ID: 955744417

View in Genome Browser
Species Human (GRCh38)
Location 3:62125884-62125906
Sequence AGACAAGAAGGTTTTGGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 384
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 354}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955744417_955744423 27 Left 955744417 3:62125884-62125906 CCTTTCCCAAAACCTTCTTGTCT 0: 1
1: 0
2: 1
3: 28
4: 354
Right 955744423 3:62125934-62125956 AAGGACAAAAATCACCATGCGGG 0: 1
1: 0
2: 1
3: 20
4: 255
955744417_955744422 26 Left 955744417 3:62125884-62125906 CCTTTCCCAAAACCTTCTTGTCT 0: 1
1: 0
2: 1
3: 28
4: 354
Right 955744422 3:62125933-62125955 GAAGGACAAAAATCACCATGCGG 0: 1
1: 1
2: 2
3: 23
4: 261
955744417_955744421 8 Left 955744417 3:62125884-62125906 CCTTTCCCAAAACCTTCTTGTCT 0: 1
1: 0
2: 1
3: 28
4: 354
Right 955744421 3:62125915-62125937 CAGTGTATTAAAAAGACAGAAGG 0: 1
1: 1
2: 11
3: 29
4: 419

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955744417 Original CRISPR AGACAAGAAGGTTTTGGGAA AGG (reversed) Intronic