ID: 955737702

View in Genome Browser
Species Human (GRCh38)
Location 3:62057322-62057344
Sequence CAGTGTAAACTGGAGGATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 224}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955737702_955737705 -7 Left 955737702 3:62057322-62057344 CCTTCATCCTCCAGTTTACACTG 0: 1
1: 0
2: 0
3: 15
4: 224
Right 955737705 3:62057338-62057360 TACACTGTTTTCTGTTGTCCAGG 0: 1
1: 0
2: 1
3: 22
4: 247
955737702_955737706 0 Left 955737702 3:62057322-62057344 CCTTCATCCTCCAGTTTACACTG 0: 1
1: 0
2: 0
3: 15
4: 224
Right 955737706 3:62057345-62057367 TTTTCTGTTGTCCAGGAAGATGG 0: 1
1: 0
2: 5
3: 39
4: 373

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955737702 Original CRISPR CAGTGTAAACTGGAGGATGA AGG (reversed) Intronic
900133858 1:1105127-1105149 CAGAATAAACTGGAGTCTGATGG + Intronic
900621789 1:3590911-3590933 CCCTGTGAGCTGGAGGATGATGG - Intronic
902161886 1:14537127-14537149 GAGTGTAAACTGGAGGTTTGTGG - Intergenic
902432887 1:16377196-16377218 AAGTGAAATCTGGTGGATGAGGG + Intronic
902568186 1:17329209-17329231 CTGTGTATACAGGAGGCTGAGGG + Intronic
902839340 1:19065346-19065368 CAGGGTAACCGGGAGGAGGACGG + Intergenic
904208106 1:28868034-28868056 CCATGGAAACTGGAGGAGGAGGG + Intergenic
904796847 1:33062607-33062629 CAGGGTAGATTGGAGGATAAGGG + Intronic
907250810 1:53137815-53137837 CAGTCCAAACTGGAGCAGGAAGG - Intronic
907909252 1:58812875-58812897 CAGGGAAAAGAGGAGGATGATGG - Intergenic
910149845 1:84129857-84129879 GAGTCTAAGCTGGAGGATGTAGG - Intronic
910505255 1:87943195-87943217 CAGTGAAACCTAAAGGATGAGGG + Intergenic
910523934 1:88155884-88155906 TAGTGTGAAGTGGAGGATGGAGG - Intergenic
911020510 1:93382512-93382534 CAGTGTAAAATGGTAGATAAAGG + Intergenic
912450941 1:109767370-109767392 CAGGGTGAACAGGATGATGATGG - Intronic
912577120 1:110682998-110683020 CAGTGTTAACTGGATCATTATGG - Intergenic
913319943 1:117581185-117581207 CAGGGAAGACTGGAGAATGAAGG + Intergenic
916676621 1:167069212-167069234 CCCTGGAAACTGGGGGATGAGGG - Intronic
916744755 1:167676605-167676627 CAGTGTAATTTGGGAGATGATGG - Intronic
916839246 1:168583232-168583254 CAGTGTAATATGTGGGATGATGG + Intergenic
918315185 1:183317242-183317264 CAGGGTATGCTGGAGGATGTGGG - Intronic
919351531 1:196461625-196461647 CAGAGTAAACTGGAGCATCCGGG - Intronic
920377320 1:205516145-205516167 CAGGGTCAGCTGGAGGATGAAGG + Intronic
921133447 1:212239343-212239365 TAGTTTAACCTGGAGGGTGAAGG - Intergenic
921884153 1:220287639-220287661 CAGTGAAAAGTGAAGGAGGATGG - Intergenic
924217982 1:241845094-241845116 CAGTGTAAAGGTGAAGATGAAGG - Intergenic
1064063274 10:12157999-12158021 CAGGGCCGACTGGAGGATGATGG - Exonic
1064358316 10:14639843-14639865 CAGTGTTAGCTGAAGGAGGAAGG - Intronic
1065781201 10:29169613-29169635 GATTGGAAACTGGAGGAAGAGGG - Intergenic
1067805952 10:49394065-49394087 CAGTGTACCCTAGGGGATGAGGG - Intronic
1070270298 10:74947661-74947683 AAGGGTAAACTGTAGGAAGAAGG - Intronic
1070602255 10:77873976-77873998 CAGTGTGAGCTGGAGGAGGGCGG - Intronic
1072889127 10:99306271-99306293 GAGGGTAAAATGGAGGAGGAGGG - Intergenic
1076055919 10:127372820-127372842 CACTCTAAACTGAAGGAAGATGG - Intronic
1076942685 10:133620321-133620343 CAGTGGAAGCTGGAGGATGCCGG - Intergenic
1077443527 11:2579589-2579611 CCTTGTTAACTTGAGGATGAGGG + Intronic
1078920672 11:15827234-15827256 AAGTGTAAACAGGAGGTTGGGGG - Intergenic
1079430422 11:20384494-20384516 CAGTATACACTGGAGGATAAAGG + Intergenic
1080881563 11:36326197-36326219 GGGTGTATATTGGAGGATGAAGG - Intronic
1082236442 11:49823812-49823834 CAGTGTAGACTGTAGTGTGAGGG + Intergenic
1085597178 11:77820712-77820734 CATTTTGAACTGGAGGATGGAGG + Exonic
1085835567 11:79952501-79952523 GAGTGAAACCTGGAGGATAAAGG - Intergenic
1087490307 11:98817982-98818004 CATTGTAAACTGAATGATAATGG + Intergenic
1088563799 11:111146073-111146095 AACTGTAAACTGGAGGATCTTGG + Intergenic
1091628356 12:2139810-2139832 CAGTGTGAACTGGAGGTGTAAGG + Intronic
1092226908 12:6753462-6753484 AAGGGGAAACTGGAGGACGAGGG + Exonic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1098243962 12:68497062-68497084 AAGTGTAAACTACAAGATGAGGG + Intergenic
1098519929 12:71423621-71423643 CAGTGTGAGCAAGAGGATGATGG - Intronic
1100182713 12:92102864-92102886 CAGTTCAAACTGGGGGAAGAGGG + Intronic
1100760594 12:97802706-97802728 CACTGTAAACTGGAACATGGTGG - Intergenic
1101329581 12:103746662-103746684 GAGTGTAACCTGGATTATGAAGG + Exonic
1102224296 12:111217024-111217046 CACAGGAAACTGGAGGATTAGGG + Intronic
1103046569 12:117740023-117740045 CAGTGTATACTGTTGGGTGATGG - Intronic
1104071535 12:125350084-125350106 CAGTGTCCTCTGGAGGAGGAAGG + Exonic
1106537741 13:30662706-30662728 CAGTGTGAACTGAAAGAGGAAGG + Intergenic
1107022870 13:35769118-35769140 CAGCTTAAACTGAAGGATTAGGG + Intronic
1107266894 13:38566640-38566662 CATTCTGAATTGGAGGATGATGG - Intergenic
1107712870 13:43168073-43168095 CACTGTCAACTGGAGAATCATGG + Intergenic
1108288500 13:48933164-48933186 CAGTGTATACTGTTGGGTGATGG - Intergenic
1108536376 13:51384674-51384696 CAGTTAAATATGGAGGATGAGGG - Intronic
1109096660 13:58127573-58127595 CAATGTAAAATGGAGGGGGAAGG - Intergenic
1109198034 13:59400654-59400676 CAGTGGAAAATGGAGGCTGGTGG - Intergenic
1110390771 13:74971142-74971164 CACTGTAAAATGAAGGTTGATGG - Intergenic
1112776232 13:102846431-102846453 CAGTGGCATCTGCAGGATGATGG + Intronic
1113029728 13:105979671-105979693 CAGTGTAAACACGATGATTATGG - Intergenic
1113386869 13:109857071-109857093 CAGGGTAAGCAGGAAGATGATGG + Intergenic
1115178555 14:30594826-30594848 CAGTTAAAAGTGCAGGATGAAGG + Intronic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1118181069 14:63493935-63493957 CTGTTTAAACTGTAGGAAGAAGG + Intronic
1118863021 14:69680217-69680239 CAGTGGAAACTGGGGCATGTGGG - Intronic
1118917753 14:70122140-70122162 CAGAGAAAACTGGGGGACGAGGG + Intronic
1119751741 14:77083520-77083542 CGGTGTAAACTGCAGCATAAAGG + Intergenic
1120778853 14:88467408-88467430 TAATGTAAAGTTGAGGATGAAGG - Exonic
1120963962 14:90151011-90151033 AAGTGTGAACAGGAGGAAGAAGG - Intronic
1122777754 14:104129816-104129838 CAATGAAAACTAGAAGATGATGG - Intergenic
1123756746 15:23402847-23402869 CAGTGTGGACTGGAAGATGGCGG - Intergenic
1124816759 15:33001599-33001621 CACTCTAAACTCGAGGAGGAGGG - Intronic
1127028632 15:54836030-54836052 AAGTGTTAACTGGACCATGAAGG - Intergenic
1128040140 15:64564771-64564793 CACTGTAATCTAGTGGATGAAGG - Intronic
1128542882 15:68549322-68549344 CAGTGTAAACTCCAGGAAGGAGG - Intergenic
1129849578 15:78785069-78785091 CAGTCTAAACTGGAGGACACAGG + Intronic
1129927641 15:79379994-79380016 CAGTGTACACTGGAGAATTCTGG + Intronic
1130252687 15:82310612-82310634 CAGTCTAAACTGGAGGACAGAGG - Intergenic
1130635969 15:85620283-85620305 CTGTGCACAGTGGAGGATGAGGG + Intronic
1130695811 15:86130128-86130150 CACTCTATACTGGAGCATGAGGG + Intergenic
1133230148 16:4362531-4362553 TAGGGTACACAGGAGGATGACGG + Intronic
1133394431 16:5434843-5434865 CAGTGAAAACTGGAGGCTTAAGG - Intergenic
1133423999 16:5671846-5671868 CAGTGTGAGCTGGGGGTTGAAGG + Intergenic
1134027915 16:10968465-10968487 CAATGAAAACTGGGTGATGAGGG - Intronic
1135934371 16:26767268-26767290 CATTTTAAAGTGGAGGAGGAAGG - Intergenic
1137039565 16:35598062-35598084 AACTGTAAACTTAAGGATGAGGG + Intergenic
1141897294 16:86966230-86966252 CAGTGGAAGCTGGAGGAGGAAGG - Intergenic
1146349660 17:32083995-32084017 GAGTGAAAAGTGGAGGGTGATGG - Intergenic
1148999170 17:51739478-51739500 CAGAGTCAAGTGGAGGAGGATGG + Intronic
1149169075 17:53788492-53788514 CTGTGTAAACTGGGGGCTGTTGG - Intergenic
1149433140 17:56610512-56610534 CAGTGTGAAATGGAGAAGGAAGG - Intergenic
1150343435 17:64386880-64386902 CTGTGTTAACTGGAGGCTCAGGG + Intronic
1151301514 17:73230741-73230763 CAGTGTTTAATGGAGTATGATGG - Intronic
1151428909 17:74049512-74049534 TAGCGTAAGCTGCAGGATGAGGG - Intergenic
1154060344 18:11054675-11054697 CAGTGTTCACTGGAGAATGAGGG - Intronic
1155288824 18:24320390-24320412 CACTTTAGATTGGAGGATGAGGG + Intronic
1156016361 18:32551352-32551374 CACTGTAAAATGGGGGACGATGG + Intergenic
1157784388 18:50469018-50469040 CAATTTAAACTAGAGGATCATGG - Intergenic
1158771291 18:60520606-60520628 CAGTGGAAACAGGAGCTTGAAGG + Intergenic
1160209102 18:76861327-76861349 CAGTGAGAACGGGAGGAGGAAGG + Intronic
1160398345 18:78588652-78588674 CAGAGCAAGCTGGAGAATGAGGG + Intergenic
1168527878 19:57103327-57103349 CAGTGTAACCAGGTGGATAATGG - Intergenic
925119621 2:1407827-1407849 CAGTGTAATCTTGAAGATGTGGG - Intronic
926531734 2:14055506-14055528 CAGTGGAAAGTGGAGGCTGGTGG - Intergenic
927495847 2:23551182-23551204 CAGCGTAAACTGAGGGAAGAAGG - Intronic
928194752 2:29207139-29207161 CAGGGATACCTGGAGGATGATGG + Intronic
930887782 2:56347703-56347725 CAGAGTGAACTGGAGGAGGGTGG + Intronic
931370863 2:61661283-61661305 CAGTGGAGACTGGAGGCTGCAGG - Intergenic
932094656 2:68837014-68837036 CAGTGTTAGCGTGAGGATGAGGG + Intergenic
933120584 2:78531896-78531918 CAGTGTAAACTGTATGAGCAAGG + Intergenic
935309053 2:101765030-101765052 CAAGGTAAACTTGAGGATAAAGG + Intronic
935628801 2:105194936-105194958 CATTGTAAGCTGGTGGATAAAGG - Intergenic
936073878 2:109389291-109389313 CTGTGCAAACAGGAGGAAGAGGG + Intronic
936659645 2:114528468-114528490 CAGTCCAAACTCTAGGATGAGGG + Intronic
937919861 2:127121404-127121426 CACTGTAAACTCAAAGATGAAGG + Intergenic
938083143 2:128380882-128380904 CAGGATGAACTGGAGGGTGAGGG - Intergenic
938828523 2:135031210-135031232 AAGTGAATACAGGAGGATGATGG + Intronic
939318672 2:140586574-140586596 CAGTGTCACCTAGAGGATGATGG - Intronic
940037239 2:149323759-149323781 CAGTGCAAATTGAAGGCTGAAGG + Intergenic
940512374 2:154633580-154633602 CAGTGTAGACTGGAGAAAGGGGG - Intergenic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
944856746 2:203775490-203775512 CAGAGCAAGCTGGAGGATGGGGG - Intergenic
946469225 2:219940835-219940857 CAGTGCAAAATGGATGAAGATGG + Intergenic
949060850 2:241956545-241956567 CAGTGCACACGTGAGGATGATGG + Intergenic
1168810874 20:703788-703810 CAGTGTGAACAGGAAGTTGACGG + Intergenic
1169149960 20:3281807-3281829 CATTGCAAAGTGGAGGAAGAGGG + Intronic
1169366717 20:4998513-4998535 CAGCTTAACCTGGAGGAGGATGG + Intronic
1171466190 20:25329409-25329431 CAGTGAAAACTGGGGGAAGCAGG - Intronic
1172634650 20:36401797-36401819 CACTGTAGACTGAAGGATCAGGG + Intronic
1182676723 22:32044718-32044740 TTGAGTAAACTGGAGGCTGAGGG - Intronic
1184877068 22:47282725-47282747 CAGAGTAAGCTGGAGGCTGGGGG - Intergenic
1185211692 22:49574184-49574206 CAGAGAAAACTGGAGAGTGATGG + Intronic
949368641 3:3310460-3310482 CAGTGTGAGCTGGAGGCAGAGGG - Intergenic
949470516 3:4391090-4391112 CAGTGGAGACCAGAGGATGATGG - Intronic
950932406 3:16803606-16803628 CAGAGGAAGCTTGAGGATGAGGG + Intronic
955737702 3:62057322-62057344 CAGTGTAAACTGGAGGATGAAGG - Intronic
957230820 3:77511644-77511666 CAGTGGTCACTGGAGGATGAAGG + Intronic
957318867 3:78603694-78603716 CAATGTAAACTGAATTATGAAGG + Intronic
958484729 3:94690330-94690352 GAGTGTAAACTCAAGGAGGATGG + Intergenic
958706385 3:97661971-97661993 CAGTATATACTGGGGGAAGAGGG - Intronic
961001252 3:123375526-123375548 CAGAGCAATCTGGAGAATGAGGG + Intronic
961601672 3:128067045-128067067 CAGGGCAGACTGCAGGATGATGG - Exonic
961920818 3:130424240-130424262 CAGTGTTAACTCCAGGTTGATGG + Intronic
962221612 3:133569091-133569113 ATGTGTGAACTGAAGGATGAGGG - Intergenic
962425620 3:135266786-135266808 TAGTGTATGCTGGAGGAGGAAGG - Intergenic
963213818 3:142723462-142723484 CAGTGTATACTGCTCGATGATGG + Intergenic
963298857 3:143577251-143577273 TAGTGAGAAATGGAGGATGAGGG - Intronic
965433868 3:168622341-168622363 CAGTTTAAATTGTAGGATGATGG + Intergenic
966458106 3:180141312-180141334 CATTGTATGCTGGAGTATGATGG - Intergenic
966946960 3:184783545-184783567 TAGAATAAACTGGAGGATGGGGG + Intergenic
967842648 3:194019216-194019238 AAGTGTAACCAGGAGGGTGATGG - Intergenic
968268524 3:197381369-197381391 CAGTAAAAAGTGGATGATGAGGG - Intergenic
968275812 3:197439560-197439582 CAGTGTCCACTGGAGCAAGAAGG - Intergenic
969884907 4:10206697-10206719 CAGTGTGAGGTGGGGGATGACGG + Intergenic
970168419 4:13264062-13264084 GAGTGTCTACTGGAGGATGGAGG - Intergenic
976040896 4:80884020-80884042 CAGTGCATACTGGAGGGTGAAGG - Intronic
976266784 4:83192640-83192662 CAATGTCAACTGGAGAATAATGG + Intergenic
979211855 4:118114240-118114262 TAGGGAAAACTGAAGGATGAAGG - Intronic
979277532 4:118830219-118830241 CAGTTTAAACTAAAGCATGAAGG + Intronic
979540119 4:121871021-121871043 CAGTGTACACTGGTGGGTGACGG - Intergenic
980054322 4:128065029-128065051 CAGTGAAGACTGGAGAATGAAGG - Intronic
980706768 4:136507232-136507254 CCGTGTGAACAAGAGGATGATGG + Intergenic
984611767 4:181848460-181848482 CAGTGCAATATGAAGGATGATGG + Intergenic
984907830 4:184646611-184646633 AAGTGTAAAATGGAGGATCTCGG + Intronic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
986217439 5:5732667-5732689 CAGGGTACACTGGAGGGTGGAGG - Intergenic
987495288 5:18635444-18635466 CAGTACAAACTGAAGAATGATGG - Intergenic
988238108 5:28573334-28573356 CAGTTCAAAGTGGAGGAGGATGG - Intergenic
988437276 5:31191142-31191164 CCCTGTGGACTGGAGGATGAAGG + Intergenic
990044656 5:51414533-51414555 GAGTGTGGACTAGAGGATGAGGG - Intergenic
991563375 5:67978901-67978923 CTGGGTAAATTGGAGGAGGAGGG - Intergenic
992500693 5:77339754-77339776 CAGTCTGTACTGCAGGATGATGG + Intronic
992846676 5:80756489-80756511 TAGTGGAAAATGGAGGGTGAAGG - Intronic
993319657 5:86457306-86457328 CTATTTTAACTGGAGGATGATGG - Intergenic
996985136 5:129552886-129552908 TAATGTAAAGTGGATGATGATGG + Intronic
997606774 5:135180486-135180508 GAGTGCACAGTGGAGGATGAAGG - Intronic
998721600 5:144957918-144957940 CAATGTATACTGGAGGAGGCGGG + Intergenic
999796129 5:154991358-154991380 AAGTGTAAACTCTAGGAAGAGGG + Intergenic
1003091594 6:3108540-3108562 CAGTGTAAGCTGGAGGTGGTGGG + Intronic
1003312810 6:4984128-4984150 CAGTGTAACCTGCTGGATCATGG - Intergenic
1008828294 6:55726547-55726569 CTGTGAAAAATGGAGGAAGAGGG - Intergenic
1010585819 6:77657885-77657907 TAGTGTGAACAGGAGGAGGAGGG - Intergenic
1012556643 6:100521687-100521709 CAGGCCAAACTGGAGGATGTGGG + Intronic
1016589409 6:145728320-145728342 CAGAGGAAGCAGGAGGATGAAGG + Intronic
1016782579 6:147976114-147976136 CAGTGTAAATGGGAAGGTGATGG + Intergenic
1016921718 6:149301363-149301385 CATTATAAACTGGAGTATTAAGG + Intronic
1017367035 6:153655139-153655161 CAGTGTAAAAAGGTGGATGGGGG - Intergenic
1018309606 6:162494202-162494224 CTGTGTAAGCTGCAGAATGAAGG - Intronic
1019415235 7:924011-924033 CAGTGTAACCTGGAGGGCGGGGG - Intronic
1019415337 7:924345-924367 CAGTGTAACCCGGAGGGTGGGGG - Intronic
1019415372 7:924462-924484 CTGTGTAACCTGGAGGGTGGGGG - Intronic
1020504599 7:8968064-8968086 CAGTGCGAACTGGTGAATGATGG + Intergenic
1021566899 7:22025030-22025052 CAGTGTCTAGTGTAGGATGATGG + Intergenic
1022047510 7:26633925-26633947 CAGTGTATACTGCTGGGTGATGG + Intergenic
1022970746 7:35514517-35514539 CAGTGCAACATGGAGGGTGAGGG - Intergenic
1023409157 7:39871506-39871528 AAGGGCAAACTGGTGGATGATGG - Intergenic
1023465201 7:40447105-40447127 CAGTGGAAGCTGGGGGAAGATGG - Intronic
1024610465 7:51059750-51059772 TAGTGCAAACAGCAGGATGAGGG - Intronic
1025043773 7:55672529-55672551 AAGGGCAAACTGGTGGATGATGG + Intergenic
1026632952 7:72053733-72053755 CAGTGTATACTGCTGGGTGATGG - Intronic
1028723357 7:94059126-94059148 CACTGTGCACTGGAGGATGGAGG - Intergenic
1028818823 7:95182070-95182092 CAGTGTATACTGCTGGGTGATGG + Intronic
1029129221 7:98317584-98317606 CGGTGTGAACTGAGGGATGAGGG - Intronic
1030091278 7:105861233-105861255 CTGTGTTAACTGGTCGATGAGGG + Intronic
1031956194 7:127944928-127944950 CAGTGTAATCTCTAGGAAGATGG - Intronic
1032246799 7:130220230-130220252 CAGGGCACACTGGAGGATGAGGG - Intergenic
1033544689 7:142389298-142389320 CAGTGTAAAGTGGAGGACACAGG - Intergenic
1034465160 7:151223691-151223713 CAGTGGGGGCTGGAGGATGAGGG - Exonic
1034705921 7:153144344-153144366 CAGTTGGAAATGGAGGATGAAGG - Intergenic
1039861028 8:41457823-41457845 CAGCATACACTGAAGGATGAAGG - Intergenic
1041559033 8:59193444-59193466 CAGTGCAAGCTTGAGGGTGATGG - Intergenic
1042466110 8:69131651-69131673 CTGATTAAACTGGATGATGAGGG + Intergenic
1043662172 8:82757893-82757915 CACTGTAAATTAGATGATGAAGG + Intergenic
1046542096 8:115598789-115598811 CAATGGAAACTGGAGGAAGGAGG - Intronic
1048172662 8:132122591-132122613 CAGTGCTATCTGGAGGATGAAGG + Exonic
1049330635 8:142048650-142048672 CACTGTAAACTGGAGGAGTAAGG + Intergenic
1052602391 9:30651769-30651791 CAGTGTAAACTCCAGAAAGAAGG - Intergenic
1055961444 9:81824370-81824392 AAGTGTGAACTGGAGTATGCTGG + Intergenic
1056298773 9:85220812-85220834 GAGTGGAAACAGGTGGATGAAGG + Intergenic
1057022185 9:91707843-91707865 CAGTGTGGACAGGAGGATGGGGG + Intronic
1059351478 9:113668489-113668511 CAGTGTAGTTTGGAGGATCAGGG - Intergenic
1061396535 9:130346793-130346815 CACTGGAAAGTGGAGGACGACGG + Intronic
1186533913 X:10327878-10327900 CAGCGTCAACTAGAGGATGGAGG + Intergenic
1188655627 X:32691757-32691779 CAGTGTCCACTGATGGATGAGGG + Intronic
1191641673 X:63433857-63433879 CAGTATAAGCTGGACAATGATGG - Intergenic
1193479225 X:82006864-82006886 CGGGGTATACTTGAGGATGAAGG - Intergenic
1197266925 X:124384263-124384285 CAGTATAAAATGGATGAAGATGG - Exonic
1198184371 X:134238776-134238798 CAGTTCAAACTGGAGAAGGAGGG + Exonic
1199637975 X:149831603-149831625 CACTGTGACCTTGAGGATGAGGG - Intergenic
1199977592 X:152903595-152903617 CAGAGACAACTGCAGGATGAGGG + Intergenic
1200366055 X:155665752-155665774 CAGTGAGAAGTGGGGGATGAAGG + Intronic
1201266033 Y:12207615-12207637 CAGTGTCCACTGATGGATGATGG - Intergenic