAGATGG + Intergenic
913983444 1:143544255-143544277 GGTGCTGCTGGGAAAGCAGTGGG - Intergenic
915036026 1:152926074-152926096 GTGTCTGTGGGGAAATGAGGAGG + Intergenic
915087993 1:153401330-153401352 GGTGCTGTGGAGAAAGGGGGCGG + Intergenic
915518082 1:156424976-156424998 GGATCTGTGGGGGAGGCAGAGGG + Intronic
915544076 1:156586049-156586071 GGTCCTTGGGGGAAAGAAGGAGG + Intronic
918602115 1:186375727-186375749 GGCTCTGCGGGGAAGGGAGGGGG + Intergenic
918931865 1:190864722-190864744 GGTTCTGTAGGGAAGGAATGTGG - Intergenic
920029433 1:203027517-203027539 CGTTCTGTGTGGAGAGCAAGTGG + Intronic
920172742 1:204081866-204081888 GGTAGGGTGGGGAAAGAAGGGGG + Intronic
921260682 1:213383066-213383088 GGCTCTGTGGGGCAAGAAGGAGG - Intergenic
921325302 1:213982715-213982737 GTTGCTGTGGGGACAGCCGGTGG - Intergenic
923136489 1:231124599-231124621 GTGTCTGTGGGGGAAGGAGGAGG + Intergenic
924409427 1:243787912-243787934 GGATCTGAGGGGAATGGAGGTGG - Intronic
1063012724 10:2041222-2041244 GGCACTGTCTGGAAAGCAGGAGG + Intergenic
1063369734 10:5513305-5513327 GGATGTGTGGAGAAGGCAGGAGG - Intergenic
1063839408 10:10052960-10052982 GGTTCAGGTGGGAAACCAGGGGG - Intergenic
1063867335 10:10380110-10380132 GGTTCTGTGGGCTATACAGGAGG + Intergenic
1063968830 10:11367373-11367395 GGGTGGGTGGGGACAGCAGGTGG - Intergenic
1065838898 10:29683811-29683833 GGTTCTCTGGGGCAAGTTGGGGG - Intronic
1067568975 10:47358008-47358030 GATGCTGTGGGGTCAGCAGGTGG + Intergenic
1067778808 10:49182971-49182993 TGTTCTGTGGGGAAAAAAGGTGG + Intronic
1070845153 10:79516001-79516023 GATTTTATGGGGAAAGCAGCTGG + Exonic
1070928644 10:80244307-80244329 GATTTTATGGGGAAAGCAGCTGG - Intergenic
1071786731 10:88909225-88909247 AGTGTTGTGGGGGAAGCAGGAGG + Intronic
1072785064 10:98273677-98273699 AGTTCTGGGGGGAAATGAGGCGG + Intergenic
1074568866 10:114606618-114606640 GGTGCAGTGGGGAAGGAAGGGGG - Intronic
1074813667 10:117128836-117128858 GGTAGTTTGGGGAAAGGAGGAGG - Intronic
1074856673 10:117479082-117479104 GGTTCTGTGGGGGAATGAGAGGG + Intergenic
1075869697 10:125762032-125762054 GGTTGTTGGGGGAAGGCAGGAGG + Intronic
1078643247 11:13115185-13115207 GGCTGTGGGGGGAAAGCAGGTGG + Intergenic
1079402651 11:20118303-20118325 GGTGATGTGGGGGATGCAGGTGG - Exonic
1081567648 11:44269889-44269911 TTTTCTGTGGGGGAAGCTGGGGG + Intronic
1081571416 11:44293808-44293830 GCTCCTGTGGGTAAAGAAGGAGG - Intronic
1083140170 11:60715002-60715024 GGTTCTGTAGGCAGAGCAGATGG - Exonic
1083720547 11:64601599-64601621 TGTTCTCTGGAGAAGGCAGGAGG + Exonic
1083742061 11:64716355-64716377 GGTTCTGTGGGAAAGGCGAGGGG + Intronic
1083886271 11:65574787-65574809 AGTGCTGTGGGGAGAGCCGGCGG - Intergenic
1083929481 11:65833034-65833056 GGGTATTTGGGGAAAGCAAGAGG - Intronic
1084102999 11:66962408-66962430 CTTTCTGTGGAGAAAGCAGCAGG + Intergenic
1085038911 11:73315558-73315580 GGTTCTGGGGGGAAAGGAGGAGG + Intronic
1085459134 11:76682611-76682633 GCTGCTGGGGGGAAGGCAGGGGG + Intergenic
1087273492 11:96137273-96137295 GGTTCTGGGGAGAAATGAGGAGG + Intronic
1087851021 11:103029324-103029346 GGTTGTGAGGGGAAAACAGCTGG - Intergenic
1088669389 11:112126835-112126857 GGTTTTGTAGAGAAAGCAGATGG + Intronic
1089061257 11:115627958-115627980 GTTTCTGTGCGGAAATCTGGGGG - Intergenic
1089495761 11:118908012-118908034 AGCTCTGGTGGGAAAGCAGGAGG + Intronic
1089976030 11:122732197-122732219 GCTTCTGTGGGGGTACCAGGAGG - Intronic
1090854546 11:130599890-130599912 GGTGCTGTGGGGATGGGAGGAGG + Intergenic
1090959882 11:131546787-131546809 GGGTTTGTGAGGAAAGCAGGAGG + Intronic
1091789838 12:3265644-3265666 GGTGGCGTGGGGAAAGGAGGGGG - Intronic
1091889523 12:4042125-4042147 GATTCTGGGGGGAAAGCATGGGG + Intergenic
1096247913 12:50005115-50005137 GATTTTGTGGGGAGAGTAGGTGG - Intronic
1097389815 12:58996424-58996446 GGATCAGTGGGGAAAGAAAGAGG - Intergenic
1097710477 12:62912266-62912288 GGTTGTTTGGGGAATGAAGGTGG - Intronic
1097981923 12:65744139-65744161 GGGGATGAGGGGAAAGCAGGTGG - Intergenic
1098891809 12:76017215-76017237 GGTTCTGTCAGCAAAGAAGGAGG - Intergenic
1100008360 12:89921998-89922020 TGTGCTTTGGGGAAAGAAGGTGG + Intergenic
1100755543 12:97747696-97747718 GGATCTTTAGGGAAGGCAGGGGG - Intergenic
1102181135 12:110913216-110913238 GGGTCTGTGGGGGAGGAAGGGGG - Intronic
1102199925 12:111050146-111050168 GGCTCTGTGGGGGAAGCGGCAGG - Intronic
1103177015 12:118872996-118873018 GCTTTAGTGGGGAAAGCAAGGGG + Intergenic
1103320083 12:120087317-120087339 GTTTCTCTAGGGAAGGCAGGCGG + Intronic
1103397487 12:120619186-120619208 GAATCTGTGGGGAAAGGAGCAGG + Intergenic
1104261905 12:127192133-127192155 TGTTCTGTGTGAACAGCAGGAGG - Intergenic
1104950843 12:132439259-132439281 GGTGGTGTGGGGTGAGCAGGTGG - Intergenic
1105899300 13:24742178-24742200 GGTTCTTTGGAGGAAGAAGGAGG + Intergenic
1108486854 13:50935561-50935583 GGTTGGGTGGGGAATGTAGGTGG + Intronic
1109525230 13:63566493-63566515 GCTTCTGTGGGGAAAGGTGAGGG + Intergenic
1111284407 13:86069451-86069473 GCTTCTGTGCGGCAAGCAGCAGG - Intergenic
1111562833 13:89974459-89974481 GTTTATGTGGTCAAAGCAGGAGG + Intergenic
1113949854 13:114065909-114065931 GACTCAGTGAGGAAAGCAGGCGG + Intronic
1114130064 14:19781041-19781063 GGTAATGTGGGAATAGCAGGTGG - Exonic
1114764446 14:25355101-25355123 GATTCCTTGGGGAAAGGAGGTGG + Intergenic
1116399340 14:44486286-44486308 TCCTCTGTGGGGGAAGCAGGAGG - Intergenic
1117538849 14:56727255-56727277 AGTTCTGGGTTGAAAGCAGGAGG + Intronic
1118550623 14:66945599-66945621 GGTTTTTTGGGGGAAGCAGGTGG - Intronic
1118617209 14:67582215-67582237 GGTTCTGTTCAGGAAGCAGGAGG + Intronic
1118678183 14:68211333-68211355 GTTTCAATGGGGAAAGCGGGTGG - Intronic
1120647269 14:87088973-87088995 GGTTCTCTGGAGGAAGAAGGGGG - Intergenic
1121029261 14:90644109-90644131 GCTTCTGTGCTGACAGCAGGAGG + Exonic
1121107235 14:91289098-91289120 GGGTCTGTGGGGAAAGGTAGGGG - Exonic
1121135325 14:91492678-91492700 GGGTTTGTGGGGAATACAGGTGG - Intronic
1122119803 14:99546210-99546232 GGCTCTGTGGGAAGAGCTGGGGG + Intronic
1122463044 14:101911532-101911554 GGTCCTGTTGGGAAAGCTGTGGG - Intronic
1123573335 15:21638725-21638747 GGTAATGTGGGAATAGCAGGTGG - Exonic
1123609957 15:22081343-22081365 GGTAATGTGGGAATAGCAGGTGG - Intergenic
1124170495 15:27368294-27368316 AGGTGTGTGGGCAAAGCAGGTGG + Intronic
1124259735 15:28178110-28178132 GGTTCTGTTGGTAAGGAAGGGGG - Intronic
1124421502 15:29527065-29527087 AGATCTGGGGGAAAAGCAGGAGG - Intronic
1124531963 15:30516384-30516406 GGTTGTGTGGTGAAAGTAGAGGG + Intergenic
1124766690 15:32491261-32491283 GGTTGTGTGGTGAAAGTAGAGGG - Intergenic
1124801411 15:32836528-32836550 GGTTCTGGGGAGAAAGCATGCGG - Intronic
1125250160 15:37692239-37692261 GTCTCTGATGGGAAAGCAGGAGG + Intergenic
1126427322 15:48542673-48542695 GGTTCCATGGGGAAAACTGGGGG - Intronic
1128330098 15:66750094-66750116 GCTGCTGTGGGGGACGCAGGGGG + Intronic
1129048763 15:72760561-72760583 GGTTCTGTGGGGAAAGGAACGGG - Intronic
1129390981 15:75220864-75220886 GGGGCTGTGGGGCAAGCCGGGGG - Intergenic
1129539926 15:76341115-76341137 GGCTCTGCGGGGCAAGCAGAAGG - Exonic
1130956380 15:88630126-88630148 GGTGCAGTGGGAACAGCAGGAGG + Exonic
1131158030 15:90086977-90086999 GGTCCTCTGTGGACAGCAGGGGG - Intronic
1131403642 15:92145971-92145993 TGTTCTGTGGGGAGAGGGGGAGG + Intronic
1131569638 15:93521809-93521831 GGTCCTGTGGTGGAATCAGGTGG + Intergenic
1132302929 15:100787685-100787707 GGGTGTGTGGGGAAGGCAGCAGG - Intergenic
1202982203 15_KI270727v1_random:373138-373160 GGTAATGTGGGAATAGCAGGTGG - Intergenic
1132519259 16:379899-379921 GGGGCTGTGGGGCAGGCAGGGGG - Intronic
1132664826 16:1076585-1076607 GGCTCTGTGGGGTGGGCAGGGGG - Intergenic
1132833476 16:1941164-1941186 GGAGCTGTGGGGCAAGCAGAGGG + Intronic
1133041957 16:3065596-3065618 GGTTTTATGGGGAAAGTGGGGGG - Exonic
1133729819 16:8569635-8569657 GGATTTGTGGGGGAAGGAGGGGG + Exonic
1134061968 16:11204766-11204788 GGGTCTGTGGGGGAGGCAGTGGG + Intergenic
1134480510 16:14614908-14614930 GGTGGTGTGGGGAAACAAGGAGG + Intronic
1135593256 16:23720693-23720715 GGTTCTGTGGGTCAAGAATGTGG + Intergenic
1135947185 16:26875475-26875497 CTTTCTGTGGGGTAAGCAGCAGG - Intergenic
1136377811 16:29876008-29876030 AGTGCTGTGGGGAGAGCAGTGGG - Intronic
1136517877 16:30778761-30778783 GAGTCAGTGGGGAAAGCAGAGGG - Exonic
1136548324 16:30967630-30967652 GGTTCTGATGGGAGAGCAAGAGG + Intronic
1136656370 16:31711646-31711668 GGTGCTGTGTGGTAAGCAGCAGG - Intergenic
1136710479 16:32233331-32233353 GGCTCTGTGGGGCAGGCTGGGGG + Intergenic
1136757432 16:32696080-32696102 GGCTCTGTGGGGCAGGCTGGGGG - Intergenic
1136810675 16:33174295-33174317 GGCTCTGTGGGGCAGGCTGGGGG + Intergenic
1136817151 16:33284375-33284397 GGCTCTGTGGGGCAGGCTGGGGG + Intronic
1136823715 16:33340906-33340928 GGCTCTGTGGGGCAGGCTGGGGG + Intergenic
1138065181 16:53933486-53933508 TGTTTTGTGGGGGAAGAAGGGGG - Intronic
1138140774 16:54566787-54566809 ATTTCTGTGGGGAAAGTAGGGGG - Intergenic
1138560665 16:57799086-57799108 GGTGGTGTGGGGAATGGAGGGGG + Intronic
1139395514 16:66635602-66635624 GCTGCTGAGGGGGAAGCAGGAGG - Intronic
1139398055 16:66656501-66656523 GGTTCTGTGGGGCATGCCTGTGG - Intronic
1139501655 16:67371303-67371325 GGTTCTGTTGGGAATGGAGGTGG + Intronic
1139505248 16:67395277-67395299 GGGACTGAGGGGGAAGCAGGAGG + Intronic
1139802087 16:69530925-69530947 TTCTCTGTGGGGAAGGCAGGAGG + Intergenic
1140333028 16:74076170-74076192 GGGCCTGTGGGGGAGGCAGGGGG + Intergenic
1141429942 16:83966225-83966247 GGATTTGTGGGGAAAGCTGCTGG + Exonic
1141739893 16:85884171-85884193 GGCTTTGTGGGGGAAGCAGCAGG - Intergenic
1141865890 16:86749479-86749501 GGTTCTGTGGGGACAGCCCCAGG - Intergenic
1142026779 16:87818635-87818657 GGCTCTGTCTGGAAAGCAGTGGG + Intergenic
1203059581 16_KI270728v1_random:956429-956451 GGCTCTGTGGGGCAGGCTGGGGG - Intergenic
1142522868 17:517406-517428 GGTTATGTTGGGAAACAAGGTGG + Exonic
1142550934 17:739056-739078 GGATCTGGGGAGAAAGTAGGAGG - Intronic
1142648303 17:1329449-1329471 GGCTCTATGGGGTCAGCAGGAGG + Intergenic
1143255269 17:5553079-5553101 GGCTCTGTGGAGAAGGCAGGAGG - Intronic
1143275541 17:5707041-5707063 GGTCCTGTGGGGAATGAATGTGG + Intergenic
1143882489 17:10040291-10040313 GGCTGTGGGGGAAAAGCAGGTGG + Intronic
1143885367 17:10061170-10061192 GGTTCAGTGGGGCAACCATGAGG - Intronic
1144703916 17:17355158-17355180 GCAGCTGTGGGGAAAGAAGGGGG + Intergenic
1147581514 17:41629813-41629835 GGTCCTGTGGGGCAGTCAGGAGG - Intergenic
1148255634 17:46129225-46129247 GATTCTGTAGGGAAAGAAGCAGG - Intronic
1148691400 17:49528987-49529009 AGTTCTGCAGGGAAGGCAGGAGG - Intergenic
1149613502 17:57976881-57976903 AATTCTTTGGTGAAAGCAGGTGG - Intronic
1149657458 17:58317937-58317959 GCATCTGTAGTGAAAGCAGGTGG - Intronic
1150132869 17:62678721-62678743 GGTTTTGTTGGGCGAGCAGGGGG + Intronic
1150360375 17:64527489-64527511 AGATCTGTGGGGAGAGCAGAGGG - Intronic
1150657091 17:67046439-67046461 GGATCTCTGGAGCAAGCAGGAGG - Intronic
1152266016 17:79295361-79295383 CGTTTTGTAGGGAGAGCAGGAGG + Intronic
1152947401 17:83205518-83205540 GGTTCTCTGTGGCCAGCAGGCGG - Intergenic
1152947417 17:83205586-83205608 GGTTCTCTGTGGCCAGCAGGCGG - Intergenic
1152947433 17:83205654-83205676 GGTTCTCTGTGGCCAGCAGGCGG - Intergenic
1152947449 17:83205722-83205744 GGTTCTCTGTGGCCAGCAGGCGG - Intergenic
1152947467 17:83205790-83205812 GGTTCTCTGTGGCCAGCAGGCGG - Intergenic
1152947483 17:83205858-83205880 GGTTCTCTGTGGCCAGCAGGCGG - Intergenic
1152947501 17:83205926-83205948 GGTTCTCTGTGGCCAGCAGGCGG - Intergenic
1153111927 18:1601312-1601334 GGTTCTGAGGGTAATACAGGAGG + Intergenic
1153130333 18:1848625-1848647 GGTGCTGTGGAAAACGCAGGGGG - Intergenic
1153772185 18:8425118-8425140 GGTGCTGTGGGGCTGGCAGGTGG - Intergenic
1155089056 18:22488665-22488687 GGATCTCTGGGGAAAGTAGACGG + Intergenic
1155491302 18:26404538-26404560 GGTCCTGTGGGCCATGCAGGAGG + Intergenic
1155821428 18:30382834-30382856 CTTTCTGTGTGGAAAGCAGCAGG - Intergenic
1157436126 18:47670916-47670938 CATTCTCTGGGGAAAGCTGGAGG - Intergenic
1157565908 18:48679170-48679192 TGTTCTGTGTGCAAAGCAGAAGG - Intronic
1160866288 19:1257665-1257687 GGGTCGGGGGGGAAAGGAGGCGG - Exonic
1161654325 19:5504503-5504525 GGTTCTCTGGACAAAGGAGGAGG - Intergenic
1161701801 19:5799967-5799989 GGTCCTGTGGGGACAGCTGCTGG + Intergenic
1162013398 19:7830924-7830946 GGTCCTGTGGGGTCAGCATGGGG - Intronic
1162332552 19:10039112-10039134 GGTTCTGTGGGGATAGGGGGTGG - Intergenic
1162898191 19:13778033-13778055 GGTTCTGAGGGAGAAGCACGGGG - Exonic
1163702207 19:18791500-18791522 GGGTCTGTGGAGAGAGCTGGTGG + Intergenic
1163798301 19:19349624-19349646 GGGTGTGGGGGGAAGGCAGGAGG + Intronic
1164687669 19:30178825-30178847 GGGTCTTTGGGGGAAGCAGGGGG + Intergenic
1165101799 19:33442897-33442919 AGTTCTGTGGGGAGAGCCAGTGG - Intronic
1167371460 19:49085210-49085232 GGTTCGGCGCGGAAAGCGGGAGG + Intergenic
925567733 2:5274376-5274398 GGGACTGTGGGGAAAGCTTGAGG - Intergenic
926002245 2:9343109-9343131 TGTTCTGTGGGGAAAGAAGATGG + Intronic
926634209 2:15163342-15163364 GTTTCTGAGGGAAAAGCAAGTGG + Intergenic
927954758 2:27200686-27200708 GGTTCGGGAGGGAGAGCAGGGGG + Intronic
929274959 2:40015028-40015050 GGTTCTGTTAGGGAAGGAGGAGG + Intergenic
929394087 2:41502028-41502050 GGTTCTGTGGGGAAATGCTGCGG - Intergenic
929631224 2:43464798-43464820 AGTCCTGCGGGGGAAGCAGGAGG - Intronic
931035775 2:58241256-58241278 GGTTCTGGGGCAGAAGCAGGGGG + Exonic
931189314 2:59984260-59984282 GGTTCTATGTGGAAAGCAGTGGG - Intergenic
932344947 2:70989179-70989201 CCTTCTGTGGGGAAAGGTGGAGG + Intronic
932903908 2:75729529-75729551 GGTTTGGTGGGGCAGGCAGGGGG + Intergenic
934674829 2:96242127-96242149 AGTTCTGTGGGGAAGGTATGGGG + Intergenic
934762674 2:96865112-96865134 GGTTCTGTGGGAAGGGGAGGAGG + Exonic
935598919 2:104902163-104902185 GGTTCTGTTGGGCAAGGAGAAGG - Intergenic
935809376 2:106782066-106782088 GGTTTTGTGGGGAAAGATTGGGG + Intergenic
936049848 2:109214344-109214366 GGGGCTGTGGGGGCAGCAGGAGG + Intronic
936061749 2:109299225-109299247 GGTCCTTTGGAGAAAGCAGCAGG - Intronic
936463687 2:112728966-112728988 GCTCCTGTGGGCAAAGCTGGGGG + Intronic
938067444 2:128288895-128288917 GTTGCTGTGGGGTCAGCAGGAGG - Intronic
938250637 2:129813067-129813089 GGTGCCGTGGGGATATCAGGGGG - Intergenic
940660276 2:156536890-156536912 GATTCTGTGGGAAGAGGAGGGGG + Intronic
941958890 2:171233990-171234012 GGTTCTCGGTGGAAAGCAGTTGG - Intergenic
943320481 2:186437143-186437165 GGGTCTGTGGGGACACAAGGTGG + Intergenic
944981161 2:205121639-205121661 GGTTTTGTGGAGGAAGCACGTGG - Exonic
946398275 2:219454259-219454281 GGGTCTGTGCGGAAAGGAGCTGG + Intronic
946444542 2:219727074-219727096 GGTACTCTGGGGAAGGCTGGAGG + Intergenic
946895357 2:224318574-224318596 GGTTGTGCGGGGATAGGAGGAGG - Intergenic
947769436 2:232659390-232659412 AGAGCTGTGGGGGAAGCAGGTGG + Intronic
947959214 2:234221061-234221083 AGATCTGAGGGGAAAGGAGGTGG - Intergenic
948251527 2:236533900-236533922 CTTTGTGTGGGGACAGCAGGAGG + Intergenic
948288951 2:236810112-236810134 GCTTCTGTGTGGCAAGCAGCAGG + Intergenic
1169142328 20:3233573-3233595 AGTTCTGTGGGCGAACCAGGCGG + Exonic
1171303331 20:24083336-24083358 GCTTCAGTGGGGAGAGCATGTGG + Intergenic
1171364940 20:24617227-24617249 GGTTCGGTGGGGACGGCTGGAGG - Intronic
1172162685 20:32879404-32879426 GGTTCAGTGGGCACAGCGGGTGG - Intronic
1172238941 20:33399020-33399042 GAATCTGTGGGGAAAGAGGGTGG + Intronic
1172766208 20:37352395-37352417 TGTTCTGTGGGGAAGGGAGTGGG + Intronic
1173334514 20:42101817-42101839 GGCTCTGTGGGGAATGGAAGAGG + Intronic
1173822610 20:46029071-46029093 GGTTTTGGGGGGAGAGCGGGAGG - Intronic
1173945855 20:46950459-46950481 GGAGCTGTGGGGAAATCATGAGG + Intronic
1174393249 20:50231204-50231226 GGCTGTCTGGGGAAGGCAGGTGG - Intergenic
1174656156 20:52174092-52174114 GGTTCTGTGGTGGGTGCAGGGGG - Intronic
1175330125 20:58157990-58158012 GGATCTGTGGGGACAGCATGTGG - Intronic
1175514798 20:59562201-59562223 GGTTCTGGGGGCCAGGCAGGTGG + Intergenic
1176271955 20:64239946-64239968 GGGTCTCTTCGGAAAGCAGGAGG + Intronic
1176361648 21:6001805-6001827 GGTTCTGTCTGGAAAACATGTGG - Intergenic
1178198135 21:30371959-30371981 GGTTCTGGGGCGGTAGCAGGAGG + Exonic
1178708915 21:34897099-34897121 GGTGCAGTGGGGAAAACAAGAGG - Intronic
1178737084 21:35162006-35162028 AGTGCTGTGAAGAAAGCAGGAGG - Intronic
1179655699 21:42842886-42842908 GATTCTGCAGGGACAGCAGGAGG + Intergenic
1179761870 21:43536745-43536767 GGTTCTGTCTGGAAAACATGTGG + Intronic
1179805481 21:43834506-43834528 GGTTCTTGGGGCACAGCAGGAGG + Intergenic
1179996075 21:44975042-44975064 GCTTCTGAGAGGAGAGCAGGAGG + Intronic
1180022396 21:45136619-45136641 AGTCCTGTGGGGACAGCTGGCGG + Intronic
1180342134 22:11627986-11628008 GGATGCCTGGGGAAAGCAGGGGG - Intergenic
1181286854 22:21758696-21758718 GGTGCAGTGGGGAGACCAGGTGG - Exonic
1181566384 22:23741290-23741312 GATGCAGTGGGGACAGCAGGCGG - Intergenic
1181727244 22:24820113-24820135 GCTTCTCTGGGGATAGAAGGAGG + Intronic
1182741807 22:32573122-32573144 GGCTCTCTGGGGAAAACAGGGGG - Intronic
1183261497 22:36798582-36798604 GGGTCTGTGTGGAATGCAGGAGG - Intergenic
1183362399 22:37389529-37389551 GGTTGTGGGGGCATAGCAGGGGG - Intronic
1183813311 22:40276435-40276457 ACTTCTGTGAGGGAAGCAGGGGG - Intronic
951529691 3:23686816-23686838 AGTGCTGAGGGGAAAGCAGGAGG - Intergenic
951767800 3:26219289-26219311 GGTTTTGTGGAGAAAAAAGGTGG + Intergenic
952207452 3:31194168-31194190 GGTTCAGTGGTGGATGCAGGAGG - Intergenic
952467876 3:33610351-33610373 GTTTCAGTGGGAAAAGAAGGTGG - Intronic
952794026 3:37223193-37223215 GGTCCTGGGGGGTAAGCAGGAGG + Intergenic
954335324 3:49913069-49913091 GGTTCTGGGGATAAGGCAGGAGG - Intronic
954444949 3:50541587-50541609 GGATGGGTGGGGAAAGCAGCTGG - Intergenic
954940668 3:54369479-54369501 GGTCCAGTGGGGACAGCAGCTGG - Intronic
955723762 3:61910742-61910764 GGTTCTGTGGGGAAAGCAGGTGG - Intronic
956464515 3:69505851-69505873 GATCCTGTGGGGAAGGCAGCTGG + Intronic
960186426 3:114646189-114646211 GGGTCTGTGGGTGAAACAGGAGG + Intronic
961099176 3:124183985-124184007 GGTGCTGTGGGGACAGAAGAAGG + Intronic
961502885 3:127350182-127350204 GTTCCTTTGGAGAAAGCAGGGGG + Intergenic
964202687 3:154135646-154135668 GGATCTCTGGGAAAAGCATGTGG + Intronic
965067871 3:163875336-163875358 GGGACTGTGGGGAAAGCATAAGG + Intergenic
967201510 3:187076257-187076279 GGCTCTGGGGGGCAAGTAGGTGG + Exonic
967721418 3:192820103-192820125 GTTTCTGTGGGGAGAGAAAGGGG + Intronic
967775792 3:193384561-193384583 GGGTCTGTGGGGACAGGTGGGGG - Intergenic
968440802 4:623600-623622 GGCTCAGTGTGGAGAGCAGGTGG - Intergenic
968483599 4:848354-848376 GGTTATGTGTGGAGAGCAGCGGG - Intergenic
969094853 4:4724621-4724643 GGTTCTTATGGGAAAGCAGTTGG - Intergenic
969115379 4:4867619-4867641 GGCGCTGTGGGGGAGGCAGGCGG - Intergenic
971236838 4:24849958-24849980 GCTTCTGTGGAGAGAGCAGAGGG - Intronic
971363615 4:25958880-25958902 GTTTCTGTGGGAAAGGCAGGAGG + Intergenic
971384122 4:26127463-26127485 GGGTCTGTGGGCAGAGCTGGAGG + Intergenic
973746889 4:53972096-53972118 GTTTCTGGGAGGTAAGCAGGTGG + Intronic
977995766 4:103496399-103496421 GGTTTTGTGGGTAAGGCAAGGGG + Intergenic
979584036 4:122393591-122393613 GGTTCTGCAGGGAAAGGAGGAGG - Exonic
980193788 4:129560940-129560962 GGTTCTGTTGGGAAGGAAGCAGG + Intergenic
980275043 4:130640011-130640033 GGTTGTGGGGGGGAGGCAGGAGG - Intergenic
980278688 4:130689331-130689353 GGTTCACTGGGGTAAGCAGGAGG - Intergenic
981011377 4:139928690-139928712 GGTCCTGTGAGGGAAGCACGTGG + Intronic
981016434 4:139978814-139978836 AGTTCTGTGGGGAGGCCAGGTGG - Intronic
982728994 4:158935375-158935397 TGGTCTGTGGGGAAGACAGGAGG - Intronic
983564832 4:169138857-169138879 TGTTCTGTTGAGAAAGCAGCAGG - Intronic
984351743 4:178603261-178603283 GCTTCTGTGTGAAAAGCAGTCGG - Intergenic
985814664 5:2117726-2117748 GGCTCTGTGGGGAGATCGGGAGG - Intergenic
985923913 5:3000807-3000829 GGTGATGGGGAGAAAGCAGGCGG + Intergenic
987047753 5:14123557-14123579 GGTTTTGGGGGGAAAGGAGTGGG + Intergenic
987069086 5:14318914-14318936 GGGTGTGGGGGGAAAGGAGGGGG - Intronic
987114761 5:14717479-14717501 TGATCTGTGGGGAAGGGAGGTGG - Intronic
987704800 5:21448703-21448725 AGTTCTGTGGAGAATGCTGGTGG - Intergenic
991927700 5:71720648-71720670 GGTCCTCTGGGGAAAGTAGAGGG - Exonic
992083446 5:73256807-73256829 GCTTTTGTGGGGAAAACAGCAGG + Intergenic
997285157 5:132672711-132672733 GGTTCTGGGAGAAAAGCAGGGGG + Intergenic
998829727 5:146144328-146144350 GATTCTGTGAGGAGACCAGGAGG - Exonic
999361385 5:150989240-150989262 TGGTGTGTGGGGAAAGGAGGTGG + Intergenic
999490336 5:152044063-152044085 TCTTCTGTGGGCAAAGCAGGTGG + Intergenic
999723772 5:154418173-154418195 GGTGGTGTTGGGAAAGCAGGGGG + Exonic
1000757874 5:165183953-165183975 GATGCTCTCGGGAAAGCAGGAGG - Intergenic
1000846921 5:166293144-166293166 GGGCCTGTGGGGAAGGCAGGGGG - Intergenic
1001057642 5:168462589-168462611 GGAGCTGTGGGAAACGCAGGGGG - Intronic
1001398981 5:171435627-171435649 GGGTCCATGGGGAAAGAAGGAGG - Intronic
1002134087 5:177097508-177097530 GGTACTGTGGGGAACGGAGCTGG - Exonic
1002741297 5:181437272-181437294 GGTTCTCTGTGGCCAGCAGGCGG - Intergenic
1002741313 5:181437340-181437362 GGTTCTCTGTGGCCAGCAGGCGG - Intergenic
1002741329 5:181437408-181437430 GGTTCTCTGTGGCCAGCAGGCGG - Intergenic
1002741345 5:181437476-181437498 GGTTCTCTGTGGCCAGCAGGCGG - Intergenic
1002741361 5:181437544-181437566 GGTTCTCTGTGGCCAGCAGGCGG - Intergenic
1002741377 5:181437612-181437634 GGTTCTCTGTGGCCAGCAGGCGG - Intergenic
1002741393 5:181437680-181437702 GGTTCTCTGTGGCCAGCAGGCGG - Intergenic
1003002322 6:2347753-2347775 GGTTGTTTGGGAAAAGTAGGAGG - Intergenic
1003408069 6:5839485-5839507 GGAACTCTGGGGAAAGCATGTGG - Intergenic
1006301594 6:33196335-33196357 GGTTATGAGGGGAAAGGAGGGGG + Intronic
1006317434 6:33298808-33298830 GGTGCTGTTGGGGAAGGAGGAGG + Intronic
1006602027 6:35232679-35232701 AGGTCTGTGGGGAAGACAGGAGG + Intronic
1007107109 6:39291167-39291189 AGTTCTGGGGTGAAAACAGGAGG + Intergenic
1007400303 6:41599248-41599270 GGCCCTGTGGGGAGAGCTGGTGG - Exonic
1007795340 6:44342657-44342679 GCCTCTGTGGGAGAAGCAGGCGG + Intronic
1007953652 6:45896745-45896767 GGTTCTGTGAAGAAACCAAGGGG - Intergenic
1009297246 6:61967524-61967546 GGGTCAGTGGGGAAAGGAGAGGG + Intronic
1009943347 6:70315513-70315535 GGTACAGTAGAGAAAGCAGGGGG + Intergenic
1013230290 6:108156604-108156626 GTTTCTTTGGGGAAGGAAGGAGG - Intronic
1013374022 6:109496709-109496731 AGTTATGTGGGGAAGGCAGCGGG - Intronic
1014103401 6:117536712-117536734 AGATCTGTGGGGAAGGCAGATGG + Intronic
1016359662 6:143253867-143253889 TGTGCTGTAGGGAAAGGAGGTGG - Intronic
1016555385 6:145330555-145330577 GGTTCAGAGGTGAAGGCAGGTGG - Intergenic
1017441976 6:154473068-154473090 GGTTCTTTGGGGACTGAAGGAGG - Intronic
1017868598 6:158466996-158467018 GGGTCTGTGAAGTAAGCAGGTGG - Intronic
1019193775 6:170269289-170269311 GCTTCTGTGGGGAAGGCTGTAGG - Intergenic
1019246415 6:170712969-170712991 GGTTCTCTGTGGCCAGCAGGCGG - Intergenic
1019246431 6:170713037-170713059 GGTTCTCTGTGGCCAGCAGGCGG - Intergenic
1019246447 6:170713105-170713127 GGTTCTCTGTGGCCAGCAGGCGG - Intergenic
1019246463 6:170713173-170713195 GGTTCTCTGTGGCCAGCAGGCGG - Intergenic
1019246479 6:170713241-170713263 GGTTCTCTGTGGCCAGCAGGCGG - Intergenic
1019246495 6:170713309-170713331 GGTTCTCTGTGGCCAGCAGGCGG - Intergenic
1019246511 6:170713377-170713399 GGTTCTCTGTGGCCAGCAGGCGG - Intergenic
1019246527 6:170713445-170713467 GGTTCTCTGTGGCCAGCAGGCGG - Intergenic
1019595081 7:1854691-1854713 GGTTCTGTGGGGACAGGGGCAGG - Intronic
1020814039 7:12882399-12882421 CTTTCTGTGGGGCAAGCAGCAGG - Intergenic
1021217391 7:17933693-17933715 GGTCCTGAGGGGAAATTAGGAGG - Intronic
1022547314 7:31201179-31201201 TGATGTGTGGGGAAAGCAGAAGG - Intergenic
1023373001 7:39530594-39530616 ACTACTGTAGGGAAAGCAGGGGG - Intergenic
1023836965 7:44074060-44074082 GGTGGTGTGGAGAGAGCAGGAGG + Intronic
1023873411 7:44274665-44274687 GGTACTATGTGCAAAGCAGGAGG + Intronic
1024869658 7:53948392-53948414 GGTTCTCTGGGGACAGGAGTGGG + Intergenic
1025740628 7:64192852-64192874 GGGTTTGTGGGGCCAGCAGGGGG + Intronic
1026366884 7:69657116-69657138 TGTTCTGAGGGGAAAGCTGAAGG - Intronic
1026678967 7:72451035-72451057 GGAACTGTGGAGAAAGCTGGGGG - Intergenic
1028011554 7:85650066-85650088 TTTTCTGTGGGGCAAGCAAGAGG - Intergenic
1028608620 7:92683064-92683086 GTTTCTATGGTGAAAGCAGAGGG - Intronic
1028740904 7:94273961-94273983 CTTTCTGTGTGGAGAGCAGGAGG - Intergenic
1029374629 7:100170348-100170370 GGTTCTGGGGGCAAAGGAGGAGG - Exonic
1031294355 7:119983369-119983391 GGTGGTGTGGTGAGAGCAGGTGG - Intergenic
1032240283 7:130154387-130154409 GGTGTGGTGGGGACAGCAGGGGG + Intergenic
1033366965 7:140679028-140679050 AGTTCTGCGGGGCAAGCTGGTGG + Intronic
1033536978 7:142321232-142321254 GGGCCTGTGGGAAAAGCAGATGG - Intergenic
1033544701 7:142389356-142389378 GGGCCTGTGGGAAAAGCAGATGG - Intergenic
1033555170 7:142482707-142482729 GGGCCTGTGGGAAAAGCAGATGG - Intergenic
1033636525 7:143217234-143217256 GGTTCTATGAGGAACACAGGAGG + Intergenic
1034528547 7:151681360-151681382 ACTCCTGTGGGGAAAACAGGTGG + Intronic
1034750711 7:153566510-153566532 GTTCCTGTGGGGACTGCAGGTGG - Intergenic
1035501612 8:94516-94538 GGTTCTCTGTGGCCAGCAGGCGG + Intergenic
1035501628 8:94584-94606 GGTTCTCTGTGGCCAGCAGGCGG + Intergenic
1035501644 8:94652-94674 GGTTCTCTGTGGCCAGCAGGCGG + Intergenic
1035501660 8:94720-94742 GGTTCTCTGTGGCCAGCAGGCGG + Intergenic
1036033716 8:4996865-4996887 TGCTCTCTGGGGAAAGGAGGTGG - Intergenic
1036052114 8:5210195-5210217 GATTCTGTGGGGAACCCATGAGG - Intergenic
1037309305 8:17537575-17537597 AGTGCTGTGGGGAGGGCAGGAGG + Intronic
1037575528 8:20198338-20198360 GGTTCTTTGGGGAAGCCAGGTGG + Intronic
1037780459 8:21864978-21865000 AGGTCTGTGGGTAGAGCAGGTGG - Intergenic
1038403451 8:27304383-27304405 GGTTAGTTGGGGGAAGCAGGTGG - Intronic
1038842945 8:31203097-31203119 GGAGATGTGGGGAAAGCAGCAGG - Intergenic
1039074519 8:33677755-33677777 GGTTCCATGCTGAAAGCAGGAGG - Intergenic
1039549060 8:38430116-38430138 GGGTCAGTGGGGAAAACAGCTGG + Intronic
1042225458 8:66511500-66511522 GGTACTTAGGGGAAACCAGGAGG + Intronic
1042511592 8:69617982-69618004 GATTCCATGGGGAAGGCAGGAGG - Intronic
1044335272 8:90976097-90976119 GGATGTGTGGGGCAAGAAGGAGG + Intronic
1044667663 8:94647541-94647563 TTTTCTGGGGGGATAGCAGGAGG + Intronic
1044962044 8:97540913-97540935 GGTTCTGTTAGGAAAGAAGAAGG - Intergenic
1045569057 8:103351193-103351215 GATTATATGGGGAAAGCAGTTGG - Intergenic
1045983889 8:108225106-108225128 TGTTCTGTGAGAAAAGCAGCTGG - Intronic
1047021211 8:120776695-120776717 GCTTATGAGGGGGAAGCAGGTGG - Intronic
1047714915 8:127586635-127586657 GGGTGATTGGGGAAAGCAGGTGG - Intergenic
1049048785 8:140174571-140174593 GGGGCTTGGGGGAAAGCAGGAGG - Intronic
1049423592 8:142527427-142527449 TGTTCACTGGGGACAGCAGGAGG - Intronic
1050009450 9:1171278-1171300 GATTTGGTGGGGAAAGCAGCAGG - Intergenic
1050466373 9:5928619-5928641 ATTTCTGAGGGGAAAGCAGAGGG - Intronic
1053129719 9:35608141-35608163 AGTCCTGTGGGGACAGAAGGAGG - Exonic
1053477197 9:38391074-38391096 CGTGCTGTGGGGGAGGCAGGAGG + Intergenic
1054724864 9:68640168-68640190 GCTGCTTTGGGGAAAGCAGAAGG + Intergenic
1055852135 9:80644604-80644626 TGTTCTGTGCAGCAAGCAGGAGG - Intergenic
1056515410 9:87344870-87344892 AGGTCTGTAGGGAAAGCATGAGG - Intergenic
1058669521 9:107348855-107348877 GTTTATGTGGGAACAGCAGGTGG - Intergenic
1058849481 9:108997128-108997150 GGTTTTATGTGGGAAGCAGGGGG - Intronic
1059432447 9:114258354-114258376 GGCTCACTGGGGAAAGCAGCAGG - Intronic
1060397795 9:123328170-123328192 GCTTCTGTGGGGAGAGGCGGGGG + Intergenic
1060806731 9:126582434-126582456 GGTTCTGTGCGGCAAGTGGGAGG - Intergenic
1061216390 9:129224360-129224382 TGCTCTGTGAGGAAGGCAGGGGG + Intergenic
1062221746 9:135419760-135419782 CATTCTGTGAGGAAGGCAGGTGG + Intergenic
1062494999 9:136827469-136827491 TCTGCTTTGGGGAAAGCAGGCGG - Intronic
1203607176 Un_KI270748v1:68352-68374 GGTTCTCTGTGGCCAGCAGGCGG - Intergenic
1203607208 Un_KI270748v1:68488-68510 GGTTCTCTGTGGCCAGCAGGCGG - Intergenic
1203607224 Un_KI270748v1:68556-68578 GGTTCTCTGTGGCCAGCAGGCGG - Intergenic
1203607240 Un_KI270748v1:68624-68646 GGTTCTCTGTGGCCAGCAGGCGG - Intergenic
1203607256 Un_KI270748v1:68692-68714 GGTTCTCTGTGGCCAGCAGGCGG - Intergenic
1203607272 Un_KI270748v1:68760-68782 GGTTCTCTGTGGCCAGCAGGCGG - Intergenic
1203607288 Un_KI270748v1:68828-68850 GGTTCTCTGTGGCCAGCAGGCGG - Intergenic
1203607304 Un_KI270748v1:68896-68918 GGTTCTCTGTGGCCAGCAGGCGG - Intergenic
1185519487 X:728157-728179 TGTTCTATGAGAAAAGCAGGAGG + Intergenic
1186056548 X:5655209-5655231 CTTTCTGTGTGGCAAGCAGGAGG - Intergenic
1186307970 X:8285215-8285237 GATTCTGTGGGGACAGGATGAGG + Intergenic
1186626406 X:11298601-11298623 GGTGCTGTTGGGACAGCACGGGG - Exonic
1187355201 X:18563163-18563185 TGTTCTGTGAGAAAAGCAAGAGG + Intronic
1190493070 X:51002218-51002240 GGCTCTGGGTGGAAAGCACGTGG - Intergenic
1190511561 X:51178433-51178455 GGCTCTGGGTGGAAAGCATGAGG + Intergenic
1190581047 X:51893513-51893535 GCTTTTGTTGGGAAAGCAGGCGG + Intronic
1190598801 X:52069288-52069310 GCTTTTGTTGGGAAAGCGGGCGG - Intergenic
1190610023 X:52184785-52184807 GCTTTTGTTGGGAAAGCGGGCGG + Intergenic
1190965358 X:55295109-55295131 GGTTCTGTGAGGAAAGCCAATGG + Intergenic
1191055216 X:56233411-56233433 GGGTGTGTGGGGGGAGCAGGGGG - Intronic
1193730468 X:85096687-85096709 GTTTCTGATGGGAAAGCAGATGG - Intronic
1194055432 X:89126741-89126763 GAAGCTGTGGGGGAAGCAGGGGG + Intergenic
1198221680 X:134608506-134608528 GGTTATGTAGGGCAAGGAGGAGG + Intronic
1199012911 X:142778188-142778210 GATACTGTGGGGAAAGCCAGTGG + Intergenic
1200045351 X:153397969-153397991 GGAGCTGTGGGTGAAGCAGGAGG - Intergenic