ID: 955732449

View in Genome Browser
Species Human (GRCh38)
Location 3:62000863-62000885
Sequence CTGGGAAAGCAGATGATCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 219}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955732449_955732456 19 Left 955732449 3:62000863-62000885 CCCTGGATCATCTGCTTTCCCAG 0: 1
1: 0
2: 2
3: 21
4: 219
Right 955732456 3:62000905-62000927 TCAAAATAGCCCAGCCAGGTAGG 0: 1
1: 0
2: 3
3: 27
4: 254
955732449_955732451 -6 Left 955732449 3:62000863-62000885 CCCTGGATCATCTGCTTTCCCAG 0: 1
1: 0
2: 2
3: 21
4: 219
Right 955732451 3:62000880-62000902 TCCCAGTGTGATTTTTCTCCAGG 0: 1
1: 0
2: 4
3: 15
4: 263
955732449_955732455 15 Left 955732449 3:62000863-62000885 CCCTGGATCATCTGCTTTCCCAG 0: 1
1: 0
2: 2
3: 21
4: 219
Right 955732455 3:62000901-62000923 GGTGTCAAAATAGCCCAGCCAGG 0: 1
1: 1
2: 0
3: 8
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955732449 Original CRISPR CTGGGAAAGCAGATGATCCA GGG (reversed) Intronic
900878470 1:5363429-5363451 TTGGGAATGCACTTGATCCAAGG - Intergenic
901649070 1:10733012-10733034 CTGGGAAAGCCCATGGTCCTCGG + Intronic
902839376 1:19065556-19065578 CTGGGGAAGCAGCTTGTCCAAGG + Intergenic
902878124 1:19353140-19353162 CTGGGAAAGCTGAGGACCCATGG + Intronic
904826035 1:33274434-33274456 CTGGGAAAGGATATGTCCCAGGG + Intronic
905274596 1:36809029-36809051 CTGGGAAAGCAGAAGAGACAAGG - Intronic
905334586 1:37235762-37235784 CAGGGAAAGCAGATTCTTCAAGG + Intergenic
906795483 1:48693415-48693437 CAGGGAAAGCAGGTCAGCCATGG - Intronic
908191378 1:61706907-61706929 CAGGGAAACCAGATATTCCAAGG - Intronic
912490870 1:110061926-110061948 CTGGAAAAGGAGATGAGGCAGGG - Intronic
912680580 1:111726545-111726567 CTGGGGAACCTGATGCTCCAGGG + Exonic
915728599 1:158036847-158036869 CTGGGAGAGCAGATGAATGAGGG + Intronic
915822832 1:159043424-159043446 CTCTGAAAGCACAAGATCCAAGG + Intronic
917357411 1:174141299-174141321 CTGGTTCAGCAGATGTTCCAGGG - Intergenic
917475459 1:175365567-175365589 GTGGGAATTCAGAGGATCCATGG - Intronic
917491614 1:175503144-175503166 CTGGGAGACCAGAGGACCCATGG + Intronic
919469169 1:197957586-197957608 CAGGGGAAGCTGATGATGCAGGG + Intergenic
923032302 1:230258978-230259000 TTGGAAAAGAAGCTGATCCAGGG + Intronic
923234285 1:232017616-232017638 CTGGGTAAGCAGTTGAGTCACGG + Intronic
924852247 1:247841921-247841943 CTGGAAAAGCACAGGATGCAAGG + Intergenic
1063443836 10:6095561-6095583 CAGGGAAAGCAGACTGTCCAGGG - Intronic
1065966448 10:30774797-30774819 CTGGGACATCAGATGGCCCAGGG + Intergenic
1065972346 10:30815619-30815641 CTGTGAAAGCAGAGGCTCGAGGG - Intergenic
1066661584 10:37741913-37741935 CTGGGTGAGAAGAGGATCCAAGG + Intergenic
1069547800 10:69341235-69341257 CTGGGGAAGCAGAGGTTGCAGGG - Intronic
1069655680 10:70086406-70086428 CAGGGAATGCAGATGATGCTTGG - Intronic
1071360601 10:84842683-84842705 ATGGGAAAGCATATGTTCCAAGG - Intergenic
1073853585 10:107649918-107649940 AGGGAAAAGCAGATGCTCCATGG + Intergenic
1074529142 10:114285073-114285095 ATTGGAAAGCAGATGGTTCAAGG - Intronic
1075260048 10:120955496-120955518 CTGAGAAAGAAAATGATACATGG + Intergenic
1075611763 10:123860213-123860235 CAGAGGAAGGAGATGATCCAGGG + Intronic
1077278248 11:1728069-1728091 CTGGGGAAGCAGCTGATTCCAGG - Intergenic
1078620275 11:12900882-12900904 CTGGGGATGCAGAGGCTCCATGG - Intronic
1078858207 11:15223808-15223830 CTGGAAAAACAGATTAGCCAAGG - Intronic
1079291495 11:19192120-19192142 CTGGGCAAGCAGTTGAAGCAAGG + Intronic
1079364077 11:19793847-19793869 CTGGAAAAGCAGAACAGCCAAGG - Intronic
1080391193 11:31848316-31848338 CTTGGGAAGCAGAAGAGCCAAGG + Intronic
1080751210 11:35152105-35152127 CTGAGAATGCAGAGGCTCCAGGG - Intronic
1085837304 11:79970834-79970856 CTGGGAAAGCAGAGGTTTAATGG - Intergenic
1086098409 11:83072769-83072791 CAGCGAAAGCAGATGTTCAAAGG + Intergenic
1088392670 11:109332220-109332242 CTAAGAATGCAGATGATCCATGG + Intergenic
1089171409 11:116514124-116514146 CTGGGCAAGCGGATGCACCATGG - Intergenic
1091218257 11:133916685-133916707 CTGGGAAAGGAGAGGGTCAATGG + Intronic
1093849462 12:24018123-24018145 CTGGGAAAGCCGGTGATGTAGGG - Intergenic
1095943425 12:47740503-47740525 GTGGGAAGGCAGAGGCTCCAGGG + Intronic
1096120892 12:49088964-49088986 CTGGGCCAACTGATGATCCATGG - Intergenic
1096581601 12:52589213-52589235 CAAGGAAAGCAGCTGATCCAAGG + Intronic
1100529466 12:95450500-95450522 ATGGGATAGTAGATGCTCCAGGG + Intergenic
1101456077 12:104832108-104832130 CTTCAGAAGCAGATGATCCATGG + Intronic
1101906839 12:108833287-108833309 CTGGTAGAGCAGATGATGCTTGG - Intronic
1102034281 12:109761954-109761976 CTGGGGAAGCAGTTGGTGCAGGG - Intronic
1104047868 12:125175867-125175889 TTGGGCCAGCAGATGAGCCAGGG - Intergenic
1105245934 13:18650321-18650343 CTGGGAAATCACAAGATCCCAGG + Intergenic
1107502731 13:40997204-40997226 CTGTGAAAACAGATCATTCAGGG - Intronic
1108409642 13:50133466-50133488 CCGGGACACCAGAGGATCCAGGG - Intronic
1108466366 13:50720106-50720128 CTGGGATGGCAGCTGATCCTGGG + Intronic
1108532875 13:51343879-51343901 CTGGGAAAACAGCAGGTCCAGGG - Intronic
1110113141 13:71776600-71776622 CAATGAAAGCAAATGATCCAGGG - Intronic
1110563785 13:76937625-76937647 CTGGGAAGCCAGATGAGTCATGG - Intergenic
1112138894 13:96615868-96615890 CTGGGAAAGCAGTTGCTCCATGG + Intronic
1113769554 13:112899339-112899361 AGGGGAAAGCAGACGCTCCAAGG + Intronic
1113801201 13:113087250-113087272 CTGGGCAAGCTGCTGATGCAGGG + Exonic
1117281398 14:54244791-54244813 CTGAGAAAGTAGGTGTTCCAGGG - Intergenic
1117956290 14:61125995-61126017 CTGGGGAAGCAGATGTCCCAAGG - Intergenic
1118375776 14:65175782-65175804 CTGGGATTACAGATGAGCCACGG + Intergenic
1121088921 14:91167902-91167924 CTGGGAAAGCAGATGATGACAGG - Intronic
1121301838 14:92878024-92878046 CTGGCCAAGCGGCTGATCCAAGG - Intergenic
1121705627 14:95991181-95991203 TTTGGAATGCAGATGATCCTTGG + Intergenic
1122631304 14:103108967-103108989 CTGGGGAAGGGGATGAACCAGGG - Intronic
1123858676 15:24439476-24439498 GGGGGAAAGCAGCTGACCCAAGG - Intergenic
1123863314 15:24489903-24489925 GGGGGAAAGCAGCTGACCCAAGG - Intergenic
1128239924 15:66094866-66094888 TAGGGAAAGCAGAAGATACAAGG - Intronic
1128541626 15:68538764-68538786 CTGGGAGAGAAGAGGATCCCTGG + Intergenic
1128564550 15:68692008-68692030 CTGTGGAAGCAGATGATGCAGGG + Intronic
1128599450 15:68983449-68983471 ATGAGAAAGCAGTTAATCCATGG - Intronic
1129767437 15:78179196-78179218 CTAGGAGAGCAGATGGCCCAGGG - Intronic
1132605883 16:793550-793572 CTGGGACAGCAGCTGAGTCAAGG - Intronic
1133361431 16:5176962-5176984 CTGGGAACACAGAGGATCTAGGG + Intergenic
1133901824 16:9982830-9982852 CTGGGAAAGTGGGTGATTCAAGG - Intronic
1135416874 16:22275128-22275150 CTGGGGAAGCACATCATGCATGG + Intronic
1135791197 16:25397855-25397877 CTGAGAGAGAAGCTGATCCAAGG + Intergenic
1135962864 16:27012307-27012329 CTGGAAAAGCAAATGCTCCTTGG - Intergenic
1139347052 16:66310706-66310728 GTGGGAACTCAGATGATACAGGG + Intergenic
1141008876 16:80378305-80378327 CTTGGAATGCAAATGATCAAGGG + Intergenic
1141153806 16:81582954-81582976 GTGGGGTAGCAGATGCTCCAAGG + Intronic
1142177459 16:88651639-88651661 CTGGGAAAGCACAGAATGCAGGG + Intergenic
1146408951 17:32565501-32565523 GTGACAAAGCAGATGATCGAGGG - Intronic
1149096328 17:52845272-52845294 CTGTGTAACCAGATGATCCTGGG + Intergenic
1149691951 17:58584782-58584804 ATGGGTGGGCAGATGATCCAGGG - Intronic
1152201259 17:78947782-78947804 CTGGGAAAGCAGTGGCTCCCTGG + Intergenic
1152618738 17:81350280-81350302 CTGGGAATGCAGACCAGCCAGGG - Intergenic
1154442984 18:14409343-14409365 CTGGGAAATCACAAGATCCCAGG - Intergenic
1155784758 18:29882374-29882396 CTGTGAAAGCAAAATATCCAGGG + Intergenic
1156367414 18:36441650-36441672 CTGGGAAACCACATGTTACAGGG + Intronic
1159019517 18:63131823-63131845 CTGGGAAACCGGAGGATGCAGGG + Intronic
1159706991 18:71702855-71702877 CTGGGGAAGCAGAAGACACATGG + Intergenic
1159859066 18:73625671-73625693 CTGGGATAGCAGATGATGCTTGG - Intergenic
1160456093 18:79001754-79001776 ATGGGAAAGCAGATTTTACATGG - Intronic
1162119422 19:8453680-8453702 CTGGGGAAGCAGAAGGTGCAAGG + Intronic
1162143215 19:8596933-8596955 CTGAGAAAACAGATGGTCCAGGG - Intronic
1162349133 19:10138246-10138268 CTAGGGAAGCAGATGATGCAGGG + Intronic
1162615813 19:11799323-11799345 TTGGGAAAACACAGGATCCACGG + Intronic
1165234483 19:34409486-34409508 TTGGGAAAGCAACTGATCCATGG - Exonic
1166437724 19:42783351-42783373 CTGGGAAAGCTGGCTATCCATGG + Intronic
1166456673 19:42947149-42947171 CTGGGAAAGCTGGCTATCCATGG + Intronic
1166466629 19:43038013-43038035 CTGGGAAAGCTGGCTATCCATGG + Intronic
1166493537 19:43281070-43281092 CTGGGAAAGCTGGCTATCCATGG + Intergenic
1167874631 19:52401480-52401502 CTGGGGAAGCAGATCAGGCAGGG - Intronic
925506580 2:4572396-4572418 CTGAGAAAGCAGATGCTTCCCGG - Intergenic
925672063 2:6321182-6321204 CTGTGAATGCATATGGTCCAGGG - Intergenic
926236902 2:11052429-11052451 CGGGGGAGGCAGGTGATCCAGGG + Intergenic
927050393 2:19322163-19322185 ATGGGAAATCAGAAGATTCAAGG - Intergenic
929518146 2:42623248-42623270 CTTGGAATGCAGGTGGTCCAAGG + Intronic
930866509 2:56127116-56127138 CAGGGGAAGCAAAAGATCCAAGG + Intergenic
930993662 2:57689618-57689640 CTGGGAATCCATATGGTCCAGGG - Intergenic
932047474 2:68364369-68364391 AGGGGAAAGCAGAAGAACCAGGG - Intergenic
932930064 2:76025056-76025078 CTGGGAATCCAGGTGTTCCAGGG - Intergenic
935952704 2:108345406-108345428 CTGGGAAACCAGTTTTTCCACGG - Intergenic
936516061 2:113182407-113182429 CCGTGAAAGCAGATGCTCCGGGG + Exonic
936559566 2:113525143-113525165 CTGAGAAAGCAGATGCCCAAGGG + Intergenic
937115724 2:119403920-119403942 CTGAGAATGCAGATGAGCCATGG + Intergenic
939282133 2:140077703-140077725 CTGGGAAAGCTGATAGCCCAAGG + Intergenic
939833235 2:147097417-147097439 CTTGGAAAGCAGAAGAGACAAGG - Intergenic
940641687 2:156350996-156351018 CTGGGAAGGGAAATGAGCCAGGG - Intergenic
941418102 2:165246844-165246866 CTGGGAGAGTAAGTGATCCAGGG - Intronic
944825925 2:203483095-203483117 ATGGGAAAGCAGATCAGGCAAGG + Intronic
945034907 2:205696461-205696483 CTGGGAAGGCACATGAGACATGG - Intronic
945324203 2:208463828-208463850 CTGGGAAGCCAGATCATCCCTGG - Intronic
946648673 2:221868234-221868256 CTGGAAAAGCAGGAGATCCTGGG + Intergenic
1169216737 20:3798550-3798572 CTGGGAAAGCAGACAGACCATGG + Intronic
1170681003 20:18525056-18525078 ATGGACATGCAGATGATCCATGG + Intronic
1174077064 20:47945010-47945032 GGGGGAAAACAGATCATCCATGG + Intergenic
1174253190 20:49234655-49234677 ATGACAAGGCAGATGATCCATGG - Intronic
1175444550 20:59011000-59011022 CCTGGAAAACACATGATCCAAGG + Intergenic
1175522378 20:59610177-59610199 CTGGGGAAGCAGAGGTTGCATGG + Intronic
1178436535 21:32564258-32564280 CTGGGAAACCAACTGGTCCAGGG + Intergenic
1181099585 22:20530534-20530556 ATGGGAAAGCAGTTGGACCAGGG + Intronic
1181765025 22:25085273-25085295 CTGGGAGGGCAGAGGAGCCAAGG + Intronic
1183786883 22:40034480-40034502 CTGGGAGAGCAGAAGCTGCAAGG - Exonic
949778232 3:7655740-7655762 CTGGGGAAGCAGAAGATCATAGG - Intronic
950465479 3:13150904-13150926 GTGTGAAAGCAGATGGTCCAGGG + Intergenic
950499516 3:13354791-13354813 CAGGGAAAGGAGCTCATCCAAGG + Intronic
952027445 3:29100013-29100035 CTGGGAAAGCTTATGACTCAAGG - Intergenic
953840604 3:46387300-46387322 CTTGGAAAACACATGACCCAGGG - Intergenic
955732449 3:62000863-62000885 CTGGGAAAGCAGATGATCCAGGG - Intronic
957705817 3:83781737-83781759 CTGGAAAAGCTGATGATCACTGG - Intergenic
959562840 3:107802147-107802169 CTAAGAAAGCAGCTCATCCATGG - Intronic
959647494 3:108720374-108720396 CTGATAAAACAGATGATTCAAGG - Intergenic
959957109 3:112251886-112251908 CTAGGAAAGGAGATGATTCAGGG - Intronic
960154402 3:114283348-114283370 ATGGCAAAGCAGATGTTCCAAGG - Intronic
962265023 3:133938678-133938700 CAGGGGATGCTGATGATCCAGGG - Intronic
962340598 3:134579300-134579322 CTGGGAAAGCACATTATTCCCGG - Intergenic
964424175 3:156534259-156534281 CTGGGAAGGCAGCTGCTTCAAGG + Intronic
964913964 3:161816981-161817003 CATTGAAAGCAGATGATTCATGG + Intergenic
965733014 3:171792422-171792444 CTGGGAATGCAGATGGATCAGGG + Intronic
966576304 3:181506485-181506507 ATGGGCAAGCAAATGACCCAAGG - Intergenic
967161127 3:186739137-186739159 CAGGGAAACCACATGTTCCAAGG + Exonic
968484193 4:850805-850827 GTGGTACAGCAGATGCTCCAGGG + Intronic
969055967 4:4402913-4402935 CTGGGAAGGAAGCAGATCCAGGG - Intronic
969160372 4:5252493-5252515 CTGGGAAGGCAGATGATGAGTGG + Intronic
971187493 4:24394302-24394324 CTGGGAAACCATGAGATCCAAGG + Intergenic
971606788 4:28668028-28668050 ATTGGAAAGCAGCTGTTCCAAGG - Intergenic
972237059 4:37146879-37146901 CTGTGAAAGCAGCTGGGCCAGGG + Intergenic
972822589 4:42718807-42718829 CTGGGAAAACAGATGTTTCAGGG + Intergenic
973566963 4:52198643-52198665 CTGGGAAGGCAGTTTCTCCAGGG - Intergenic
974718973 4:65711842-65711864 CTGAGAACTCAGATAATCCAAGG + Intergenic
976492344 4:85686090-85686112 CTGGGAGAGCTGATCCTCCAGGG - Intronic
978983060 4:114974931-114974953 CTGGGAAATCAGATCATTCTGGG + Intronic
979553436 4:122017495-122017517 CTGGGACAGAAAATGATGCATGG + Intergenic
981147582 4:141343229-141343251 CAGGGAACACAGATGCTCCAGGG - Intergenic
982666694 4:158273491-158273513 GTGAGAAAGCAAATGATCCTTGG + Intergenic
987782343 5:22455394-22455416 CGGGTAATGCTGATGATCCAAGG - Intronic
988290128 5:29273810-29273832 CTGTGAATGCATATGATCCCAGG - Intergenic
988996120 5:36716391-36716413 CCTGGAAAGCAAAGGATCCAGGG + Intergenic
989200096 5:38754610-38754632 CTGGGAAAGTAGTGGTTCCATGG - Intergenic
990097674 5:52137238-52137260 GTGGCAAAGCAGATGTTCCTTGG + Intergenic
990727259 5:58769468-58769490 CTGGGACAGTAGATGATACTGGG + Intronic
996422532 5:123278239-123278261 CGGGGAAAGCAGGTGGTTCAGGG + Intergenic
996549139 5:124711940-124711962 ATGGGAAAACAGATGAGACAGGG + Intronic
996901802 5:128551543-128551565 CTAGGAAAGCAGCTGATTCCAGG + Intronic
998906323 5:146909028-146909050 AAGAGAAAGCAGATGGTCCATGG + Intronic
1000305782 5:159993381-159993403 CTTGGAAAGCAGCTCATCCTGGG + Intergenic
1002029152 5:176415748-176415770 CTGGGAAAAAAGAGGATCCTGGG - Intronic
1002943210 6:1735589-1735611 CTGGGTAAGCTGATGAGCGAGGG - Intronic
1003698927 6:8440745-8440767 CTGGGAAAGAAGAGGAGTCATGG - Intergenic
1005812494 6:29528253-29528275 CTGGGAAAGCAGAGGTCCCCTGG - Intergenic
1005831643 6:29675867-29675889 CAGGGAAACCAGATGTTCCAGGG + Intronic
1006395691 6:33785963-33785985 CTGGGAAAGAAAATGACGCATGG - Intronic
1006556738 6:34873338-34873360 CTGGGAAAGCAGATGTGCCAGGG - Exonic
1006621657 6:35369071-35369093 CTGGCAAACCAAATTATCCAGGG - Intronic
1007340277 6:41186736-41186758 CTGGGGAAGGAGATGATCTGGGG - Intergenic
1011518760 6:88181361-88181383 GGAGGAAAGGAGATGATCCAGGG - Intergenic
1014893371 6:126870034-126870056 CTGTGAATGCAGATGATACTGGG - Intergenic
1015098899 6:129451142-129451164 ATGGCAAAGCAGATGAGCAATGG - Intronic
1016494642 6:144646687-144646709 CTGGGAAAGCAAATGTATCAGGG + Intronic
1016933630 6:149432303-149432325 CTGAGAAAGGAGCTGATCAACGG - Intergenic
1017795780 6:157842970-157842992 TTGGGAAAGAATTTGATCCATGG - Intronic
1018359298 6:163050566-163050588 TTGGTAAAGTTGATGATCCAGGG + Intronic
1018378319 6:163234106-163234128 CAGGGACAGAAGATGATCTAGGG + Intronic
1021475785 7:21059099-21059121 CTGGGAAATGAGATGAACAAAGG - Intergenic
1022313079 7:29215772-29215794 CAGGGAAAGAAAATGTTCCAAGG + Intronic
1024526690 7:50355265-50355287 CTGTGAGAGCAGATGGTCCTGGG + Intronic
1024705889 7:51959325-51959347 CTTTGAAACCAGCTGATCCACGG - Intergenic
1025724916 7:64047612-64047634 CTCTGAAAGGAGATGACCCAGGG - Intronic
1025753950 7:64316165-64316187 CTCTGAAAGGAGATGACCCAGGG - Intronic
1026570037 7:71521358-71521380 CTGGGAAAGGAGGTGGTCAAAGG - Intronic
1026650354 7:72210858-72210880 CTGGGAAAGATGATGAGCCCCGG + Intronic
1027556927 7:79676432-79676454 CTGTGAAACCAGATTATCAATGG + Intergenic
1032915224 7:136482084-136482106 CTGGGAAGGCAGATAACACATGG + Intergenic
1034761415 7:153675377-153675399 CTGGGACGCCAGAGGATCCAGGG + Intergenic
1035065951 7:156105279-156105301 CTGAGAAAGCAGATAAACAAAGG + Intergenic
1035216386 7:157370808-157370830 CTGGGGAAGCTGCTGCTCCATGG + Intronic
1035391186 7:158506152-158506174 CAGAGAAAGCAGAGGCTCCATGG + Intronic
1036717465 8:11139564-11139586 CTCGGAAAACAGATGCTCCAGGG + Intronic
1036762255 8:11517573-11517595 CGGGGAAAGCAGATGAGGCCGGG - Intronic
1038913051 8:31988813-31988835 CTGGAAAAGCATAGGATCTAAGG - Intronic
1040575500 8:48647920-48647942 CAGGGAAAGGAGATGATGGATGG + Intergenic
1040618846 8:49066548-49066570 TCGGGAAAGCATATGAGCCAGGG + Intronic
1041596611 8:59661427-59661449 CAGGGAAAGTAGATAATACAAGG + Intergenic
1042747317 8:72121530-72121552 CCAAGAAAGCAGAGGATCCATGG + Intergenic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1043516876 8:81002948-81002970 CAGGGAAGGCAGATGACTCAAGG + Intronic
1047183186 8:122608460-122608482 CGGGAAAAGCAGAAGATCCATGG + Intergenic
1048358519 8:133674233-133674255 CAGGGGAAGCAGATGAGCAAGGG - Intergenic
1048757198 8:137752978-137753000 CAGTGAAAGCAGATGATGTAGGG + Intergenic
1049893299 9:91080-91102 CTGAGAAAGCAGATGCCCAAGGG - Intergenic
1053734512 9:41091138-41091160 CTGAGAAAGCAGATGCCCAAGGG - Intergenic
1054693870 9:68340281-68340303 CTGAGAAAGCAGATGCCCAAGGG + Intronic
1054717791 9:68574285-68574307 ATGGGAAAACAAATGAACCAAGG + Intergenic
1056512440 9:87318689-87318711 CTGGGCATGCAAATGATGCATGG + Intergenic
1059307410 9:113365573-113365595 CTGGAGAAGCAGCTGATTCAGGG - Intronic
1060265702 9:122110422-122110444 GTGGGGGAGCAGATCATCCAGGG - Intergenic
1061160794 9:128892701-128892723 CAGGGGAAGCACATGACCCATGG + Intronic
1062217727 9:135398412-135398434 CTGGCAAAGCAGACGAGCCAGGG + Intergenic
1186804486 X:13126419-13126441 ATGGGAAAGCACATGATTCCTGG - Intergenic
1189236236 X:39489450-39489472 ATGGGAAAGCTGATGATGGAGGG - Intergenic
1189446109 X:41083702-41083724 GTGGGGAAGCAAATGATTCATGG + Intergenic
1189681127 X:43517809-43517831 CTTGCAAAGCTGAAGATCCAGGG + Intergenic
1195752477 X:108172478-108172500 CTGGGAGACCAGATGCTCCTGGG + Exonic
1195903231 X:109819763-109819785 CTGGGCAAGCAGATGATGTTTGG + Intergenic
1197111775 X:122783619-122783641 CTAGGGAAGGAAATGATCCAGGG + Intergenic
1197839083 X:130726292-130726314 CTTGTAAAGCAGAGGCTCCATGG + Intronic
1198110459 X:133498294-133498316 GGGGGAAAGCACATGATTCAGGG + Intergenic