ID: 955747913

View in Genome Browser
Species Human (GRCh38)
Location 3:62158317-62158339
Sequence TTATTCCCAAAAATAGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 273}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955747913 Original CRISPR TTATTCCCAAAAATAGAGCC AGG Intronic
901602423 1:10432390-10432412 TTAGTCCCTAGAACAGAGCCTGG + Intronic
902107155 1:14047349-14047371 TTATTCCCAAATATTGATCTGGG + Intergenic
903223806 1:21883892-21883914 ATTTTCCCAAAGATAGAGGCAGG - Intronic
905643539 1:39608945-39608967 ATATGGCCAAAAATAGAGCATGG + Intergenic
906756697 1:48324300-48324322 CTATTCCAAAAAATAGAGGAGGG + Intronic
906979111 1:50609177-50609199 TTATTCACAAACCTAAAGCCTGG - Intronic
907032342 1:51184743-51184765 TTATTCAAAAAAATAGAGACAGG - Intergenic
909271904 1:73633334-73633356 CTATTCCAAAAAATAGAGAAGGG + Intergenic
910016057 1:82525827-82525849 TGCTTCCAAAAAATACAGCCAGG - Intergenic
910215954 1:84844516-84844538 CAATTCACAAAAATAGACCCAGG + Intronic
910547675 1:88436950-88436972 CTATTCCAAAAAATAGAGGAGGG + Intergenic
910828374 1:91433790-91433812 TTATTCTTAAAAATAAAGCGGGG - Intergenic
911216071 1:95196486-95196508 TTATTATCAAAACTAGAGGCTGG - Exonic
911487520 1:98520648-98520670 CTATTCCCAAAAATAGATGAGGG + Intergenic
912858983 1:113196236-113196258 TTATTCCCTAGCACAGAGCCTGG + Intergenic
913059177 1:115188977-115188999 TTAATCCCAAAATAAGAGCAGGG - Intergenic
914236744 1:145819564-145819586 TTATTCCAAAAAATCGAGGAGGG + Intronic
914277845 1:146141251-146141273 ACATTGCCAAAAATACAGCCTGG + Intronic
914391006 1:147223346-147223368 TTAGTCCCCAAAACAGAGTCAGG + Intronic
914538890 1:148592199-148592221 ACATTGCCAAAAATACAGCCTGG + Intronic
914780115 1:150778035-150778057 TTAAAACCAAAAATAGAGGCCGG + Intergenic
916616030 1:166441080-166441102 CTATTCCAAAAAACAGAGACAGG - Intergenic
917137813 1:171804463-171804485 TTATTCTCAAAAATAAAGCTTGG + Intronic
917669441 1:177258628-177258650 ATAGTGCCAAAAATAGTGCCAGG - Intronic
918335638 1:183509163-183509185 GTCTTCACAAAAATAGATCCAGG + Intronic
922240263 1:223751065-223751087 TTATTCTGAGAAATATAGCCAGG + Intronic
922944207 1:229496808-229496830 TTATTTTTAAAAATAGAGACAGG - Intronic
1064065214 10:12175634-12175656 ATAGTCTCAAAAAAAGAGCCCGG + Intronic
1065955540 10:30690600-30690622 TTATTTACAAAAACAGAGCTGGG - Intergenic
1066716757 10:38295028-38295050 TTATTTCCAAACAAAGAGCCAGG - Intergenic
1067016829 10:42763237-42763259 CTATTCCAAAAAATAGAGGAGGG + Intergenic
1067798995 10:49344476-49344498 CTATTCCAAAAAATAGAGGACGG + Intergenic
1068547248 10:58361407-58361429 ATAATCCCAGAAATAGAGCAAGG - Intronic
1069061752 10:63902027-63902049 TTCTTCCCAAATATAGTACCGGG - Intergenic
1069838950 10:71327314-71327336 TTATTCCAGAGAATAGAGACAGG - Intronic
1069971637 10:72175846-72175868 TTATTCCCAAAGACAGACCCTGG + Intronic
1071041277 10:81310893-81310915 CTCTTCCCAAAAATAGAGGAGGG + Intergenic
1071208211 10:83308613-83308635 TTATTCACAAGAACAGTGCCAGG - Intergenic
1071410350 10:85385789-85385811 CTATTCCCAAAAATTGAGGGGGG + Intergenic
1071582949 10:86790338-86790360 ATATTCCCACAAATAGTGTCTGG - Intronic
1071605962 10:86989978-86990000 CTATTCCAAAAAATAGAGGAGGG - Intergenic
1072697592 10:97615408-97615430 TTATTATAAAAAATTGAGCCAGG - Exonic
1073243525 10:102073749-102073771 TAATTCCCAAACAGAGGGCCTGG + Intergenic
1075162747 10:120039283-120039305 TTATTAGGAAAAATAGAGCAGGG - Intergenic
1075768715 10:124916202-124916224 ATTTTCCCAAGACTAGAGCCAGG + Intergenic
1075770391 10:124929649-124929671 TTATTCATAAAAATGGAGGCTGG + Intergenic
1076350267 10:129810741-129810763 TGACTCCAGAAAATAGAGCCAGG - Intergenic
1079813303 11:25023277-25023299 TTATTGCCAAAAAAAAAGTCCGG - Intronic
1081137847 11:39461264-39461286 TTATACCCACACATCGAGCCTGG + Intergenic
1081397543 11:42604539-42604561 TTATTTCCAAACATAGATACAGG + Intergenic
1081632646 11:44700286-44700308 CTGTTTCCTAAAATAGAGCCAGG + Intergenic
1082199802 11:49352256-49352278 TTATTGCTAAAAATGAAGCCTGG - Intergenic
1083527058 11:63378151-63378173 TTATTCCAGAAAATTGAGGCAGG + Intronic
1085257605 11:75184796-75184818 ATCTTCCCTAAAATAAAGCCTGG - Intronic
1086313869 11:85568458-85568480 TTATTCCAAAAAATTGAGGAGGG - Intronic
1086655865 11:89353938-89353960 TTATTGCTAAAAATTAAGCCTGG + Intronic
1087554441 11:99697259-99697281 TTCTTCCCAAGAATAGAGTGTGG + Intronic
1087563936 11:99829392-99829414 TTATTTTCAAACATAAAGCCTGG - Intronic
1087720494 11:101659779-101659801 CTATTCCAAAAAATAGAGGAGGG - Intronic
1087862303 11:103174844-103174866 TGATTCCAAAGAATAAAGCCAGG - Intronic
1088182173 11:107125427-107125449 CTATTCCAAAAAATAGAGAAAGG + Intergenic
1092031994 12:5294138-5294160 TTTTTCCAAAAGAGAGAGCCTGG + Intergenic
1092788165 12:12048589-12048611 TGATTCCCAAAAAAGGAGTCAGG + Intergenic
1092897642 12:13028790-13028812 TTTTTATCAAAAATACAGCCTGG - Intergenic
1097431511 12:59514028-59514050 TTTTTCCCTAAAATAGACCCTGG - Intergenic
1097877326 12:64655483-64655505 TTTTTTCAAAAAATAGAGACAGG + Intronic
1098192364 12:67963017-67963039 TTAATAGCAAAAATTGAGCCGGG + Intergenic
1098627421 12:72689538-72689560 TTCTCCCCAAAAATGTAGCCAGG - Intergenic
1099143699 12:79012232-79012254 TGATTCCCAAAAATAGAGTCTGG - Intronic
1099617141 12:84950521-84950543 TTATTCACAATAACAGAGACAGG + Intergenic
1100113705 12:91276867-91276889 TTATTCCCATAATTGGAGCAAGG + Intergenic
1100961476 12:99967611-99967633 CTATTCTGAAAAATAGAACCTGG + Intronic
1102087814 12:110158405-110158427 TTATTCTAAAAAATAGAAACAGG + Intronic
1103822233 12:123708158-123708180 TCTTTACCAAAAATACAGCCAGG - Exonic
1104333959 12:127875197-127875219 TTATTCTTAAAAATAAGGCCGGG - Intergenic
1106036322 13:26048514-26048536 TATTTCCCAAAAATATAGCCAGG - Intronic
1108489443 13:50966106-50966128 TTATTCCCCAAAATGGCACCTGG - Intronic
1108871712 13:54995215-54995237 TTTTGCCCTAAAATAGAGACAGG + Intergenic
1109642170 13:65204566-65204588 TTATTCACAAAGTTAGAGGCAGG - Intergenic
1110388804 13:74947201-74947223 CTATTCCCAAACATAGAGGAAGG + Intergenic
1110665445 13:78111973-78111995 TTATTCTGAAAAATAGAGGAGGG - Intergenic
1110773082 13:79373904-79373926 TTATTCTCAACAATATAGTCTGG - Intronic
1112003562 13:95234795-95234817 TTTTTCCCAAAAATATGGGCTGG + Exonic
1114878101 14:26748739-26748761 TTATTTACAAAAATAGAGGTAGG - Intergenic
1115115098 14:29871419-29871441 TTATTGCCAAAATGAGAGGCAGG + Intronic
1115381222 14:32741911-32741933 TTATTCCAAAAAATAGAGGAGGG - Intronic
1115619569 14:35128378-35128400 CTATTCCAAAAAATAGAGGAGGG - Intronic
1115918748 14:38347427-38347449 CTATTCTCAAAAATAGAGAAGGG + Intergenic
1116050664 14:39799058-39799080 CTATTACCACAAATGGAGCCTGG - Intergenic
1116327228 14:43545991-43546013 TTCTTCCAAAAAATAAATCCAGG + Intergenic
1116451698 14:45074311-45074333 TAATTCTCAAAAATAGTGCCAGG + Exonic
1116563075 14:46407786-46407808 TAATTCCCAAAATGAGATCCTGG - Intergenic
1116885523 14:50217525-50217547 TAATTTTCAAAAATAGAGACAGG - Intronic
1117108830 14:52427494-52427516 TCATTGCCAAAAACAGTGCCTGG + Intergenic
1117482736 14:56164576-56164598 CTATTCCAAAAAATAGAGGAGGG - Intronic
1118413768 14:65510465-65510487 CTATTCCGAAAAATAGAGGAGGG - Intronic
1118657992 14:67974230-67974252 TAATTCCCTAAAATTTAGCCTGG - Intronic
1122682853 14:103479347-103479369 TTATTCCTAAATATATACCCAGG - Intronic
1126262641 15:46712309-46712331 TGTTTCTCAAACATAGAGCCCGG + Intergenic
1126293711 15:47112606-47112628 TTATTTACAAAAACAGAGCGTGG + Intergenic
1126903422 15:53338200-53338222 CTATCCCCTAAAATAGAGCCTGG - Intergenic
1126963976 15:54030201-54030223 GTCTTGCCAAAAGTAGAGCCTGG - Intronic
1127242286 15:57129664-57129686 TCATTCTCAAAAATAGTGCAAGG - Intronic
1129768325 15:78184476-78184498 TTATTACCAACAATAAGGCCAGG - Intronic
1131945300 15:97613561-97613583 CTATTCCAAAAAATAGAGGAGGG + Intergenic
1133076696 16:3285569-3285591 TCATTCCCAAAAGCAGAGGCTGG + Intronic
1134827518 16:17296474-17296496 TTATTCACAAACAGAGAGGCAGG - Intronic
1135231482 16:20712152-20712174 TTATTTACAAAAACAGGGCCAGG - Intronic
1136120616 16:28131030-28131052 TTATTCCCAAAAATGGCTTCTGG + Intronic
1140325485 16:73997515-73997537 TTATTCACAAAAATAGGCACTGG + Intergenic
1142469776 17:156747-156769 TTTTTCAAAAAAATAGAGACAGG + Intronic
1142990413 17:3726655-3726677 TTATTTAAAAAAATAGAGACAGG - Exonic
1143908934 17:10231571-10231593 TTTTTTTCAAAAATAGAGGCAGG - Intergenic
1144444564 17:15314959-15314981 TTATTACCAAAGACAGACCCTGG + Intronic
1146284137 17:31563040-31563062 TTATTAAAAAAAAAAGAGCCAGG - Intergenic
1148282570 17:46360543-46360565 TTATTTTTAAAAATAGAGGCAGG - Intronic
1148304788 17:46578468-46578490 TTATTTTTAAAAATAGAGGCAGG - Intronic
1148721989 17:49760492-49760514 TTATTTACAAAAATAGGCCCAGG + Intronic
1148892485 17:50818118-50818140 TGATTCCCCAAATTCGAGCCAGG - Intergenic
1149143930 17:53467132-53467154 TTATTGCCTATCATAGAGCCAGG - Intergenic
1149205947 17:54247963-54247985 TTGTACCTAAAAAGAGAGCCAGG - Intergenic
1153259010 18:3203736-3203758 TTTTTTCCAAAAATAGAGAAGGG + Intronic
1153626624 18:7027473-7027495 TTATTTCCAAATAAAGAGCTGGG + Intronic
1155422300 18:25668389-25668411 TTATTCCCTAAACCACAGCCGGG - Intergenic
1155970866 18:32082485-32082507 CTATTCCCTAAAATATTGCCTGG - Intergenic
1156063323 18:33108411-33108433 TAATTCCCAAAGATACAGTCGGG - Intronic
1160434824 18:78841668-78841690 TTATTTCAAAGAAAAGAGCCCGG - Intergenic
1165316120 19:35056391-35056413 TCACTGCCTAAAATAGAGCCTGG + Intronic
1165641633 19:37393859-37393881 TTATTCACAAAACTCGAGACAGG + Intergenic
1165832930 19:38738122-38738144 TGATTTCCCAAAATAGAACCTGG + Intronic
1166671441 19:44711807-44711829 TTATTTTCAAAAATAGAGACGGG - Intergenic
927797642 2:26064480-26064502 TTTTTCCCAAAAAATTAGCCAGG - Intronic
928029516 2:27766692-27766714 TTTTTAACAAAAATAGAGGCAGG + Intergenic
928949119 2:36798997-36799019 TTAGTCCCAACCATAGAACCTGG + Intronic
928986085 2:37183432-37183454 TTATTCTCGAAGATAGACCCAGG + Exonic
929281334 2:40083268-40083290 CTATTCCAAAAAATAGAGGAGGG - Intergenic
929944535 2:46360634-46360656 TTTTTCCCAAAACCAGAGCCTGG - Exonic
930288395 2:49463731-49463753 CTATTCCAAAAAATAGAGAAGGG - Intergenic
931010451 2:57906442-57906464 TTTTTCCCCAAAATAGAAGCAGG + Intergenic
932862738 2:75311513-75311535 TTATTGCTAAAGATAGAGCAAGG - Intergenic
936395582 2:112125777-112125799 TTCTTCCCAAAAATAGAAGAAGG + Intergenic
938616453 2:133004272-133004294 TTATTTCCCTAAATACAGCCAGG + Intronic
940411564 2:153369994-153370016 TTATACCTAAAATTAGAGACAGG - Intergenic
940802771 2:158151657-158151679 TTATTTGCAAAAATAGAGTGTGG - Intergenic
941012309 2:160314568-160314590 TTAGTACCAAAAATATTGCCTGG + Intronic
943214712 2:185015752-185015774 TCATTCCTGAATATAGAGCCTGG + Intergenic
944448163 2:199813303-199813325 TTATTCTCAAAAATAGTTCCAGG + Intronic
945095600 2:206216149-206216171 TTATTTTTAAAAATAGAGACAGG + Intronic
945931781 2:215862579-215862601 TTATTTACAAAAATAGAGGGTGG - Intergenic
947455723 2:230252170-230252192 ATATCCAGAAAAATAGAGCCAGG + Intronic
1170625265 20:18025585-18025607 GTATTCCCAGAAACAGAGCCTGG + Intronic
1170708873 20:18771061-18771083 CTATTCCAAAAAATAGAGGAGGG - Intergenic
1172533933 20:35656080-35656102 TTACCCCCAAAAGTAGAACCTGG + Intronic
1174673524 20:52331141-52331163 TAATCCCCAAAAATACAACCAGG - Intergenic
1175379360 20:58552197-58552219 TAAGGCCCAAACATAGAGCCTGG - Intergenic
1177203759 21:17987216-17987238 TTATTCCTAAAAACTAAGCCAGG + Intronic
1177469238 21:21535761-21535783 TTTTTTCCCAAAATATAGCCTGG - Intronic
1177771645 21:25523208-25523230 CTATTCCAAAAAATAGAGGAGGG + Intergenic
1178826581 21:36022344-36022366 TTATTTACAAAAATAGAAACTGG + Intergenic
1179358873 21:40686975-40686997 TCACTCCCAAAAATATAGCATGG + Intronic
1179375149 21:40843491-40843513 TTATTGCTAAAAGAAGAGCCAGG - Intronic
1180625711 22:17192101-17192123 TTGTTCCCAAAAGTCCAGCCAGG + Intronic
1181505589 22:23354216-23354238 GCATTTCCAAAAGTAGAGCCTGG - Intergenic
1182866847 22:33611484-33611506 TTATTCCCAAAAGGAGAAACTGG - Intronic
1182881460 22:33737479-33737501 TAAAGCACAAAAATAGAGCCAGG - Intronic
1182942466 22:34290456-34290478 TTATTACAAAAAACAGAGTCAGG - Intergenic
1184373746 22:44098843-44098865 TTATTTTTAAAAATAGAGACAGG + Intronic
1185210311 22:49566973-49566995 TTATTCCTGGTAATAGAGCCTGG - Intronic
950386597 3:12664994-12665016 GTAATCCCAAAAAAAGCGCCGGG - Intergenic
954981126 3:54746437-54746459 TTATTCCCTAAAATATTTCCAGG - Intronic
955747913 3:62158317-62158339 TTATTCCCAAAAATAGAGCCAGG + Intronic
956645286 3:71449197-71449219 TTAATTGCAAAAATAGAGCAGGG + Intronic
958760468 3:98301028-98301050 CTATCCCAAAAAATAGAGCTGGG + Intergenic
958862091 3:99456803-99456825 ATATTCCAAAAAATAGAGAAGGG - Intergenic
958867296 3:99516161-99516183 TTATTGCCAAAGGTAGGGCCTGG - Intergenic
959328434 3:104969785-104969807 TTATTCTGAAAAATAGAGGAGGG - Intergenic
960794853 3:121474575-121474597 TTTTTCCCACAAGTTGAGCCAGG + Intronic
960938568 3:122918759-122918781 TTATTCACAAGAAGAGAGCTCGG - Intronic
961770322 3:129244769-129244791 TTATTTTTAAAAATAGAGACAGG - Intergenic
962483659 3:135820443-135820465 CTATTCCAAAATATAGAGGCGGG + Intergenic
965099883 3:164282477-164282499 CTATTCCAAAAAACAGAGCAGGG + Intergenic
965260366 3:166475420-166475442 TTTTTCCCAAAAATAAATCCAGG + Intergenic
965550171 3:169956435-169956457 TTAGACCCAGAAATAGAGCATGG - Intergenic
965971923 3:174569795-174569817 CAATTCCCAAAACTATAGCCAGG - Intronic
966350060 3:179024013-179024035 TGATTTCAAAAAATAGGGCCGGG - Exonic
966514994 3:180809734-180809756 TTATTAACAGAATTAGAGCCAGG + Intronic
967823013 3:193855736-193855758 TTCTTCCCAAAATTAGACCTTGG - Intergenic
967839223 3:193991201-193991223 TTATTCATAAAAATAGATCATGG - Intergenic
967848834 3:194066349-194066371 CTATTCCAAAAAATAGAGGAGGG + Intergenic
967883748 3:194319308-194319330 TTATTCCCTAGCAAAGAGCCTGG - Intergenic
969487473 4:7480416-7480438 CAATTCACAAAAATACAGCCCGG + Intronic
971314816 4:25559022-25559044 ATATTCTAAAAAATAGAGACAGG + Intergenic
971485922 4:27160072-27160094 TTATTCAGAAAAATAAAGCAAGG - Intergenic
972851974 4:43061561-43061583 CTATTCCGAAAAATAGAGAAGGG + Intergenic
973940955 4:55910095-55910117 TAATTAACAAAAATAGAGACAGG - Intergenic
974802700 4:66839217-66839239 TTACTTCCAAGAATAGAGACAGG - Intergenic
975803113 4:78083333-78083355 TTATTCTCAAAAACAGATCTGGG + Intronic
976053022 4:81030927-81030949 GTGTTCCCAAAAATAAAGCGAGG + Intergenic
976094544 4:81494364-81494386 TTAGTCCTAAAAATAGACTCAGG + Intronic
977251584 4:94694724-94694746 TCAGTCCCAAAAAGAGACCCGGG + Intergenic
977375026 4:96191442-96191464 CTATTCCAAAAAATTGAGGCGGG + Intergenic
977872589 4:102110339-102110361 CTATTCCAAAAAATAGAGGAGGG + Intergenic
978684786 4:111427090-111427112 TTATTCAGAAAAATAGAGAAGGG + Intergenic
978977039 4:114890247-114890269 TTATTCTCCAAAATACAACCTGG - Intronic
980205201 4:129710075-129710097 TTATTTCAAGAAATAGAGCAGGG + Intergenic
980639782 4:135562590-135562612 TTTTTCCCAAAAATGGAACTTGG - Intergenic
981975950 4:150728305-150728327 GTATTCCAAAAAATAGAGGAGGG + Intronic
981996396 4:150979925-150979947 TTATTCCGAAAAATAGGGGAGGG + Intronic
982963542 4:161872581-161872603 TAAGTGCCAAAAATAGTGCCTGG - Intronic
983232153 4:165139871-165139893 ATACTCCCAAAAATTTAGCCTGG + Intronic
984031347 4:174607605-174607627 TTTTTCCCCAAAAGAGAGTCTGG - Intergenic
984368172 4:178825592-178825614 TTATTTTCAAGAATAGTGCCAGG + Intergenic
985374502 4:189320923-189320945 TTATTCTGAAAAATAGAGGTGGG - Intergenic
985954960 5:3257726-3257748 TTTGTCCCTAAAATGGAGCCAGG + Intergenic
987536074 5:19189292-19189314 CTATTCCCAAAAATAGAGTAGGG + Intergenic
987557909 5:19479195-19479217 TTATTGGCAAAACTAGAGCTGGG + Intronic
990157172 5:52890212-52890234 TTATTTTGAAAAGTAGAGCCAGG - Intronic
995756085 5:115505801-115505823 TAATTCCCAAAATTAGAGGTGGG - Intergenic
996116102 5:119620792-119620814 CTATTCCAAAAAATAGAGAAGGG - Intronic
997733636 5:136197982-136198004 TTAGTCCCAGAAATGGAGACAGG + Intergenic
999973335 5:156886793-156886815 TTATTCTCAAAAATAGAAAAGGG - Intergenic
1000845420 5:166274078-166274100 TTATTGCAAAAAAGAGAGTCAGG - Intergenic
1001725292 5:173891600-173891622 CCATTCCTAAAAATAGATCCAGG + Intronic
1004874048 6:19937441-19937463 TGATTCCAAAGAATAGAGCATGG - Intergenic
1005143388 6:22660161-22660183 TCATTCCCACAAATACATCCAGG + Intergenic
1006134142 6:31885549-31885571 TCTTTCCAAAAAATACAGCCAGG + Intronic
1006215306 6:32437009-32437031 CTATTCCCAAAGATACAGACAGG - Intergenic
1007564523 6:42839314-42839336 TTATTTTAAAAAATAGAGCTGGG + Intronic
1009282150 6:61766016-61766038 TTATTCAGAAAAATAGAGGACGG - Intronic
1010903965 6:81462911-81462933 TTATTCCAAAAGATAGAGAAAGG + Intergenic
1012291244 6:97458301-97458323 ATTTTTCCAAAAACAGAGCCGGG + Intergenic
1012665548 6:101963944-101963966 TTTTGCCCAAGAAGAGAGCCAGG - Intronic
1013054347 6:106568890-106568912 TTATTTCCAAAGATAGTGACAGG + Exonic
1015393062 6:132705131-132705153 CTATTCCAAAAAATAGAGAAAGG + Intronic
1015720735 6:136238432-136238454 TTATTAAAAAAAATAGAGACAGG - Intronic
1016231268 6:141807448-141807470 TAATTCCAAAAAATAGAGTATGG - Intergenic
1019925485 7:4189397-4189419 TTTTCCCCAAAAAGCGAGCCAGG + Intronic
1020383521 7:7571055-7571077 TTAGTGCCATATATAGAGCCTGG - Intronic
1020947685 7:14634319-14634341 TTATTTGAATAAATAGAGCCTGG - Intronic
1021662195 7:22930578-22930600 TTCTTCCAAAAAATAGAGAAGGG + Intergenic
1021967507 7:25935534-25935556 TTATTCCAAAAAATTGAGGAGGG + Intergenic
1022252542 7:28622848-28622870 TTATTTTCAAAAATAGAGATGGG - Intronic
1022300960 7:29101854-29101876 TTTTTTCCAAAAATAGAACCAGG + Intronic
1023130155 7:36994907-36994929 TTCTTCCTTGAAATAGAGCCTGG - Intronic
1023306083 7:38828708-38828730 TTATTTCCAAAAATATATCATGG + Intronic
1023330631 7:39112491-39112513 TTATAACCAAAAATAAAGGCAGG + Intronic
1027049943 7:75015631-75015653 TTAGTGCCCAAGATAGAGCCTGG + Intronic
1028796066 7:94906220-94906242 TTCTTTCCAAAAGTGGAGCCTGG + Intergenic
1029383092 7:100226039-100226061 TTGGTGCCCAAAATAGAGCCTGG - Intronic
1031892586 7:127311908-127311930 TTATTTCAAAAAATAGAGGAGGG + Intergenic
1033199509 7:139356771-139356793 TTATTCACAAAAATAGGCCGTGG + Intronic
1033835563 7:145306623-145306645 TTATTACCAAAATTAGAAACTGG + Intergenic
1033901185 7:146142787-146142809 TTATTCCCAAATTGAGAGACAGG + Intronic
1035821933 8:2602361-2602383 TTATGCCGAAAAATATAGGCAGG + Intergenic
1036769647 8:11570282-11570304 TCTTTCCCAAGAACAGAGCCAGG - Intergenic
1039013431 8:33121250-33121272 TTATTCCCCTAAATTGAGCTGGG + Intergenic
1039328688 8:36513090-36513112 GTATTCCCAGAAATAGATCAGGG + Intergenic
1039567298 8:38560491-38560513 TTCCCCCCAAAACTAGAGCCAGG + Intergenic
1041261214 8:56022005-56022027 TTATTATCTAAAATAGAGACAGG + Intergenic
1042621333 8:70708903-70708925 CTATTCCAAAAAATTGAGGCAGG + Intronic
1045034187 8:98164798-98164820 TTTTTCTCTAAAACAGAGCCTGG + Intergenic
1045602095 8:103729112-103729134 GTATTCCCAAAAATAAAGGAGGG - Intronic
1045668661 8:104520851-104520873 TTATTCCCAAAGTTACAGACTGG + Intronic
1045937768 8:107702001-107702023 TTCTCCCCAAAAATAGACCTTGG + Intergenic
1048737006 8:137513131-137513153 TAAGTCCCCAAAATAGAACCTGG - Intergenic
1050257484 9:3810419-3810441 TTAGTCACCAAATTAGAGCCTGG + Intergenic
1050618185 9:7425273-7425295 CTATTCCCATAAGTAGAGCAGGG - Intergenic
1051047555 9:12893148-12893170 CTATTCCAAAAAATAGAGGAGGG + Intergenic
1053454394 9:38221655-38221677 CTATTCCTAAAAATAGAGGAGGG - Intergenic
1058504093 9:105651711-105651733 TTATTCATAAAAGTAGAGACGGG - Intergenic
1060314179 9:122493240-122493262 TTATTCCAAAAAATAGAGAAAGG - Intergenic
1061713500 9:132503751-132503773 TTATATTTAAAAATAGAGCCGGG + Intronic
1186497119 X:10020387-10020409 TCATTTCCAAAAATAGCTCCTGG + Intronic
1186684569 X:11911966-11911988 TTAAACCCACAAACAGAGCCAGG - Intergenic
1186868924 X:13750205-13750227 TTATTGCCAAAAAGAGAGTAAGG - Intronic
1187840333 X:23480337-23480359 TTATTACCAAGACTAAAGCCTGG - Intergenic
1188653622 X:32663618-32663640 TCATTGCCTAAAATAGTGCCTGG - Intronic
1189173637 X:38932791-38932813 TCATTACCAAAAAGAGAACCAGG - Intergenic
1189889913 X:45590193-45590215 CTATTCCAAAAAATAGAGGAGGG - Intergenic
1190121903 X:47667858-47667880 TTCTTCACAGAAATAGAGCCTGG - Intergenic
1191815319 X:65238132-65238154 TTATTCCAAAAAATCGAGGAGGG - Intergenic
1192493643 X:71598385-71598407 TCATTCCCACACATAGAGCGGGG - Intronic
1193756354 X:85413766-85413788 CTATTCCAAAAAATAGAGGAGGG - Intergenic
1194854900 X:98916156-98916178 TTAGTCCCAAAGATAGTACCTGG + Intergenic
1195144956 X:102004020-102004042 CTATTCCCAAAAATTGAGAAGGG + Intergenic
1195251023 X:103047444-103047466 TTATTCCAAAAAATAGAGGAGGG - Intergenic
1196361869 X:114870460-114870482 CTATTCCAAAAAATAGAGGAGGG - Intronic
1196984116 X:121249346-121249368 TTATTCCAAAAAATAGAGGAGGG - Intergenic
1197004341 X:121478532-121478554 TAATTACCAAATATAGACCCAGG + Intergenic
1197016110 X:121627588-121627610 CTATTCCAAAAAATAGAGGAGGG + Intergenic
1197279137 X:124514805-124514827 TTATTCCAAAAAATTGAGGAGGG + Intronic
1199316938 X:146390872-146390894 ATATTCCAAAAAATAGAGAAGGG - Intergenic
1202086938 Y:21147770-21147792 TTATTGCCCAAAATATAACCTGG - Intergenic
1202350795 Y:23988741-23988763 TTGTTCCCAAAAAGAGAGTAAGG - Intergenic
1202519984 Y:25681378-25681400 TTGTTCCCAAAAAGAGAGTAAGG + Intergenic