ID: 955745569

View in Genome Browser
Species Human (GRCh38)
Location 3:62136806-62136828
Sequence GACTCACAGTTCCACGTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 22098
Summary {0: 36, 1: 862, 2: 5111, 3: 8006, 4: 8083}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955745569_955745571 15 Left 955745569 3:62136806-62136828 CCAGTCACGTGGAACTGTGAGTC 0: 36
1: 862
2: 5111
3: 8006
4: 8083
Right 955745571 3:62136844-62136866 TTTTGTAAACTGCCCAGTCTTGG 0: 39
1: 1075
2: 1182
3: 1298
4: 5172
955745569_955745572 16 Left 955745569 3:62136806-62136828 CCAGTCACGTGGAACTGTGAGTC 0: 36
1: 862
2: 5111
3: 8006
4: 8083
Right 955745572 3:62136845-62136867 TTTGTAAACTGCCCAGTCTTGGG 0: 25
1: 761
2: 2454
3: 5789
4: 13930

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955745569 Original CRISPR GACTCACAGTTCCACGTGAC TGG (reversed) Intronic
Too many off-targets to display for this crispr