ID: 955733104

View in Genome Browser
Species Human (GRCh38)
Location 3:62008529-62008551
Sequence GATTGCAGACCTGTACCATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 66}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955733104_955733105 -2 Left 955733104 3:62008529-62008551 CCATATGGTACAGGTCTGCAATC 0: 1
1: 0
2: 0
3: 5
4: 66
Right 955733105 3:62008550-62008572 TCCCTTATCTGAAACTCTTGAGG 0: 1
1: 7
2: 27
3: 89
4: 334

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955733104 Original CRISPR GATTGCAGACCTGTACCATA TGG (reversed) Intronic
902431896 1:16369749-16369771 GATTACAGGTATGTACCATAGGG - Intronic
903910388 1:26720333-26720355 GATTACAGACCTGTGCCACCAGG - Intronic
907486244 1:54780348-54780370 GATTACAGACGTGTGCCATCAGG - Exonic
911357854 1:96843832-96843854 GATTCCAGGCCTGTAACGTAAGG - Intergenic
916962131 1:169899374-169899396 GATTTCAGACCAGCCCCATATGG - Intergenic
918286297 1:183058259-183058281 TATTTCATACCTGTAACATAAGG + Intronic
919223270 1:194659763-194659785 AATTACAGACCTGTAGCAGAGGG + Intergenic
920072152 1:203309952-203309974 GATTGCAGGCATGTGCCATCAGG + Intergenic
920566691 1:206979838-206979860 GTTTCCAGACCTGTAGTATAGGG - Intergenic
1063195711 10:3740882-3740904 AATTCAAGACCTGTACAATAAGG - Intergenic
1073441903 10:103557153-103557175 GATTGCAGGCGTGAACCATCGGG - Intronic
1074155723 10:110797531-110797553 GATTGCAGATGTGCACCACACGG - Exonic
1077303700 11:1858526-1858548 GATGGCAGCCCAGGACCATAAGG + Intronic
1083455602 11:62776711-62776733 GATTACAGACATGTACCACCAGG - Intronic
1086388611 11:86337042-86337064 GCTGGCAGACCTGCTCCATAAGG + Intronic
1086992782 11:93323790-93323812 AATTGTTAACCTGTACCATATGG - Intergenic
1093328749 12:17810426-17810448 AACTGCAGACAGGTACCATATGG + Intergenic
1093863976 12:24202606-24202628 GATTGAAGAACTGTCCCAGATGG - Intergenic
1098754418 12:74341322-74341344 GATTACAGGCCTGAACCACAGGG - Intergenic
1099170574 12:79359233-79359255 GATTTCAGCCCTTTACCATATGG - Intronic
1099620188 12:84993926-84993948 GATTGAAGAACTGTTCCAGAAGG + Intergenic
1109006094 13:56879501-56879523 AATTGCATACCTTTACCATTGGG - Intergenic
1111645212 13:91023539-91023561 GATTACAGGCATGTGCCATAAGG - Intergenic
1117095921 14:52297753-52297775 GTGTGCAAACCTGTACCATCTGG - Intergenic
1121958718 14:98238863-98238885 GTTTGAATACCTGTCCCATAAGG + Intergenic
1122100162 14:99402137-99402159 GACTGAAGACCTTTAGCATAGGG - Intronic
1122254407 14:100466495-100466517 GATTCCAGACCTGTTCCATTAGG - Intronic
1127977912 15:64012083-64012105 CACTGCAAAGCTGTACCATAAGG + Intronic
1130199420 15:81811136-81811158 GATTGCTGACCTGAGCTATAAGG + Intergenic
1133932578 16:10244360-10244382 GAATGCAGACCTTGACCATGGGG - Intergenic
1142672889 17:1495465-1495487 GAATGCAGGCCTGTGCCAAATGG + Exonic
1149746099 17:59099939-59099961 GATTACAGACATGTACCACCAGG + Intronic
1151196620 17:72436196-72436218 GACTGCAGACCTGCACCATCAGG + Intergenic
1153046804 18:863375-863397 TATTTCTGACCTGTAGCATAAGG + Intergenic
1157982057 18:52393249-52393271 GATTTCTGACTTGGACCATACGG + Intronic
1158147926 18:54336592-54336614 CAATGCAGACATATACCATAAGG - Intronic
1163432260 19:17275426-17275448 GATTACAGACATGTGCCATCAGG + Intronic
1165173637 19:33911019-33911041 GATTGGAGCCCTGAACCATCCGG - Intergenic
930179070 2:48333978-48334000 GATTGCAGACCTGAATAATCAGG + Intronic
930315349 2:49790717-49790739 GATTATAGAACTGTACTATAGGG - Intergenic
930867425 2:56135674-56135696 GAATGCAGGCATGTACGATAGGG - Intergenic
1172616571 20:36290738-36290760 GACTGCAAGCCTGTACAATATGG - Intergenic
1184361811 22:44023733-44023755 GCTTGCAGGCCGGTACCATGAGG - Intronic
950110947 3:10418389-10418411 GAATGCAGACATTTAACATATGG + Intronic
955733104 3:62008529-62008551 GATTGCAGACCTGTACCATATGG - Intronic
961482280 3:127191776-127191798 GATTGCAGACATGAACCAAGGGG - Intergenic
963190754 3:142470169-142470191 AATTGCAGATCTCTACAATATGG - Exonic
972770876 4:42195842-42195864 GATTGCAGACTTGCATCATGCGG + Intergenic
975256406 4:72241019-72241041 GATTGCAGACTAGTACAGTAGGG + Intergenic
976956471 4:90907117-90907139 AATTGCAGACCTTTACCACAGGG + Intronic
982824895 4:159991001-159991023 GATTCCAGAACAGTACCACAGGG + Intergenic
986352730 5:6895429-6895451 GATTACAGGCATGTACCACAGGG + Intergenic
989801214 5:45542857-45542879 AATTGGAGACTTGTTCCATATGG + Intronic
1000145270 5:158447579-158447601 GCTGGCAGACCTGAATCATATGG - Intergenic
1003793072 6:9568353-9568375 GACTGCAGGCCTGTACCACCAGG - Intergenic
1005633376 6:27730586-27730608 GATTACAGACATGTACCACCAGG + Intergenic
1006686150 6:35836056-35836078 GACCGCAGACTGGTACCATAGGG - Intronic
1007128873 6:39450665-39450687 GACTGCAGACATGTACCACCAGG - Intronic
1008234770 6:49030927-49030949 GTTTGCACATCTGTACAATAGGG + Intergenic
1013022408 6:106232828-106232850 GTTTACAGACCTGGACCTTAAGG + Intronic
1016839265 6:148509614-148509636 GCTTGCACAACTGTGCCATATGG + Intronic
1030148584 7:106380516-106380538 GATTGCAGACAAGAACCCTATGG + Intergenic
1044012400 8:87010605-87010627 GATTACAGGCATGTACCATCAGG - Intronic
1052226983 9:26101569-26101591 GATTACAGACCTGCACCACCTGG - Intronic
1053448481 9:38172189-38172211 GCTTGCAGACATGGACCATGTGG + Intergenic
1058068598 9:100577972-100577994 GATTGCAGAACAGTCACATATGG + Intergenic
1060208054 9:121694062-121694084 GAGTGCAGAGCTGTCCCACAGGG - Intronic
1186093319 X:6073176-6073198 GATTTCAGGCTTGTACCATAGGG - Intronic
1188691444 X:33133866-33133888 GATTGCATATCTTTCCCATAGGG + Intronic
1192068147 X:67908787-67908809 GATTGCAGACATATACCACTGGG + Intergenic
1193534238 X:82693113-82693135 GATTGCAGAGCTCTTCCAGAAGG + Intergenic
1198680135 X:139172672-139172694 GATTGCAGAGTTCTGCCATAGGG - Intronic