ID: 955739357

View in Genome Browser
Species Human (GRCh38)
Location 3:62073722-62073744
Sequence CTTTGTGAGGCCAAGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270574
Summary {0: 8, 1: 1404, 2: 26762, 3: 81732, 4: 160668}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955739357_955739363 -8 Left 955739357 3:62073722-62073744 CCATCCACCTTGGCCTCACAAAG 0: 8
1: 1404
2: 26762
3: 81732
4: 160668
Right 955739363 3:62073737-62073759 TCACAAAGTGCTGGGATTACAGG 0: 1786
1: 298626
2: 265319
3: 148850
4: 129231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955739357 Original CRISPR CTTTGTGAGGCCAAGGTGGA TGG (reversed) Intronic
Too many off-targets to display for this crispr