ID: 955744952

View in Genome Browser
Species Human (GRCh38)
Location 3:62131257-62131279
Sequence ACGAAAAACGTCTCCAGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 26, 3: 75, 4: 169}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955744949_955744952 -3 Left 955744949 3:62131237-62131259 CCTCCCACTGCTATGTGACAACG 0: 1
1: 0
2: 1
3: 6
4: 87
Right 955744952 3:62131257-62131279 ACGAAAAACGTCTCCAGACATGG 0: 1
1: 0
2: 26
3: 75
4: 169
955744944_955744952 10 Left 955744944 3:62131224-62131246 CCCTTCTCATCCCCCTCCCACTG 0: 1
1: 1
2: 5
3: 100
4: 894
Right 955744952 3:62131257-62131279 ACGAAAAACGTCTCCAGACATGG 0: 1
1: 0
2: 26
3: 75
4: 169
955744940_955744952 16 Left 955744940 3:62131218-62131240 CCCCTCCCCTTCTCATCCCCCTC 0: 1
1: 6
2: 81
3: 603
4: 3267
Right 955744952 3:62131257-62131279 ACGAAAAACGTCTCCAGACATGG 0: 1
1: 0
2: 26
3: 75
4: 169
955744948_955744952 -2 Left 955744948 3:62131236-62131258 CCCTCCCACTGCTATGTGACAAC 0: 1
1: 0
2: 0
3: 13
4: 145
Right 955744952 3:62131257-62131279 ACGAAAAACGTCTCCAGACATGG 0: 1
1: 0
2: 26
3: 75
4: 169
955744946_955744952 0 Left 955744946 3:62131234-62131256 CCCCCTCCCACTGCTATGTGACA 0: 1
1: 0
2: 1
3: 16
4: 214
Right 955744952 3:62131257-62131279 ACGAAAAACGTCTCCAGACATGG 0: 1
1: 0
2: 26
3: 75
4: 169
955744943_955744952 11 Left 955744943 3:62131223-62131245 CCCCTTCTCATCCCCCTCCCACT 0: 1
1: 2
2: 16
3: 213
4: 2208
Right 955744952 3:62131257-62131279 ACGAAAAACGTCTCCAGACATGG 0: 1
1: 0
2: 26
3: 75
4: 169
955744941_955744952 15 Left 955744941 3:62131219-62131241 CCCTCCCCTTCTCATCCCCCTCC 0: 1
1: 9
2: 132
3: 1242
4: 6425
Right 955744952 3:62131257-62131279 ACGAAAAACGTCTCCAGACATGG 0: 1
1: 0
2: 26
3: 75
4: 169
955744945_955744952 9 Left 955744945 3:62131225-62131247 CCTTCTCATCCCCCTCCCACTGC 0: 1
1: 0
2: 9
3: 131
4: 1362
Right 955744952 3:62131257-62131279 ACGAAAAACGTCTCCAGACATGG 0: 1
1: 0
2: 26
3: 75
4: 169
955744947_955744952 -1 Left 955744947 3:62131235-62131257 CCCCTCCCACTGCTATGTGACAA 0: 1
1: 0
2: 0
3: 17
4: 175
Right 955744952 3:62131257-62131279 ACGAAAAACGTCTCCAGACATGG 0: 1
1: 0
2: 26
3: 75
4: 169
955744942_955744952 14 Left 955744942 3:62131220-62131242 CCTCCCCTTCTCATCCCCCTCCC 0: 1
1: 9
2: 78
3: 664
4: 3438
Right 955744952 3:62131257-62131279 ACGAAAAACGTCTCCAGACATGG 0: 1
1: 0
2: 26
3: 75
4: 169
955744950_955744952 -6 Left 955744950 3:62131240-62131262 CCCACTGCTATGTGACAACGAAA 0: 1
1: 0
2: 1
3: 10
4: 140
Right 955744952 3:62131257-62131279 ACGAAAAACGTCTCCAGACATGG 0: 1
1: 0
2: 26
3: 75
4: 169
955744951_955744952 -7 Left 955744951 3:62131241-62131263 CCACTGCTATGTGACAACGAAAA 0: 1
1: 0
2: 2
3: 14
4: 112
Right 955744952 3:62131257-62131279 ACGAAAAACGTCTCCAGACATGG 0: 1
1: 0
2: 26
3: 75
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955744952 Original CRISPR ACGAAAAACGTCTCCAGACA TGG Intronic
900522791 1:3113707-3113729 ACCAAACACATCCCCAGACATGG + Intronic
900884885 1:5408103-5408125 ACCAAAAGTGTCTCCAGACATGG + Intergenic
901538210 1:9897162-9897184 ACAAAAAACGTGGCCAGGCACGG + Intronic
901782827 1:11605349-11605371 TCCAAAAATGTCTCCAGTCATGG + Intergenic
902175442 1:14646688-14646710 AACAAAAATGTCTCCAGACATGG + Intronic
903700755 1:25246801-25246823 ACGAAAACCGGCTCGAGACGCGG + Exonic
903771047 1:25764566-25764588 ACAAAAAAAGTAGCCAGACATGG - Intronic
904155942 1:28483237-28483259 ACAAAAAACTTAGCCAGACATGG + Intronic
904995012 1:34624937-34624959 AGGAAAAAGTGCTCCAGACAAGG + Intergenic
905217152 1:36416870-36416892 ATGTAAAATGTCTCCAGCCAGGG - Intronic
905751136 1:40465090-40465112 GTCAAAAATGTCTCCAGACATGG + Intergenic
905775795 1:40666301-40666323 ACCAAAAATGTCTCCAGACATGG - Intergenic
907851402 1:58258508-58258530 ATGAAAAATGAGTCCAGACAGGG - Intronic
910817705 1:91310534-91310556 AGGAAAAACGTATACTGACATGG + Intronic
910938525 1:92507370-92507392 ACCCAAAATGTCTCCAAACATGG - Intergenic
911693528 1:100862325-100862347 ACCAAAAATCTCTCCAGACGTGG + Intergenic
912349369 1:108997285-108997307 AAGAAAAACTTAGCCAGACATGG + Intronic
912702005 1:111885010-111885032 ACCAAAAATGTCTCCAGACATGG + Intronic
915329599 1:155102145-155102167 ACAAAAAAGTTCTCCAGGCATGG + Intergenic
915607467 1:156961850-156961872 ACTAAAAATGTCTCCAGACATGG - Intronic
918417504 1:184326818-184326840 ACCAAAAATGTCTCTAGACATGG + Intergenic
921028915 1:211319199-211319221 ATCAAAAATGTCTCCAGACATGG + Intergenic
922144321 1:222923772-222923794 CCGAAAAAAGTCACCAGACAAGG - Intronic
924164582 1:241268445-241268467 ATGAAAAATGTCTCTAGATATGG + Intronic
1065446136 10:25802952-25802974 AAAAAAAATGTCTCTAGACATGG + Intergenic
1065796319 10:29311685-29311707 AAGAAAAACATCACCAGGCACGG + Intronic
1066431496 10:35356156-35356178 AAGAAAAACACCTCCAGAAAAGG - Intronic
1067356260 10:45530624-45530646 AAGAAAAACTTATCCAGGCATGG + Intronic
1070050697 10:72886789-72886811 ATGAACAAAGCCTCCAGACAAGG - Exonic
1070609297 10:77922583-77922605 AGGAAAAACCACCCCAGACAAGG + Intronic
1073665075 10:105522554-105522576 AAGACAAACTTCTCCAAACATGG + Intergenic
1074119325 10:110481742-110481764 ACCCAAAATGTTTCCAGACATGG + Intergenic
1074313375 10:112341404-112341426 ATGAGAAATGTCTCCAGACATGG - Intergenic
1074501203 10:114026436-114026458 CCTAAAAATGTCCCCAGACATGG + Intergenic
1075538890 10:123295708-123295730 AACTAAAATGTCTCCAGACATGG + Intergenic
1076095626 10:127733297-127733319 ACCAAAAATGTCTTCAGACATGG - Intergenic
1077590568 11:3487803-3487825 ACCAAAATTGTCTCCAGACATGG - Intergenic
1078459194 11:11500475-11500497 ACCAAAAACATCTCCAGACATGG - Intronic
1081591271 11:44424904-44424926 ATCAAAAATGTCTCCAGCCATGG - Intergenic
1082989026 11:59191532-59191554 ACCAAAAATGTCTCCAGACATGG - Intronic
1083693788 11:64429006-64429028 ACCAAAGATGTCTCCAAACATGG - Intergenic
1084246289 11:67859584-67859606 ACCAAAATTGTCTCCAGACATGG - Intergenic
1084826393 11:71734916-71734938 ACCAAAATTGTCTCCAGACATGG + Intergenic
1085815656 11:79734504-79734526 AATAAAAACGTCTCCCTACATGG - Intergenic
1086496747 11:87411902-87411924 CCAAAAAATGTCTCCAGACAAGG + Intergenic
1088353826 11:108920867-108920889 ACTAAAAATGTCTTCAGACATGG + Intronic
1089195829 11:116693537-116693559 ACCAAATACTTCTCCAGGCAGGG - Intergenic
1089575000 11:119435649-119435671 ACCAAAAATGTCTCCAGACATGG - Intergenic
1092416855 12:8296708-8296730 ACCAAAATTGTCTCCAGACATGG - Intergenic
1092623569 12:10301230-10301252 AAGAAAAAAGTCTTCTGACAAGG - Intergenic
1093710827 12:22328015-22328037 ACCAAATATGTCTCCAGACTTGG - Intronic
1094165075 12:27435316-27435338 ACCAAAAATGTCTGCAGACAGGG + Intergenic
1097354932 12:58590566-58590588 ACTAAAACCAGCTCCAGACAAGG - Intronic
1097789915 12:63804146-63804168 ATCAAAAACGTCTCCAGGCCAGG - Intronic
1099288351 12:80743892-80743914 ACGTAAAACATCTTCAGAAAAGG - Intergenic
1101268116 12:103113538-103113560 ACCCAAAATGTCTCCAGACATGG - Intergenic
1101878631 12:108611452-108611474 ACCAAACACGTCTCCAGACATGG + Intergenic
1103287146 12:119812099-119812121 ACAAAAAAAGTATCCAGGCATGG - Intronic
1104551655 12:129762651-129762673 ACGCATAACTTCTCCTGACATGG + Intronic
1104615919 12:130268495-130268517 ACCAAAAATGTCTCCAGACATGG - Intergenic
1107377122 13:39815934-39815956 ATCAAAAATATCTCCAGACATGG + Intergenic
1108669953 13:52675896-52675918 ACCCACAATGTCTCCAGACATGG + Intronic
1108698527 13:52924326-52924348 ACCAAAAATGTCTCTAGACATGG - Intergenic
1108915738 13:55608680-55608702 ACCAAAAATATTTCCAGACATGG - Intergenic
1108941457 13:55961043-55961065 AGGAAATACCACTCCAGACATGG - Intergenic
1108977634 13:56468562-56468584 AATAAAAATGTCTCCACACAAGG + Intergenic
1112359590 13:98705451-98705473 ACAAAAAATGTCTCCAGAGATGG + Intronic
1113627071 13:111855251-111855273 ACAAAAAAATTATCCAGACATGG - Intergenic
1114501536 14:23172687-23172709 ACCAAAAGTGTCTCCAGATACGG - Intronic
1115692597 14:35860283-35860305 ACAAAAAAATTATCCAGACATGG - Intronic
1116352895 14:43888137-43888159 ACCATAAATGTCTTCAGACATGG + Intergenic
1117328648 14:54691257-54691279 AGGGATAATGTCTCCAGACAAGG - Intronic
1117975170 14:61290001-61290023 AGGAAAAATGTGTCCAGGCACGG + Intronic
1118391504 14:65299577-65299599 ACAAAAAAAGGCTCCTGACAGGG + Intergenic
1120210211 14:81626803-81626825 ACCAAAAATGTCTTCAGTCATGG + Intergenic
1121744814 14:96279806-96279828 GCCAAAGACGTCTCCAGACATGG - Intergenic
1125659986 15:41386253-41386275 ACAAAAAAAGTAGCCAGACATGG + Intergenic
1125660354 15:41389615-41389637 ACAAAAAACTTATCCAGCCATGG + Intronic
1127414687 15:58746602-58746624 AAGAAAAATGTCTTAAGACAAGG + Intronic
1129918522 15:79296782-79296804 ACCAAAAATGTCTCTAGACGTGG + Exonic
1130092678 15:80834105-80834127 TCCCAAAATGTCTCCAGACATGG + Intronic
1130774471 15:86964420-86964442 ACAAAAAATGTGTCCAGACATGG + Intronic
1130935170 15:88464060-88464082 ACCAAAAATATCTCTAGACATGG - Intronic
1130980444 15:88808586-88808608 ACAAAAAATGTCTCCAGACATGG - Intronic
1131156389 15:90078610-90078632 ACCATAAATGTCTCCAAACATGG - Intronic
1132029576 15:98428936-98428958 ACCAAAAATATCTCCAGACATGG + Intergenic
1133174811 16:4006142-4006164 ACCAAAAATGTCTCCAGACATGG - Intronic
1133274836 16:4631464-4631486 ATCACAAATGTCTCCAGACATGG - Intronic
1133355937 16:5136888-5136910 ACCAAAACTGTCTCCAGACATGG - Intergenic
1133607873 16:7405908-7405930 ACTAAAAATGTCTCTGGACATGG - Intronic
1133755377 16:8758679-8758701 ACCAAAAATGTCTGCAGACATGG + Intronic
1133826244 16:9280707-9280729 ACCAAAAATGTCTCTAGATATGG - Intergenic
1134009218 16:10838875-10838897 ATGCAGAATGTCTCCAGACATGG + Intergenic
1134213406 16:12297014-12297036 ATCACAAATGTCTCCAGACATGG + Intronic
1134394194 16:13848095-13848117 AGCCAAAATGTCTCCAGACATGG + Intergenic
1134827411 16:17295707-17295729 AACAAAAATGTCTCCAGACATGG - Intronic
1134860430 16:17555670-17555692 ATCAAAAATGTCTCCAGACATGG + Intergenic
1135078886 16:19417121-19417143 AAGAAAAACGTGTCCAGGCCAGG + Intronic
1135142441 16:19933171-19933193 TCCAAAAATGTCTCCAGACATGG - Intergenic
1135350064 16:21721375-21721397 ACCAAAAATGTTTGCAGACATGG - Intronic
1140556293 16:75925224-75925246 ACCCAAAATGTCTCAAGACATGG + Intergenic
1140700189 16:77574536-77574558 ACCAAAAATGAATCCAGACATGG + Intergenic
1140711034 16:77677815-77677837 ACAAAAAACGTAGCCAGGCATGG + Intergenic
1140932969 16:79644885-79644907 ACAAAAACCCTCTCCAGCCAGGG - Intergenic
1141440007 16:84024124-84024146 ACCCAAAATGTCTGCAGACATGG + Intronic
1141743017 16:85906777-85906799 CCAAAAAAGGTCTCCAAACATGG - Intronic
1141746713 16:85931070-85931092 ACCAAAAATGTCTCCAGACATGG - Intergenic
1141756132 16:85992200-85992222 ACAAAAAATGTCCCCAGACATGG + Intergenic
1141758310 16:86009874-86009896 ACAAATAAGGTGTCCAGACAGGG - Intergenic
1144398244 17:14867115-14867137 AGGAAGAGGGTCTCCAGACAGGG + Intergenic
1144757867 17:17691185-17691207 ACCAAAAATGTCTCCTGACATGG - Intronic
1146420984 17:32685560-32685582 GGGAAAAACCTCTACAGACATGG - Intronic
1146720096 17:35118157-35118179 ATCAAAAATGTCTCCTGACATGG - Intronic
1147855119 17:43473932-43473954 ACCAAAAATGTCTCCAGACATGG - Intergenic
1147916819 17:43892762-43892784 GCCAAAAACGTTTCCAGAGAAGG + Intronic
1150383625 17:64740278-64740300 ACCAAAAATGTCTCCAGGCCAGG + Intergenic
1150918104 17:69456791-69456813 ATGAAAAACATCTCTAGATAAGG - Intronic
1151179119 17:72312903-72312925 AGCAAAACTGTCTCCAGACATGG + Intergenic
1151227984 17:72660868-72660890 AACCAAAACGTCTCCAGACATGG + Intronic
1152217011 17:79039209-79039231 ACAAAAAATGTCTCCAAACATGG - Intronic
1154286467 18:13061850-13061872 ACCAGTAACGTCTCCAAACATGG + Intronic
1156111264 18:33730127-33730149 ACAAAAAACATCTCCAAACATGG - Intronic
1156313096 18:35942680-35942702 ATGAAAAACGTAGCCAGGCACGG - Intergenic
1157775389 18:50391437-50391459 ACCAAAAATGTCTCCAGACATGG - Intronic
1159309958 18:66694431-66694453 ACTAAAAAAATCTCCAGAAATGG - Intergenic
1161328660 19:3675861-3675883 ACCACAGATGTCTCCAGACATGG + Intronic
1161523049 19:4736558-4736580 ACCACAAATGTCCCCAGACATGG - Intergenic
1161938060 19:7384294-7384316 ATCAAAAATGTCTCCAGACATGG + Intronic
1162331756 19:10034139-10034161 ATGAAAAAACTCTCCAGACTCGG - Intergenic
1162684692 19:12372301-12372323 ACAAAAAAATTATCCAGACATGG + Intergenic
1163399491 19:17083498-17083520 ACCAGAAATGTCTCCAGACATGG + Intronic
1165526868 19:36363550-36363572 ACCAAAATTGTCTCCAGATATGG - Intronic
1168421586 19:56207679-56207701 AACAAAAATGTCTCTAGACATGG - Intronic
926105151 2:10145223-10145245 ACTAAAAACCCCTCCAGACCTGG - Intronic
929085714 2:38165314-38165336 AACCAAAAAGTCTCCAGACATGG - Intergenic
929607312 2:43243290-43243312 ACCAAAAATGTCTCCAGACACGG - Intronic
932815794 2:74860712-74860734 ACTAAAAACGTGTCCACAAAAGG - Intronic
936864938 2:117066636-117066658 ACCAAATATGTCTCCAGACCTGG - Intergenic
937524780 2:122754955-122754977 ACCAAAAATGTCCCTAGACATGG + Intergenic
938663373 2:133509675-133509697 ATGAAAACTGTCTCCAGACATGG - Intronic
939642375 2:144656006-144656028 AAGAAGAACCTCTCCGGACAGGG + Intergenic
940150253 2:150592226-150592248 ACCAAAAATGTCTGGAGACATGG + Intergenic
943519487 2:188930407-188930429 ACGCAAAACTTATCCAGGCAGGG + Intergenic
943850330 2:192712633-192712655 TCACAAAACGTCACCAGACAAGG - Intergenic
947704386 2:232262506-232262528 ATCAAAAATGTCTCCAGACATGG - Intronic
947807792 2:232980652-232980674 AAGAAAAACGTAGCCAGGCACGG - Intronic
1169836879 20:9890288-9890310 AATAAAAACATCTCCAGACTGGG + Intergenic
1169862347 20:10165982-10166004 AAGAAAAACATCACCAGGCATGG + Intergenic
1170472645 20:16683623-16683645 ATCAAAAATGTCTCCAGACCAGG - Intergenic
1172301327 20:33852571-33852593 ACCAAAAATGTCTTCAGACATGG + Intronic
1174483770 20:50848855-50848877 AAGAAAAGAGTCTCCAGAAAGGG + Intronic
1174498722 20:50968486-50968508 AATCAAAATGTCTCCAGACATGG - Intergenic
1174565032 20:51458361-51458383 ACCAAGATTGTCTCCAGACAAGG + Intronic
1175154339 20:56959554-56959576 ACCAAAAATGTCTCCGGACATGG + Intergenic
1175201037 20:57277799-57277821 CCGAACAGAGTCTCCAGACATGG + Intergenic
1175266339 20:57705777-57705799 GCCAGAAATGTCTCCAGACATGG - Intronic
1179025700 21:37676705-37676727 ATCAAAAATGTCTCCAGACATGG - Intronic
1181775017 22:25153329-25153351 ACCAAAAATGTCTCCAGACAAGG - Intronic
1181974850 22:26721662-26721684 ACCAAAAACATCTCAAGACATGG - Intergenic
1183396744 22:37575998-37576020 ACCAAGAATGTCTCCAGACAGGG + Intronic
1183725807 22:39589120-39589142 ACCAAAAATGTCTCCAGACACGG + Intronic
952000144 3:28775698-28775720 ATCAAAAATGTCTCCAGGCATGG - Intergenic
953394640 3:42558024-42558046 ACCAGAAATGACTCCAGACATGG - Intronic
954098026 3:48346679-48346701 ACGAAAAAATTATCCAGGCATGG + Intergenic
955738836 3:62067867-62067889 ACCAAAAATGTCTCTAGACATGG + Intronic
955744952 3:62131257-62131279 ACGAAAAACGTCTCCAGACATGG + Intronic
955761784 3:62292670-62292692 AGCAAAAAAGTCTCCAGACATGG - Intronic
955775435 3:62427595-62427617 ACCAGGAATGTCTCCAGACATGG + Intronic
956067846 3:65415787-65415809 ACCAATAATGTCTTCAGACAGGG - Intronic
960603741 3:119483808-119483830 ATCAAAAATGTCTACAGACATGG + Intronic
961587643 3:127947154-127947176 AAGAAAAAAATCACCAGACATGG - Intronic
961894407 3:130155309-130155331 ACCAAAATTGTCTCCAGACATGG - Intergenic
962399689 3:135047800-135047822 AACCAAAATGTCTCCAGACATGG - Intronic
964249330 3:154692363-154692385 ACCAAAAATGTCTACAGACATGG - Intergenic
965208008 3:165746845-165746867 ACAAAGAACGTTTCAAGACATGG + Intergenic
967042716 3:185708409-185708431 ACCAAAAACATCTCCAGGAAGGG + Intronic
967232208 3:187350606-187350628 ACCAAAACTGACTCCAGACAAGG + Intergenic
967826346 3:193880652-193880674 ACAAAAAAAGTAGCCAGACATGG + Intergenic
969004497 4:4008388-4008410 ACCAAAACTGTCTCCAGACATGG - Intergenic
969249716 4:5959036-5959058 ACCAAAAATGTCTCCAGACATGG + Exonic
969748371 4:9091760-9091782 ACCAAAACTGTCTCCAGACATGG + Intergenic
969809402 4:9636319-9636341 ACCAAAACTGTCTCCAGACATGG + Intergenic
971630378 4:28985350-28985372 ACGAAAAGCATCTCCAGACATGG - Intergenic
976337393 4:83906162-83906184 ACCAAAAATGTCTCCAGACATGG + Intergenic
978395199 4:108271547-108271569 ACAAGAAACGTCTCCTGTCAAGG - Intergenic
978988377 4:115045625-115045647 ATGAAAAAGGTCTCCAGGGATGG - Intronic
980767389 4:137324971-137324993 AGGAAAACCGTCTGAAGACAAGG - Intergenic
983646828 4:170000010-170000032 ACCAAAAATGTCTCCAGACTTGG + Intronic
984498736 4:180532013-180532035 ACCAAAAATGTCTCCAGAAATGG - Intergenic
986732554 5:10645906-10645928 ACCAAAAATGTCTACAGACGTGG - Intronic
987259726 5:16190910-16190932 ACCAAAAATGTCTCCAGACATGG - Intergenic
989371725 5:40717617-40717639 AACAAAAATGTCTCTAGACATGG + Intronic
990334983 5:54763843-54763865 ATCAAAAACGTCTTCTGACAAGG - Intergenic
990669526 5:58112558-58112580 ACTAAAAATGTCTCCAGACATGG + Intergenic
992934939 5:81693047-81693069 ACAAAAAAATTATCCAGACATGG + Intronic
993034852 5:82745501-82745523 ACCAAAACTGTCTCCAGACATGG + Intergenic
994109771 5:95988136-95988158 AGCAAAAATGTCTCCACACAAGG - Intergenic
994298917 5:98122487-98122509 TTGAAAAACTTCTCCAGCCAGGG + Intergenic
997005904 5:129815873-129815895 ATGAACACAGTCTCCAGACATGG + Intergenic
997868247 5:137483755-137483777 ACCAAAAATGTCTCCAGACAGGG + Intronic
997926711 5:138036826-138036848 ACCAAAAATGTCTGCACACATGG - Intronic
1000971495 5:167719745-167719767 AACAAAAACATCACCAGACAGGG - Intronic
1001017975 5:168158654-168158676 ATCAAAAATGTCTCCAGACTGGG + Intronic
1002463582 5:179389608-179389630 GTCAAAAATGTCTCCAGACATGG - Intergenic
1002474730 5:179458077-179458099 ACAAAAAAAGTAGCCAGACATGG - Intergenic
1004608316 6:17214716-17214738 ATCAAAAATGTCTCCAGACATGG - Intergenic
1005256292 6:24007002-24007024 AGCAAAAATGTCTCCAGACGTGG - Intergenic
1006471479 6:34231801-34231823 ACAAAAAACGTAGCCAGGCATGG - Intergenic
1006751203 6:36378794-36378816 ACTAAAAATGTCTCCAGACACGG + Intronic
1007500294 6:42291843-42291865 AGTAAAAACTTGTCCAGACAGGG - Intronic
1007688938 6:43685497-43685519 ACCAAAAATGTCTGCAGACATGG + Intronic
1009213487 6:60891436-60891458 AACAAAAATGTCCCCAGACATGG + Intergenic
1009438061 6:63640932-63640954 GCCAAAAATGTCTCTAGACATGG + Intronic
1012358064 6:98340840-98340862 ACCAAAAATGTCTCCTGACATGG - Intergenic
1013750901 6:113404990-113405012 ACTAAAAGTGTCTCCAGACATGG + Intergenic
1015803573 6:137086169-137086191 AGGAAAAACATCTCCATATATGG + Intergenic
1018181897 6:161230598-161230620 AGGAAAAACTTGTCCAAACAGGG - Intronic
1020021514 7:4872232-4872254 ACCAAAGATGTCTGCAGACATGG - Intronic
1020324633 7:6964887-6964909 ACCAAAATTGTCTCCAGACATGG - Intergenic
1021523662 7:21562302-21562324 ATCATAAATGTCTCCAGACATGG + Intronic
1021910687 7:25383347-25383369 AAGAAAAAGGTTTCCAGACAGGG - Intergenic
1022341920 7:29476708-29476730 ATAAAAAATGTCTCCAGACATGG - Intronic
1027444258 7:78254667-78254689 AGGAAAAACACCTGCAGACAGGG + Intronic
1027656747 7:80940153-80940175 ACAAAAAATGTCTCTAGATATGG + Intergenic
1027809757 7:82880592-82880614 ACCAAAAATGTTTCTAGACATGG - Intronic
1029935967 7:104424578-104424600 ACCAAAAATGTCTCCAGACCTGG - Intronic
1030490025 7:110220699-110220721 ACCAAAAATATCTTCAGACATGG - Intergenic
1032022695 7:128418539-128418561 ACCAAAAATGTCTTCAGACACGG - Intergenic
1036117219 8:5971521-5971543 AAAAAAAAAGTATCCAGACATGG + Intergenic
1036371433 8:8166054-8166076 ACCAAAATTGTCTCCAGACATGG + Intergenic
1036879470 8:12499590-12499612 ACCAAAATTGTCTCCAGACATGG - Intergenic
1038323251 8:26548721-26548743 AAAAAAAAAGTCACCAGACATGG + Intronic
1038507582 8:28098457-28098479 AAGAAAAACTTCTAAAGACACGG - Intronic
1041561425 8:59223736-59223758 AAGAAAAACATCTTCAGAAAGGG - Intergenic
1041811851 8:61920314-61920336 ATGAAAAAAGTCCCCAAACAAGG - Intergenic
1045690390 8:104754165-104754187 ACCAAAAATGTCTCCAGGCTGGG - Intronic
1045807891 8:106186746-106186768 ATGAAAAACATCTCCAGGCAAGG - Intergenic
1046017586 8:108623798-108623820 ATCAAAAATGTCTCCAGACATGG - Intronic
1046279774 8:112011527-112011549 ACTAAAAAAGTTTCCAGACATGG - Intergenic
1047693751 8:127383120-127383142 CCCAAAAATGTCTCCAGACATGG + Intergenic
1050026268 9:1337429-1337451 GCCAAAAATATCTCCAGACACGG - Intergenic
1050668613 9:7969882-7969904 ACCAAAAATGTCTCTGGACATGG - Intergenic
1055645140 9:78356102-78356124 ACCAAAAATGTCTCTAGACATGG - Intergenic
1060062578 9:120474362-120474384 ACCAAAAATGTCTCCAGACATGG - Intronic
1060820124 9:126656859-126656881 ATCAAAAATGTCTCCAGACATGG + Intronic
1061430040 9:130525020-130525042 ACAAAAAACTTAGCCAGACATGG + Intergenic
1061701333 9:132418218-132418240 ACCAAAAATGTCTCCAGACGTGG - Intronic
1061712000 9:132494369-132494391 ACCAAAAATATGTCCAGACATGG + Intronic
1062304039 9:135892190-135892212 AAGAAAACCGTGTGCAGACATGG + Intronic
1185798899 X:2991692-2991714 AACAAAAATGTCTCCAGACATGG - Intergenic
1186157279 X:6738628-6738650 ACCCAAAATGTCTCCAGACATGG - Intergenic
1186157369 X:6739467-6739489 ACCAAAAATGTCCTCAGACATGG - Intergenic
1186239599 X:7552331-7552353 ACCAAGAATGTCTCCAGATATGG - Intergenic
1186515521 X:10163906-10163928 ACAAAAAATGTCTCTAGACATGG + Intronic
1186886987 X:13923644-13923666 ATGAATAACATCTCCAAACATGG + Intronic
1187408347 X:19024585-19024607 ACCAAAAATGTCTCCAGACATGG - Intronic
1187682181 X:21778636-21778658 AAGAAAAACGTGGCCAGGCACGG + Intergenic
1189096939 X:38150433-38150455 ACCAAAAATATCTCCAGACATGG - Intronic
1190487105 X:50938709-50938731 ACCAAAAAATTATCCAGACATGG - Intergenic
1194708257 X:97201271-97201293 ACGCAACACCTCTCCAGCCAGGG + Intronic
1195641653 X:107182319-107182341 ACCAAAAATGTCTCCAGATTTGG + Intronic
1195765972 X:108297511-108297533 ACCAAAAATGTTCCCAGACATGG + Intronic
1195999056 X:110761583-110761605 ACCAAAAATGTCTCCAGACATGG - Intronic
1196219416 X:113094833-113094855 ACAAAAAACATAGCCAGACATGG + Intergenic
1198313715 X:135445529-135445551 ACTAAAAACGTCTCCAGATCTGG - Intergenic
1199162091 X:144624829-144624851 ATCAGAAATGTCTCCAGACAGGG - Intergenic
1199271302 X:145885625-145885647 ACCAAAAACATCTCCAGATATGG + Intergenic
1199290791 X:146102846-146102868 ACCAAAAACGTAGCCAGAGAAGG - Intergenic
1201245150 Y:11996213-11996235 ACCAAAAATGTCTCTAGATATGG + Intergenic
1201550902 Y:15215423-15215445 ACCCAAAATGTCTCCAGACATGG - Intergenic
1201550991 Y:15216260-15216282 ATGAAAAATGTCCCCAGACATGG - Intergenic