ID: 955735099

View in Genome Browser
Species Human (GRCh38)
Location 3:62030588-62030610
Sequence GTTGACCAGCAAGTGAGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 1, 2: 1, 3: 34, 4: 144}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955735099 Original CRISPR GTTGACCAGCAAGTGAGCAC TGG Intronic
900392109 1:2438262-2438284 GTTTACAAGGAAGTGTGCACTGG + Intronic
904945528 1:34196293-34196315 GCAGACCAGCAAGTGTGCAGCGG + Intronic
906680726 1:47723957-47723979 CTTGTTCAGCAAGTTAGCACCGG - Intergenic
906745089 1:48215874-48215896 GTTGAGCAGCCAGGAAGCACAGG + Intergenic
907857524 1:58318417-58318439 GCTGCCCAGGAAGTGAGGACGGG + Intronic
914839532 1:151236756-151236778 GATGACCAGTAAGTGGGCTCAGG + Exonic
916632367 1:166630373-166630395 GTTGTACAGCAGGTGTGCACAGG + Intergenic
920278199 1:204824230-204824252 GATCACCAGCATGTGTGCACTGG + Intergenic
1062760789 10:16745-16767 GTGGAGCAGTAAGTTAGCACTGG - Intergenic
1066301750 10:34103419-34103441 GGTCACCAGCAAGGGAGCCCGGG + Intergenic
1067540726 10:47150447-47150469 GATGACCAGCAATTGAGCTGTGG + Intergenic
1067909824 10:50334989-50335011 GTTGATCATCAAGGGAGTACAGG + Intronic
1068147323 10:53088390-53088412 GGTGGCCACCAAGTGACCACAGG + Intergenic
1069810408 10:71155252-71155274 GTTCACCTTCAAGTTAGCACTGG - Intergenic
1070427460 10:76303468-76303490 AGTGCCCAGCAAGTGAGCGCTGG - Intronic
1073290538 10:102411076-102411098 GTTGAGCAGCATGAGCGCACAGG + Exonic
1074818683 10:117163470-117163492 GTGGACCAGCACGTGGGCCCGGG + Intergenic
1075558106 10:123447854-123447876 GTCTCCCAGCTAGTGAGCACTGG - Intergenic
1076197327 10:128528500-128528522 AGTTACCAGCAAGAGAGCACTGG - Intergenic
1076299120 10:129411419-129411441 GTTGCCCAGCCAGTGAGAGCGGG - Intergenic
1076581093 10:131511907-131511929 GGTGACCAGCCAGCGAGCAAAGG + Intergenic
1077432087 11:2520691-2520713 GGTGACCAGTGAGTGAGCAGGGG + Intronic
1080620815 11:33986052-33986074 GATGGCCAGGAAGTGAGGACTGG - Intergenic
1083275532 11:61595005-61595027 GTTACACAGCCAGTGAGCACGGG - Intergenic
1094205666 12:27837835-27837857 GTTGAGCAGAAAGTGAGGACTGG - Intergenic
1096217273 12:49804891-49804913 ATAACCCAGCAAGTGAGCACTGG - Intronic
1096914580 12:55017599-55017621 GTGGGCCAGCAACTGAGTACTGG + Intergenic
1098147604 12:67513664-67513686 GTTGCCCAGCAAGTAATAACTGG - Intergenic
1100173920 12:92007967-92007989 GGTGAGCAGCAGGTGAGCACAGG + Intronic
1101964244 12:109271529-109271551 GTTCACCTCCAGGTGAGCACTGG + Intergenic
1103021606 12:117539070-117539092 GTTGACCAGAGAGTATGCACTGG - Intronic
1103984857 12:124760448-124760470 GGTGACCAGCCTGTGAGCCCAGG - Intergenic
1104643175 12:130480236-130480258 GTTGACCACGAAGTTACCACAGG - Intronic
1104720393 12:131042067-131042089 GTTGCCCAGCAGGTGAGGAAAGG + Intronic
1104992238 12:132632351-132632373 ATTGAGCAGCAAGTGGGAACCGG + Exonic
1106146342 13:27053070-27053092 ATTTACCAGCATGTCAGCACTGG + Intergenic
1115961283 14:38837824-38837846 GGAGAGCAGGAAGTGAGCACAGG + Intergenic
1116496368 14:45565469-45565491 CTTACCCAGCAAGTGAGCAAAGG + Intergenic
1122022620 14:98851720-98851742 GGTCACCAGGAAGTGAGCAGGGG - Intergenic
1202890977 14_KI270722v1_random:157457-157479 CTTGACTAGCAAGTGTGGACAGG - Intergenic
1202935386 14_KI270725v1_random:82994-83016 GTTGACCAACAAGTGACTTCAGG - Intergenic
1125126148 15:36223381-36223403 GTGGACCAGCAAATGAACTCAGG + Intergenic
1126038004 15:44565515-44565537 GCCGCACAGCAAGTGAGCACTGG - Intronic
1130154525 15:81338080-81338102 GTTCTCAAGCCAGTGAGCACTGG + Intronic
1130890777 15:88132200-88132222 GTTGACCAGAAAATGACTACTGG + Intronic
1131708502 15:95025211-95025233 GCTGACAGGAAAGTGAGCACAGG + Intergenic
1132698337 16:1211794-1211816 GTCGACCAGCAGGTGCGCACAGG + Exonic
1132714019 16:1281812-1281834 GTTGAACAGCCTGAGAGCACAGG + Intergenic
1133033296 16:3021682-3021704 GTTCACCAGTAAGTGTGCCCTGG + Exonic
1137222434 16:46469694-46469716 TTTGACCATAAAGTGAGTACTGG + Intergenic
1137891490 16:52167380-52167402 TTTGAGCAGCAAGTGTGCATGGG - Intergenic
1141240182 16:82258559-82258581 GTTGAACAGAAAGTTACCACAGG - Intergenic
1150599325 17:66636924-66636946 GTTGATCAGCAATTGTGCACAGG - Intronic
1151241651 17:72762955-72762977 GATGTCCAGCATGTGAGCATTGG + Intronic
1151478198 17:74355399-74355421 GATGACCAGGAAGTAAGCTCAGG + Exonic
1152557044 17:81058613-81058635 TGGGAGCAGCAAGTGAGCACAGG - Intronic
1152953696 18:17099-17121 GTGGAGCAGTAAGTTAGCACTGG - Intergenic
1155437081 18:25824597-25824619 GGTGACCAGCAAGTGACCACTGG + Intergenic
1156293662 18:35771662-35771684 GTTAACCAGCACGTAACCACTGG + Intergenic
1156385516 18:36601223-36601245 GTTGCCCAGCCAGTCAGAACTGG - Intronic
1157625936 18:49051280-49051302 GTTGATCACCAGGTGAGCCCAGG + Intronic
1159087844 18:63814138-63814160 GATGACCAGCAACAGAGGACTGG - Intergenic
1160608620 18:80071223-80071245 GGCGACCAGCAGGTGTGCACAGG - Intronic
1160608631 18:80071259-80071281 GGTGACCAGCAGGTGTGCACAGG - Intronic
1160608653 18:80071332-80071354 GGCGACCAGCAGGTGTGCACAGG - Intronic
1160608664 18:80071368-80071390 GGTGACCAGCAGGTGTGCACAGG - Intronic
1160608676 18:80071404-80071426 GCCGACCAGCAGGTGTGCACAGG - Intronic
1160608688 18:80071441-80071463 GGCGACCAGCAGGTGTGCACAGG - Intronic
1160608699 18:80071477-80071499 GGTGACCAGCAGGTGTGCACAGG - Intronic
1160608712 18:80071514-80071536 GGTGACCAGCAGGTGTGCACAGG - Intronic
1160608725 18:80071551-80071573 GGCGACCAGCAGGTGTGCACAGG - Intronic
1160608736 18:80071587-80071609 GGTGACCAGCAGGTGTGCACAGG - Intronic
1160608748 18:80071623-80071645 GCCGACCAGCAGGTGTGCACAGG - Intronic
1160608760 18:80071660-80071682 GGCGACCAGCAGGTGTGCACAGG - Intronic
1160608771 18:80071696-80071718 GGTGACCAGCAGGTGTGCACAGG - Intronic
1160608784 18:80071733-80071755 GGTGACCAGCAGGTGTGCACAGG - Intronic
1160608797 18:80071770-80071792 GGCGACCAGCAGGTGTGCACAGG - Intronic
1160608808 18:80071806-80071828 GGTGACCAGCAGGTGTGCACAGG - Intronic
1160608820 18:80071842-80071864 GCCGACCAGCAGGTGTGCACAGG - Intronic
1160608832 18:80071879-80071901 GGCGACCAGCAGGTGTGCACAGG - Intronic
1160608843 18:80071915-80071937 GGTGACCAGCAGGTGTGCACAGG - Intronic
1160608856 18:80071952-80071974 GGTGACCAGCAGGTGTGCACAGG - Intronic
1160608869 18:80071989-80072011 GGCGACCAGCAGGTGTGCACAGG - Intronic
1160608880 18:80072025-80072047 GGTGACCAGCAGGTGTGCACAGG - Intronic
1160608891 18:80072061-80072083 GGTGACCAGCAGGTGTGCACAGG - Intronic
1160608904 18:80072098-80072120 GGTGACCAGCAGGTGTGCACAGG - Intronic
1160608927 18:80072171-80072193 GGCGACCAGCAGGTGTGCACAGG - Intronic
1160608940 18:80072207-80072229 GCCGACCAGCAGGTGTGCACAGG - Intronic
1160608953 18:80072244-80072266 GCCGACCAGCAGGTGTGCACAGG - Intronic
1160608965 18:80072281-80072303 GGTGACCAGCAGGTGTGCACAGG - Intronic
1160608978 18:80072318-80072340 GGCGACCAGCAGGTGTGCACAGG - Intronic
1160608989 18:80072354-80072376 GGTGACCAGCAGGTGTGCACAGG - Intronic
1160609001 18:80072390-80072412 GCCGACCAGCAGGTGTGCACAGG - Intronic
1160609013 18:80072427-80072449 GGTGACCAGCAGGTGTGCACAGG - Intronic
1160609026 18:80072464-80072486 GGTGACCAGCAGGTGTGCACAGG - Intronic
1160609039 18:80072501-80072523 GGTGACCAGCAGGTGTGCACAGG - Intronic
1160609052 18:80072538-80072560 GGCGACCAGCAGGTGTGCACAGG - Intronic
1160609063 18:80072574-80072596 GGTGACCAGCAGGTGTGCACAGG - Intronic
1160609074 18:80072610-80072632 GGTGACCAGCAGGTGTGCACAGG - Intronic
1160609087 18:80072647-80072669 GGTGACCAGCAGGTGTGCACAGG - Intronic
1160609110 18:80072720-80072742 GGCGACCAGCAGGTGTGCACAGG - Intronic
1160609123 18:80072756-80072778 GCCGACCAGCAGGTGTGCACAGG - Intronic
1160609135 18:80072793-80072815 GGTGACCAGCAGGTGTGCACAGG - Intronic
1160609148 18:80072830-80072852 GGTGACCAGCAGGTGTGCACAGG - Intronic
1160609162 18:80072867-80072889 GCCGACCAGCAGGTGTGCACAGG - Intronic
1160609174 18:80072904-80072926 GGTGACCAGCAGGTGTGCACAGG - Intronic
1160609203 18:80073013-80073035 GGCGACCAGCAGGTGTGCACAGG - Intronic
1160609214 18:80073049-80073071 GGCGACCAGCAGGTGTGCACAGG - Intronic
1160609225 18:80073085-80073107 GGCGACCAGCAGGTGTGCACAGG - Intronic
1160609236 18:80073121-80073143 GGCGACCAGCAGGTGTGCACAGG - Intronic
1160609247 18:80073157-80073179 GGCGACCAGCAGGTGTGCACAGG - Intronic
1160609279 18:80073247-80073269 GGCGACCAGCAGGTGTGCACAGG - Intronic
1160609290 18:80073283-80073305 GGCGACCAGCAGGTGTGCACAGG - Intronic
1160609301 18:80073318-80073340 GGCGACCAGCAGGTGTGCACAGG - Intronic
1160609322 18:80073391-80073413 GGTGACCAGCAGGTGTGCACAGG - Intronic
1160609335 18:80073428-80073450 GGCGACCAGCAGGTGTGCACAGG - Intronic
1160609366 18:80073537-80073559 GGTGACCAGCAGGTGTGCACAGG - Intronic
1164655476 19:29918042-29918064 GTTGACCACCAAGTGGCCAATGG + Intergenic
1202666397 1_KI270708v1_random:124293-124315 CTTGACTAGCAAGTGTGGACAGG - Intergenic
926525625 2:13976398-13976420 TTTGACCAGCATGTGTGCAGTGG + Intergenic
928732746 2:34251550-34251572 GCTGATGAGAAAGTGAGCACTGG - Intergenic
933414441 2:81968456-81968478 GTTGACAAGAAAATAAGCACTGG + Intergenic
935349296 2:102140027-102140049 GTTGACCAGCAGGTGGGAAGGGG - Intronic
940188970 2:151018351-151018373 TTTGACCTGCAAGTGAGACCTGG - Intronic
941147167 2:161862882-161862904 CTTGACCAACAAGTGAGCTCAGG + Exonic
942163978 2:173223262-173223284 GTTGTCAAGCAACTGAGCCCAGG - Intronic
943960338 2:194255230-194255252 GTTCATGAGCAAGTGAACACAGG - Intergenic
944999049 2:205329105-205329127 GTTGAGCACCAAGTATGCACAGG + Intronic
947421169 2:229942642-229942664 GTGGAGCAGCAAGTAGGCACTGG - Intronic
947424652 2:229972525-229972547 AGTGACCAGCAAGTGAACAGAGG + Intronic
948219398 2:236257722-236257744 GTTGACCAGCAAGTGAACACAGG + Intronic
1168821205 20:774880-774902 GTTGCACAGCCGGTGAGCACAGG - Intergenic
1172007905 20:31830091-31830113 GTTGCCCAGCAAGTAAGCGACGG - Intronic
1173897731 20:46563420-46563442 TTTGACCAGCAAGTGTCCAGAGG + Exonic
1175395532 20:58657027-58657049 GTGGCCCAGGAGGTGAGCACGGG - Intronic
1179442229 21:41403352-41403374 GGTGACTAGCAAGTGAACTCTGG - Intronic
1181519824 22:23439108-23439130 GAAGACCAGCAAGTTGGCACAGG - Intergenic
1183267766 22:36839815-36839837 GTTGAGCAGCAAGAGAGCCTCGG - Intergenic
952385178 3:32835945-32835967 AATGACCAGCAAGTCAGTACAGG - Intronic
953109610 3:39921268-39921290 ATCAACCAGCAAGTGAGCACTGG + Intronic
953528091 3:43712219-43712241 GTTGCCCTGCTGGTGAGCACTGG + Intronic
955735099 3:62030588-62030610 GTTGACCAGCAAGTGAGCACTGG + Intronic
958835685 3:99141952-99141974 CTAGTCCAGCAAGTGAGCAAAGG - Intergenic
960039827 3:113139649-113139671 GGAGACCAGCAACTCAGCACTGG + Intergenic
969624543 4:8295616-8295638 GTTGGCCAGGAGGTGGGCACAGG - Intronic
969942668 4:10750169-10750191 GCTGAGCAGCAAGTGAGGAGGGG - Intergenic
975505624 4:75133636-75133658 GTAGACCTGCAAGTGGCCACAGG + Intergenic
988304869 5:29481156-29481178 AGTGACCACCAAGTGACCACAGG - Intergenic
991197486 5:63953410-63953432 TGTCTCCAGCAAGTGAGCACAGG + Intergenic
991973068 5:72159488-72159510 GTGGACTAGCAAGTAAACACTGG + Intronic
993867213 5:93209797-93209819 GTTGACCAGCAGGAAAGCAGGGG - Intergenic
1001040080 5:168328326-168328348 GTTCACCAGCAAGTGAAGAAAGG - Intronic
1002303172 5:178268976-178268998 GGTGACCAGCAAGGGCCCACTGG + Intronic
1004018564 6:11755089-11755111 GTTGCCAAGGATGTGAGCACTGG + Intronic
1008959318 6:57249769-57249791 TTTGACCAGCACGTTAGCATAGG - Intergenic
1013276448 6:108589576-108589598 GTGGACCTGCAAGTCTGCACTGG - Intronic
1018111627 6:160541981-160542003 GGAGAACAGCAATTGAGCACAGG + Intronic
1019979698 7:4612392-4612414 GTTCAGCAGGAAGTGAGCAGCGG + Intergenic
1022589108 7:31643866-31643888 GGTGACCAGTTAGTGAACACAGG - Exonic
1033257406 7:139814182-139814204 GTTGATCAGGAAGTGAGCTGAGG - Intronic
1033529161 7:142245612-142245634 GATCACCAGCAAGTGAGCCTCGG - Intergenic
1037307896 8:17524889-17524911 TATAAGCAGCAAGTGAGCACAGG - Intronic
1037888531 8:22608141-22608163 GTTGGCCAGGAAGTGAACCCAGG + Intronic
1040429696 8:47327429-47327451 GTTGCCCAGCTAGAGTGCACTGG + Intronic
1041332136 8:56738321-56738343 TTTCACCAGCCAGTGAGCACAGG - Intergenic
1047173713 8:122520401-122520423 CATGACTAGCAAGTAAGCACAGG - Intergenic
1047432126 8:124801703-124801725 CTGGACCAGCAAGTCAGCAAAGG + Intergenic
1049276538 8:141722891-141722913 GTTGCCCAGCCAGGGAGCAGAGG + Intergenic
1049777296 8:144412666-144412688 GCTGAGGAGCAAGTGGGCACCGG + Exonic
1052361409 9:27564497-27564519 ATTGACCAGCAAATAAGGACTGG + Intronic
1053011863 9:34638051-34638073 CTTCACCAGCCAGTGAGCTCGGG - Intergenic
1056209130 9:84348794-84348816 GTGGAAAGGCAAGTGAGCACAGG - Intergenic
1057504133 9:95618579-95618601 GCTGACCAACAAGGGAGCCCCGG + Intergenic
1060324515 9:122600247-122600269 TTTGATCAGCAAGTGAGGCCTGG - Intergenic
1061670420 9:132185271-132185293 GTTGATCAGCAAGAAAGCCCAGG + Intronic
1062598700 9:137310656-137310678 TTTGTCCAGGAAGTGACCACTGG - Intronic
1186101614 X:6163463-6163485 GTTGAAAAGCAATGGAGCACAGG - Intronic
1189705768 X:43757157-43757179 GTGGACAAGCAGGTGGGCACAGG - Intergenic
1195993728 X:110710100-110710122 GTTGACCAGACAGTCAGCATGGG - Intronic
1198802325 X:140460426-140460448 GGTGGCCAGCAAGTGACAACTGG + Intergenic
1199497069 X:148464345-148464367 GCTGACCAGGAAGTGAGCATGGG + Intergenic