ID: 955748259

View in Genome Browser
Species Human (GRCh38)
Location 3:62161702-62161724
Sequence CTGTAGCCACAGGAGGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 385
Summary {0: 1, 1: 0, 2: 6, 3: 28, 4: 350}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955748253_955748259 8 Left 955748253 3:62161671-62161693 CCTTTCTATAATCACCTTCATGC 0: 1
1: 0
2: 0
3: 17
4: 157
Right 955748259 3:62161702-62161724 CTGTAGCCACAGGAGGGGCATGG 0: 1
1: 0
2: 6
3: 28
4: 350
955748254_955748259 -6 Left 955748254 3:62161685-62161707 CCTTCATGCAAAACTGACTGTAG 0: 1
1: 0
2: 0
3: 5
4: 123
Right 955748259 3:62161702-62161724 CTGTAGCCACAGGAGGGGCATGG 0: 1
1: 0
2: 6
3: 28
4: 350
955748252_955748259 9 Left 955748252 3:62161670-62161692 CCCTTTCTATAATCACCTTCATG 0: 1
1: 0
2: 2
3: 34
4: 328
Right 955748259 3:62161702-62161724 CTGTAGCCACAGGAGGGGCATGG 0: 1
1: 0
2: 6
3: 28
4: 350
955748250_955748259 27 Left 955748250 3:62161652-62161674 CCTTTTCCTTCTATAAAGCCCTT 0: 1
1: 1
2: 1
3: 34
4: 382
Right 955748259 3:62161702-62161724 CTGTAGCCACAGGAGGGGCATGG 0: 1
1: 0
2: 6
3: 28
4: 350
955748251_955748259 21 Left 955748251 3:62161658-62161680 CCTTCTATAAAGCCCTTTCTATA 0: 1
1: 1
2: 1
3: 19
4: 249
Right 955748259 3:62161702-62161724 CTGTAGCCACAGGAGGGGCATGG 0: 1
1: 0
2: 6
3: 28
4: 350

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955748259 Original CRISPR CTGTAGCCACAGGAGGGGCA TGG Intronic
900471254 1:2856149-2856171 CTGCAGGCACAGCCGGGGCAGGG - Intergenic
900494711 1:2971220-2971242 CTGCCCCCACAGGAGGGGCTGGG - Intergenic
900499847 1:2998652-2998674 CTGGAGCAGGAGGAGGGGCAGGG + Intergenic
900600667 1:3501454-3501476 CTGCAGCCCCAGGAGGTGCCCGG - Intronic
900615410 1:3563437-3563459 CTGGAGTCACAGCTGGGGCAGGG + Intronic
900932454 1:5745922-5745944 CTGTGGCCGGAGGAGCGGCAGGG - Intergenic
901388917 1:8929933-8929955 CCTTAGCCACAAGAGGGGCTGGG + Intergenic
901645503 1:10714920-10714942 CTGGAGCAACAGGACTGGCATGG - Intronic
901962430 1:12838160-12838182 CATGAGCCACAGGAAGGGCAGGG + Intergenic
901977008 1:12953126-12953148 CATGAGCCACAGGAAGGGCAGGG + Intronic
902008161 1:13248644-13248666 CATGAGCCACAGGAAGGGCAGGG - Intergenic
902027137 1:13392443-13392465 CATGAGCCACAGGAAGGGCAGGG - Exonic
902571062 1:17347436-17347458 CTGGAGCAGCAGGAGGAGCACGG - Intronic
902658584 1:17886264-17886286 CTGCAGCCCCTGGAGGGGCCTGG + Intergenic
903377698 1:22876863-22876885 CTGTAACCCCAGGCGTGGCAAGG - Intronic
904396782 1:30227638-30227660 CTGTAGACCTAGGAGGGGCTTGG - Intergenic
904756207 1:32770156-32770178 CTGGATTGACAGGAGGGGCAGGG + Exonic
905214197 1:36395486-36395508 CCGTAGCCACAGGCCGGGCGTGG + Intronic
905631696 1:39522380-39522402 CTGCAGGGACAGAAGGGGCAAGG - Intronic
905666057 1:39763792-39763814 CTGCAGGGACAGAAGGGGCAAGG + Exonic
905773200 1:40651378-40651400 CAGAAGCCAGGGGAGGGGCACGG + Intronic
908102808 1:60808718-60808740 CTAAATCCACAGGTGGGGCAAGG + Intergenic
910196212 1:84642268-84642290 CTGTAGCTACAGTTGGGACACGG + Intergenic
910342478 1:86203435-86203457 CTGCAGTCACAGGACGAGCAGGG - Intergenic
911050286 1:93665191-93665213 CTGTAGACAGAGGAGGTACATGG - Intronic
912252459 1:108025722-108025744 CTGCAGCCACAGCTGGAGCAAGG - Intergenic
912949318 1:114109935-114109957 CTAAAGACACAGAAGGGGCAGGG + Intronic
914456582 1:147842311-147842333 CATGAGCCACAGGAAGGGCAGGG - Intergenic
915417643 1:155754374-155754396 CTGTAGCCACTGTAGCAGCAAGG - Exonic
916028450 1:160855694-160855716 CAGTAGCAACAGCAGTGGCAGGG - Intronic
916217703 1:162411643-162411665 CTGCAGCAGCAGGAGGGACATGG - Intronic
916449473 1:164906504-164906526 CTTGAGCCACAAGAGAGGCATGG - Intergenic
919124988 1:193382645-193382667 CTGTTGCCTCAGGTGGTGCATGG + Intergenic
920203535 1:204275464-204275486 CTGTGGCCAGGAGAGGGGCAGGG + Intronic
920682898 1:208086060-208086082 CTGAAGCCAGTGCAGGGGCAGGG - Intronic
921243354 1:213209741-213209763 CTGTAGGCAGAGTAGGAGCATGG + Intronic
921640896 1:217552468-217552490 AAGTAGCCACAGGAGGGCAAAGG + Intronic
921762472 1:218932013-218932035 CTGTAATCACAGGAAGGCCAAGG + Intergenic
922573804 1:226648860-226648882 CTGTGGCCACAAGATGGGAAGGG + Intronic
922801419 1:228366377-228366399 CTGGAGGCACAGGACCGGCAGGG - Intronic
1066556539 10:36620566-36620588 CTGTAGACACAGGCTTGGCATGG - Intergenic
1069338677 10:67385244-67385266 CTGGAGCCACAGGAGGCCCTGGG - Intronic
1069511906 10:69048785-69048807 CTGTGGACAGAGGAGGGGCAGGG - Intergenic
1069838805 10:71326597-71326619 CAGTGGACAGAGGAGGGGCAGGG - Intronic
1070912456 10:80130505-80130527 CTAAGCCCACAGGAGGGGCAAGG - Intergenic
1071102710 10:82058012-82058034 CTGTAGTCACAGGAGAGTAAGGG - Intronic
1071529894 10:86381043-86381065 CTGCAGCCACAGGTGGCCCAAGG - Intergenic
1073206032 10:101769925-101769947 CTGCACCCCCAGGTGGGGCAGGG - Intergenic
1075715669 10:124553834-124553856 CTGCAGACAGAGGAGGGGCCTGG - Intronic
1075815193 10:125259736-125259758 CTGCACCCACAGGAGGGGCAGGG + Intergenic
1076737742 10:132466259-132466281 CTGTGGCCACAGGAGGGGCCCGG - Intergenic
1076744896 10:132507922-132507944 CTGGAGCCACAGCAGGGTCACGG + Intergenic
1076768917 10:132652355-132652377 CTGCAGCCCCAGGAGGAGCGGGG + Intronic
1078097727 11:8310952-8310974 CTGGGGGCCCAGGAGGGGCAGGG - Intergenic
1078398565 11:11002809-11002831 CCAGAGCCAAAGGAGGGGCAAGG - Intergenic
1078423118 11:11228571-11228593 ATCGAGCCACTGGAGGGGCAGGG + Intergenic
1079396020 11:20064351-20064373 CTGTAGGCACCAGAGGGACATGG + Intronic
1080290842 11:30669903-30669925 CTGTAGCAAAAGGTGGGGCTAGG - Intergenic
1080653725 11:34242430-34242452 ACGCAGCCACAGGAGGGGCAGGG + Intronic
1080909162 11:36577962-36577984 CTGGAGCCACAAGAGGGTTAGGG - Exonic
1081993654 11:47350565-47350587 CAGTGGCCTCAGCAGGGGCAGGG + Exonic
1083491855 11:63019563-63019585 CAGCAGCCACAGCAGGAGCAGGG - Intergenic
1083660234 11:64248710-64248732 CTGAGGCCGGAGGAGGGGCACGG - Intergenic
1083709474 11:64539232-64539254 CTGAGGCGACAGGAGGAGCAGGG + Intergenic
1083777926 11:64903240-64903262 CTGGAGCCACAGCAGGTGCAGGG - Intronic
1083908027 11:65686803-65686825 CTGTGACCCCTGGAGGGGCAGGG - Intergenic
1084001661 11:66298579-66298601 TTGTAGCCACAGGCTGGGCGCGG + Intergenic
1084186428 11:67474861-67474883 CTGTGACCTCTGGAGGGGCAAGG + Intergenic
1084332443 11:68438041-68438063 CACCAGCCACGGGAGGGGCAGGG - Intronic
1084399883 11:68937347-68937369 CTGCAGCAGCAGGAGGGGCCTGG + Intronic
1084412510 11:69012856-69012878 CTGGAGCCTCAGGAGTGGCAGGG + Intronic
1084603136 11:70158459-70158481 CTGTATCAGCAGGAGGGGGATGG - Intronic
1084941221 11:72614458-72614480 CTCTAGCCACAGGAGGTGCTTGG - Intronic
1085449013 11:76620574-76620596 CTGGAACCCCAGCAGGGGCATGG + Intergenic
1085526318 11:77166287-77166309 CTGTGGCTCCAGGAGGGGCCTGG + Intronic
1086974072 11:93113237-93113259 GTGGAGCCATATGAGGGGCAGGG + Intergenic
1087791195 11:102407732-102407754 CAGAAGCCAGAGGAGAGGCATGG + Intronic
1089329590 11:117680322-117680344 CTGCACCCACAGGAGGGTCAGGG - Intronic
1089379488 11:118017429-118017451 CTGTATCCACAAGAGAGACAGGG + Intergenic
1089751433 11:120654154-120654176 CTGTAGTCAAAGCAGGGGCCTGG + Intronic
1089806630 11:121096462-121096484 CTTTAGCCAGAGTAGGGGCAGGG + Intergenic
1089894433 11:121914931-121914953 CTGTAGCCAAAGGAGTTTCAGGG - Intergenic
1091121366 11:133060602-133060624 ATGCAGCCACAGTAGGAGCAGGG - Intronic
1091601122 12:1918303-1918325 CAGCAGCCACAGGAGGGCCGAGG + Exonic
1091658393 12:2362734-2362756 CTGCAGCCACAGGAGAGAGAGGG - Intronic
1096257609 12:50072793-50072815 CACAAGCCACAGGAGGGGTAGGG + Intronic
1096452630 12:51756742-51756764 CTGGAACCCCAGGAAGGGCACGG - Intronic
1097596909 12:61644529-61644551 CACTAGCCACAAGAGCGGCAAGG + Intergenic
1097699648 12:62807044-62807066 CAGTAGCAACAGCAGGTGCAAGG + Intronic
1098498351 12:71163012-71163034 ATGTGGCCACAGAGGGGGCAGGG - Intronic
1099526056 12:83720658-83720680 CTTTTGCCACAGGAAGTGCAGGG - Intergenic
1100775447 12:97968303-97968325 CTATAGCCACAAGTGGGCCAGGG + Intergenic
1102580166 12:113881376-113881398 CCGTAGCCAGAGGAGGCCCACGG + Intronic
1103035222 12:117651212-117651234 CTGTTGCCTCAGGCAGGGCAGGG - Intronic
1103933360 12:124462372-124462394 CTGCAGCCAGCGGAGGGGCTTGG - Intronic
1103974312 12:124692361-124692383 CTGTTGCTACTGGAGGGGAAGGG - Intergenic
1104388955 12:128375246-128375268 CTGTTGTCACAGGAAGGCCACGG + Intronic
1104729441 12:131096990-131097012 CTGCAGCCACAGCAGAGGCGTGG - Intronic
1104955347 12:132462165-132462187 CTGTTGCCAAAGGCAGGGCATGG + Intergenic
1104980101 12:132569860-132569882 CCTGGGCCACAGGAGGGGCAGGG + Intronic
1105550102 13:21385845-21385867 AAGTAGCTACAGGAGGGGAAAGG + Intronic
1106209870 13:27631963-27631985 CTGAAGCCACAGGATAGGCATGG - Intronic
1106415269 13:29541048-29541070 CTGCAGCCACAGGTGGGAGAAGG + Intronic
1107414542 13:40188537-40188559 CTGAAGCCACAGGAGGGGAAGGG + Intergenic
1107740698 13:43446815-43446837 CTGTGCCCCCAGGATGGGCATGG - Intronic
1108094003 13:46881201-46881223 CTGTGGGCAGAGGAGGGGAAGGG + Intronic
1108695005 13:52895536-52895558 CTGAAGACACAGGAGAGGAAGGG - Intergenic
1108706311 13:52991661-52991683 CGGTCACCACAGGAGGGCCAGGG - Intergenic
1110401054 13:75092621-75092643 CTGAAGCCAGAGCAGGAGCACGG + Intergenic
1112637194 13:101227913-101227935 ATGTAGCCAAAGGAAGTGCAAGG - Intronic
1113630813 13:111882389-111882411 ATGAAGCCACAGGCCGGGCACGG - Intergenic
1113855100 13:113439411-113439433 CTGTAGGCCCAGGCTGGGCACGG - Intronic
1114297735 14:21345121-21345143 CTGGACCCACAGGAGCAGCAAGG + Exonic
1115174743 14:30549113-30549135 CTTTAGCCAGAGGAGTGGGAGGG + Intergenic
1118706221 14:68483002-68483024 CAGTTGCCACAGTAGGGGAAGGG + Intronic
1118881107 14:69826537-69826559 CTGTTGCCTCCGGAAGGGCAGGG + Intergenic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1119679128 14:76578658-76578680 CTGTGGCCAGAGGCGGGACAGGG + Intergenic
1119823666 14:77639944-77639966 CAGTAGCCATAGGCTGGGCACGG + Intergenic
1121043744 14:90773084-90773106 CTTCAGGGACAGGAGGGGCAAGG + Intronic
1121318248 14:92974875-92974897 CTGTGGTCACAGGAGGAGCGGGG + Intronic
1121473643 14:94174864-94174886 CGGACGCCTCAGGAGGGGCAAGG - Intronic
1122104478 14:99441738-99441760 ATGAGGCCACAGCAGGGGCAGGG + Intronic
1122701007 14:103589142-103589164 CTGTTGCCACAGGGAAGGCAGGG - Intronic
1122783703 14:104154423-104154445 CTGCGGCCACAGGTGGGGCCTGG + Intronic
1122912131 14:104835999-104836021 TTGTAGCCACAGCAGGAGCCTGG + Intergenic
1123506240 15:20942757-20942779 CTGTGGCCATGGCAGGGGCAGGG + Intergenic
1123953677 15:25311424-25311446 ATGTTGCCACGGGAGTGGCAGGG + Intergenic
1125587502 15:40831280-40831302 CAAGAGCCACAGGATGGGCACGG + Intergenic
1125726302 15:41870015-41870037 CTGCAGCTGCGGGAGGGGCAGGG + Exonic
1126129476 15:45326384-45326406 CTCTAGCCCCAGGCCGGGCACGG - Intergenic
1126531612 15:49716711-49716733 CTGTAGCAAGAGGAAGGACAAGG + Intergenic
1126938024 15:53733436-53733458 ATGTAGCCACAGGAAGAGCTGGG - Intronic
1127260498 15:57323448-57323470 CTGTGGCCAGAGGAAGGGTACGG + Intergenic
1127832072 15:62759753-62759775 ATGTAGCCACTGGTGGGGCTGGG + Intronic
1128073740 15:64813229-64813251 CAGTAGCCACAGGACTTGCATGG + Intergenic
1128223230 15:65983068-65983090 ATGGAGCCAGGGGAGGGGCAGGG - Intronic
1129421407 15:75430249-75430271 CTTCATACACAGGAGGGGCAGGG + Exonic
1129506996 15:76089711-76089733 ATGTACCGACAGGAGAGGCAAGG + Intronic
1130106726 15:80934356-80934378 CAGTGGCCACATGAGGGACAGGG + Intronic
1131265298 15:90912020-90912042 CTGTGGGCACAGGAGGGGTGAGG - Intronic
1132218221 15:100083823-100083845 CTAGAGCCACTGGAGGGGGAAGG - Intronic
1132219707 15:100096321-100096343 CTGTAGCCACAGCAGCCCCATGG + Intronic
1202971824 15_KI270727v1_random:243598-243620 CTGTGGCCATGGCAGGGGCAGGG + Intergenic
1132761138 16:1509162-1509184 CTGAAGCACCAGGAGGAGCAGGG + Intronic
1133722868 16:8511277-8511299 CTGTAGCTACAGAAAGGGTAAGG + Intergenic
1135052868 16:19206635-19206657 CAGAAGCCACAGGAGAGGCCTGG - Intronic
1135767645 16:25191691-25191713 CTACAGCAACAGGATGGGCATGG + Intergenic
1138189954 16:55006758-55006780 CTGGAGCCACAGGAAGGGAATGG + Intergenic
1138496131 16:57410471-57410493 CTGTGGCCAAAGGAAGGGAAAGG - Intronic
1138538017 16:57670024-57670046 CTGTGGCTACAGGAGGGAAATGG + Intronic
1138608659 16:58105737-58105759 CTGCAGACAGAGGAGGGGCCAGG - Intergenic
1138636650 16:58344723-58344745 CTGTAACCACAGGACAGGAAGGG + Intronic
1139327494 16:66163773-66163795 CTGTAGCCACAGGACCAGCGTGG + Intergenic
1139922789 16:70470436-70470458 CAGCAGGCACCGGAGGGGCAGGG - Intronic
1142026421 16:87816562-87816584 CTGGAGCCCCAGGAGTGGAAGGG - Intergenic
1142112192 16:88338862-88338884 CTGGAGCCTCAGGAGGAGCGTGG + Intergenic
1142124849 16:88405172-88405194 TTGCAGCCACAGGATGGGCCAGG + Intergenic
1142147956 16:88500262-88500284 CGGCAGGCCCAGGAGGGGCAAGG - Intronic
1142220971 16:88854769-88854791 CTGTCGACTCAGGAGGGCCAGGG + Intronic
1143189951 17:5033799-5033821 CTGTAACCACAGGGGGCTCAGGG - Exonic
1143663056 17:8339150-8339172 CTGGAGCCACAGGCCAGGCAAGG + Intergenic
1144968741 17:19093908-19093930 CTCTAGCCAAAGCAGGGGCAAGG + Exonic
1144979175 17:19158158-19158180 CTCTAGCCAAAGCAGGGGCAAGG - Exonic
1144989047 17:19220074-19220096 CTCTAGCCAAAGCAGGGGCAAGG + Exonic
1145317299 17:21742638-21742660 CTGTGGCCACAGGCGTGGCCTGG - Intergenic
1146286083 17:31575033-31575055 CTGTGTTCACAGGAGGGGCGTGG - Intronic
1150358292 17:64506624-64506646 CTGTAACCAAAAGAGGGGGAAGG + Exonic
1150852269 17:68714971-68714993 CAGTAGTCACAGGGGGGACACGG - Intergenic
1151342512 17:73481067-73481089 CAGCAGCCTCAGGAGGGGAAGGG + Intronic
1151625396 17:75272500-75272522 CTGTAGCCCCAGAAGGGCCGTGG - Intergenic
1203172889 17_GL000205v2_random:167487-167509 CAGTAGCCAGGGGATGGGCAGGG + Intergenic
1154107376 18:11534249-11534271 CTGCGGCCACAGCAAGGGCACGG + Intergenic
1155409834 18:25531810-25531832 CTGGAGCCACAGGAATGGCAAGG - Intergenic
1156490916 18:37495523-37495545 CTGGAGCCTCAGATGGGGCATGG - Intronic
1158557504 18:58487352-58487374 CGGAAGCCAGAGGAGAGGCATGG + Intronic
1159413418 18:68111381-68111403 TTGCAGCCAGAGAAGGGGCAAGG - Intergenic
1159775558 18:72600017-72600039 CTGTAACCACAGGCGGTGCTTGG - Intronic
1160372950 18:78389919-78389941 CTGCAGGCACAGCAGGTGCAGGG - Intergenic
1160411553 18:78678506-78678528 CTGGAGCCCCAGAGGGGGCAGGG - Intergenic
1161592007 19:5133131-5133153 CTGTGTCCACAGGAGATGCAGGG + Intronic
1161663554 19:5561400-5561422 CTGGAACAACAGGAGGGGAAGGG + Intergenic
1161709329 19:5838963-5838985 TTGAAGCCACAGGTGGGGCAAGG - Exonic
1161772584 19:6239125-6239147 CTGTGTCCAGAGGAGGGGCAGGG - Intronic
1162153293 19:8660342-8660364 CTGTAGACACAGAGGGGGAATGG + Intergenic
1163007964 19:14408142-14408164 CTGTGGCCACAGGAGCTGCTGGG - Exonic
1163297954 19:16424518-16424540 CTGCAGACACAGGCTGGGCACGG + Intronic
1163426187 19:17242372-17242394 CAGTCGCCACCTGAGGGGCAGGG - Intronic
1163591656 19:18197248-18197270 CTATATGTACAGGAGGGGCAGGG + Exonic
1165230217 19:34382034-34382056 CTGTAGCAACAGGTGGTCCATGG + Intronic
1165329888 19:35135486-35135508 CTGTAGCCAGGGGAGGGGGCTGG - Intronic
1165906826 19:39199362-39199384 CTGTAGCACCAGGAGGGTCTTGG - Intronic
1166091817 19:40514262-40514284 CTGCAGGCACAGTAGGGGCAAGG - Intronic
1167240233 19:48339084-48339106 CTGTGCCCAGAGGAGGGGCAGGG + Intronic
1167276079 19:48540492-48540514 CAGTAGGCACAGGTGGGGAAGGG - Intergenic
1167604063 19:50470941-50470963 CAGTAGCCACAGGCTGGGCGCGG - Intronic
927981688 2:27378541-27378563 CGGAAGCCACAGGTCGGGCAGGG + Exonic
928132418 2:28662196-28662218 TTATGCCCACAGGAGGGGCAGGG - Intergenic
928979373 2:37122313-37122335 CTGCAGCAAGAGGAGGAGCAAGG + Intronic
929371994 2:41236706-41236728 CAATAGCCAAAGGAGGAGCAAGG + Intergenic
929553794 2:42911203-42911225 CTGTAGCGACAGGGGAGGCTGGG + Intergenic
931436304 2:62250296-62250318 TTGTAGAGACAGGAAGGGCAGGG - Intergenic
931961655 2:67489498-67489520 CTGTAAGCACAGGAGAGGAAGGG + Intergenic
932740111 2:74284760-74284782 CAGGAGCCAAGGGAGGGGCAGGG - Intronic
933683311 2:85122633-85122655 CGGAAGCCACAAGAGAGGCATGG - Intergenic
935673525 2:105575379-105575401 GTGAAGCCACAGGAGAGTCAGGG + Intergenic
936111861 2:109671287-109671309 CTGCAGCCAGGGCAGGGGCAGGG + Intergenic
938988818 2:136606945-136606967 CTTTTGCCACAGAAGGGCCATGG + Intergenic
939539874 2:143480780-143480802 CTGAAACCACAGGCGGGGGAAGG + Intronic
939569665 2:143825617-143825639 CTGTAGCCAACGGAGGGGGTTGG - Intergenic
945058651 2:205889528-205889550 CTGGAGGCACAGGAAGGGCAGGG + Intergenic
946357818 2:219199649-219199671 CTCTAGCCAGAGGCGGGGCCTGG - Intronic
946834639 2:223760929-223760951 CTGTAGCCTCGGGAGGGGCCTGG + Intronic
948088143 2:235267630-235267652 CACTAGCTACAGGAGGAGCAGGG - Intergenic
948253976 2:236552740-236552762 ATGTAGCCACTGAAGGGACAAGG + Intergenic
948422874 2:237871263-237871285 CTTTAGACAGAGCAGGGGCAGGG + Intronic
948460963 2:238129801-238129823 CTGTAGCCACAGGTGGCTCCTGG + Intronic
948694303 2:239725494-239725516 CTGTAGCCACAGGACGAAGAGGG - Intergenic
948802250 2:240438251-240438273 CTGCAGCCATAGGGGGTGCAGGG - Intronic
948907632 2:240987249-240987271 CTGGAGCCTGAGGAGGGGGAGGG + Intronic
1170579101 20:17684583-17684605 CTGTTGGCAGATGAGGGGCAAGG - Intergenic
1170962445 20:21037392-21037414 CTGCAGGGCCAGGAGGGGCAGGG + Intergenic
1172115371 20:32570507-32570529 CTGTGGGGACAGGAGGGGGAAGG - Intronic
1172331519 20:34079033-34079055 CTGCAGCCACAGGAGGCTCTTGG - Intronic
1172336827 20:34123263-34123285 CTGTAGCCACAGCTGGAGCCTGG - Intergenic
1172409962 20:34713750-34713772 AAGTAGCCACTGGAGGGGAAAGG + Intronic
1173318914 20:41970039-41970061 CTGGGGTCACAGGAAGGGCAGGG - Intergenic
1175536226 20:59716070-59716092 CATGAGCCAGAGGAGGGGCAGGG - Intronic
1175728048 20:61332784-61332806 CTGGCGCCACAGCCGGGGCAGGG - Intronic
1176021893 20:62966410-62966432 GTGGAGCCACGGGAGGGGCTGGG - Intronic
1176200814 20:63859517-63859539 CTGCAGCCAAGGGATGGGCAAGG - Intergenic
1176229219 20:64023138-64023160 CTGTAGCCTGAGGAGTGGCCTGG + Intronic
1178587884 21:33885215-33885237 CTGGACCTAGAGGAGGGGCATGG + Intronic
1179479929 21:41670532-41670554 CTGCAGCAACAGGAGGTGGAGGG + Intergenic
1179502338 21:41818071-41818093 GCGTAGAGACAGGAGGGGCAGGG - Intronic
1179732174 21:43374094-43374116 CTCTGGGCACAGGAGGGCCAAGG - Intergenic
1181015298 22:20065218-20065240 CTGTGGCCACAGGAGAGGAGGGG - Exonic
1182283830 22:29232544-29232566 CTGTAACCACAGGAGGACAACGG - Intronic
1183172820 22:36200484-36200506 CGGCAGCCACAGCAGGGGCTAGG - Intronic
1183177375 22:36234008-36234030 CGGCAGCCACAGCAGGGGCTGGG - Intronic
1183196784 22:36358937-36358959 CTGTGGCAAAAGGAAGGGCAGGG - Intronic
1183461563 22:37953983-37954005 CTGGAGGCACAGGAGGGCCCAGG + Intronic
1184403269 22:44286136-44286158 ATGTAGGCAAAGGTGGGGCAGGG - Intronic
1184413439 22:44338668-44338690 CTGTAGCCACAGGGAAGCCATGG - Intergenic
1184417424 22:44360442-44360464 CTGCAGCCCCGGGTGGGGCAGGG - Intergenic
1184677635 22:46052423-46052445 CTGGGGCCTCAGCAGGGGCAGGG + Intronic
949357498 3:3197582-3197604 CTCTAGACACTGGAAGGGCAAGG - Intergenic
949543879 3:5055476-5055498 CTGTAGCCACAGAAGAGGAAGGG - Intergenic
950113964 3:10438608-10438630 CTGAAACCACAGCAGGGGCCTGG + Intronic
950161605 3:10764753-10764775 TTGTAGCCAGAGGCGAGGCAGGG - Intergenic
950502269 3:13372063-13372085 CTGCCTCCACAGGAGAGGCAGGG + Intronic
951541820 3:23789202-23789224 CTGGACACACAGGAGTGGCAGGG + Intergenic
952581501 3:34838667-34838689 CAGAAGTCACAGGAGGGGAAAGG + Intergenic
953041683 3:39261161-39261183 CTTCATCCACAGGAGGGCCAAGG - Intergenic
953391273 3:42535268-42535290 CTGGAGCCAGGGGTGGGGCAGGG + Intronic
953660604 3:44888847-44888869 CTCTTGCCACAAGAGGGGTATGG + Intronic
954003808 3:47577584-47577606 CTGTAGCCTCAGGAATGGCAGGG + Exonic
954145537 3:48632625-48632647 CAGTAGACACAGGTGGGACAGGG - Intronic
954199205 3:49014249-49014271 CTGCAGCCACAAGGGGGCCAAGG - Exonic
954369008 3:50160619-50160641 CTCTGGCCAGAGGAGGGCCAAGG - Intronic
954385826 3:50243279-50243301 CTGTGGCCAAAGAAGGGGCCTGG - Intronic
954958999 3:54548269-54548291 ATGTAGCCACATTAGGAGCAAGG + Intronic
955748259 3:62161702-62161724 CTGTAGCCACAGGAGGGGCATGG + Intronic
961413419 3:126740228-126740250 CTGCAGCTGCAGGAGGGACAAGG - Intronic
961662532 3:128477321-128477343 CTGTTGCCACAGTGAGGGCAGGG - Intergenic
961780746 3:129318878-129318900 CTGCAGCCACAGGCTGGGCCAGG + Intergenic
962162606 3:133014585-133014607 ATGTAGCCAGAGCAGAGGCAAGG - Intergenic
962430121 3:135311394-135311416 CTATAGGCAAACGAGGGGCAGGG + Intergenic
963093326 3:141507860-141507882 CTGTAGCCACAAGAGAGGCTGGG + Intronic
963103019 3:141623621-141623643 CAGCAGCCACAGGCGGGCCAAGG - Intergenic
963163779 3:142180199-142180221 CTGCAGCCACAGGATTGCCAGGG - Intronic
966309129 3:178574331-178574353 CTGAAGCCCCAGGAGGAGCCAGG - Intronic
966854331 3:184183906-184183928 CTGTGGCCACAGGGGTGGGAAGG - Exonic
968264543 3:197352676-197352698 CTGCAGACACAGCGGGGGCAGGG - Intergenic
968524515 4:1049199-1049221 CTGTGGCCACAGGGGAGGCCGGG - Intergenic
969092605 4:4706505-4706527 CTGTAGCCAAAGCCTGGGCAGGG + Intergenic
969099406 4:4757497-4757519 GTGTAACCGAAGGAGGGGCAAGG + Intergenic
969457458 4:7308299-7308321 CTGGAGCAGCAGAAGGGGCAGGG - Intronic
970170473 4:13284307-13284329 CTGTAGCCACCTCAGGGGCTTGG - Intergenic
970193525 4:13535832-13535854 GTGTAGCCACAGAAGGGGGCCGG + Intergenic
974747227 4:66091449-66091471 CTGTTGCCTCAGGTGGTGCAGGG + Intergenic
976824560 4:89246473-89246495 CTGGAGACACGGGAGGGCCAAGG + Exonic
978585489 4:110272008-110272030 CTGGAGACCCAGGAGAGGCAAGG + Intergenic
979961706 4:127028124-127028146 CAGTAGTGACAGGAGGGGAAAGG + Intergenic
984769605 4:183425945-183425967 CTGAGGACACAGGAGGGGGAGGG - Intergenic
984928548 4:184826680-184826702 CTGAAGCCCCAAGATGGGCATGG - Exonic
988107438 5:26769969-26769991 CTGTTGCCTCAGGCGGTGCAAGG - Intergenic
988485506 5:31665307-31665329 CACTAGCCACAGGAAGGGCAAGG - Intronic
989823651 5:45827306-45827328 CTGTAACTACAGCTGGGGCAGGG + Intergenic
991352518 5:65733596-65733618 CATGAGCCACAGGAAGGGCAGGG - Intronic
991961026 5:72044377-72044399 CTGTTGCCAAAGAATGGGCAAGG + Intergenic
997376831 5:133403472-133403494 CTGGGGCCACACGAGGAGCAAGG - Intronic
998007816 5:138668709-138668731 CTGAAGGCACGGGAGGGGCCGGG - Intronic
999224481 5:150009762-150009784 CTGAGGCCTCAGGAGGGGAAAGG + Intronic
999431965 5:151532038-151532060 CTGCAGCCACAGGAGGGGCTGGG + Intronic
999665785 5:153911405-153911427 CAGTAGCCATAGGTGGGGAAGGG - Intergenic
999692199 5:154157807-154157829 CCTTAGCCACTGGAGGGCCAAGG + Intronic
1001574309 5:172751924-172751946 CTGTAGGCACTGGTAGGGCAGGG - Intergenic
1002055341 5:176595391-176595413 CAGAGGCCCCAGGAGGGGCAGGG + Intronic
1002179661 5:177424545-177424567 CTGAAGTCTCAGGAGGGGCCTGG - Intronic
1002528055 5:179826107-179826129 CTGTAGCCACAGGAGGCAGCAGG - Intronic
1002564194 5:180100716-180100738 CTGTAGCCACAGTTCAGGCATGG - Intergenic
1003083470 6:3041664-3041686 CTGTATCCAAAGGAGAGTCATGG - Intergenic
1003191537 6:3879429-3879451 CGGGAGCCACAGCAGGGTCAGGG + Intergenic
1006365006 6:33610151-33610173 CTGGAGCCACAGGAAGGGATTGG - Intergenic
1006447819 6:34089816-34089838 CTGGAGGGACAGGAGAGGCATGG - Intronic
1007082505 6:39117809-39117831 CTGTAGCTATAGGAGAAGCAAGG + Intergenic
1007789413 6:44300645-44300667 GTGCAGCCACATGGGGGGCAAGG - Exonic
1010057649 6:71585073-71585095 CTGTAGTCACGGGAGGGCCCGGG - Intergenic
1010750858 6:79614786-79614808 CAGTGGCCACAGGAGAGGAAAGG + Intergenic
1011588947 6:88952239-88952261 CTGTAGCCACTGTAGGGGATGGG - Intronic
1012990605 6:105922131-105922153 CTGTAGCCACAGAAAAGTCAAGG + Intergenic
1015804204 6:137092150-137092172 CTGCAGCAACAACAGGGGCAAGG - Intergenic
1016409339 6:143765571-143765593 CTGGAGCCACAGGGGGTGGAGGG - Exonic
1017587264 6:155940825-155940847 TTGTAACCCCAGGAGGGGCCTGG + Intergenic
1018096427 6:160390918-160390940 CTGGAGCCAGGAGAGGGGCATGG - Intronic
1018209868 6:161470553-161470575 GTGTGGCCAGAGGAGGGCCAGGG - Intronic
1018703484 6:166446387-166446409 CTGTAGTCTCAGAAGGGACAAGG + Intronic
1018905177 6:168071830-168071852 CTTGAGCAACAGGAGGGGCTGGG - Intronic
1019001934 6:168761272-168761294 CTGTAGACTCAGGAGTTGCAAGG - Intergenic
1019135440 6:169904868-169904890 CTGGAGCTGCAGGAGGGGCAGGG + Intergenic
1019275449 7:173269-173291 CTGTGTCCACAGATGGGGCAGGG + Intergenic
1019625689 7:2014632-2014654 CTGTGTCCACAGGAGCGGGACGG - Exonic
1019632967 7:2059405-2059427 ATGTGGCCAGAGGAGAGGCACGG + Intronic
1019751788 7:2735234-2735256 CCGTGGCCACAGGAGAGGGAGGG - Intronic
1022400442 7:30031186-30031208 CTGTAGGCTCAAGAAGGGCATGG - Intronic
1023020828 7:36010485-36010507 CTGTAGCTACAGGAGCTGAAGGG - Intergenic
1023601744 7:41887386-41887408 ATTTGGCCACAGGAAGGGCAGGG - Intergenic
1024394310 7:48848239-48848261 CAGGAGCCAGAGGAGGGGCCTGG + Intergenic
1024400956 7:48924406-48924428 CAGGAGCCAGAGGAGGGGCCTGG - Intergenic
1025810301 7:64871341-64871363 CTGTAGGCCCATGAGGAGCATGG - Intronic
1026302024 7:69106440-69106462 CTGTAGGCAGAGCAGCGGCATGG + Intergenic
1026528483 7:71176363-71176385 CTTTAGCCCCTGGACGGGCAGGG - Intronic
1026906018 7:74063230-74063252 TTGAAACCCCAGGAGGGGCAGGG + Intronic
1027016824 7:74784706-74784728 CGATAGCCACAGGCTGGGCAAGG - Intronic
1027071203 7:75161230-75161252 CGATAGCCACAGGCTGGGCAAGG + Intergenic
1028522144 7:91743091-91743113 CTTCAGCCACAGGATGGGAAAGG + Intronic
1029747706 7:102525586-102525608 ATGGAGCCACAGTGGGGGCATGG + Intergenic
1029765657 7:102624676-102624698 ATGGAGCCACAGTGGGGGCATGG + Intronic
1031122517 7:117738052-117738074 GTGGTGCCACAGGAGTGGCAGGG + Intronic
1032330982 7:130979226-130979248 TTGAAGCCACAGCAGGGGCAAGG + Intergenic
1033597149 7:142866267-142866289 CTGCAGCCTGAGGAGGGTCAGGG - Exonic
1036557387 8:9872324-9872346 CTGTTGCCACAGGATGGACCTGG + Intergenic
1038187759 8:25291166-25291188 CTTTAAACCCAGGAGGGGCATGG + Intronic
1038779211 8:30556504-30556526 CAGGAGACACAGGAGGGGGAGGG - Intronic
1040388162 8:46927938-46927960 CTGTAGCCACATGAGGGAGTGGG - Intergenic
1040621370 8:49096303-49096325 CTGCAGGAACAGTAGGGGCAAGG - Intergenic
1041312297 8:56529513-56529535 TTATAGGCACAGGATGGGCATGG - Intergenic
1043110429 8:76172921-76172943 GTGTAGCCACAGGAGAGGCAGGG - Intergenic
1044898171 8:96915240-96915262 CTTTGGACACAGGAGAGGCACGG - Intronic
1046044804 8:108951219-108951241 CTGTAGTATCAGGCGGGGCACGG - Intergenic
1047289997 8:123521443-123521465 CTGATGCCCCAGGAGTGGCATGG + Intronic
1048003352 8:130397790-130397812 CTGGGGCCACAGGAGGGGCATGG - Intronic
1049360777 8:142211674-142211696 CTGAGGTCTCAGGAGGGGCAAGG + Intergenic
1049674810 8:143884718-143884740 CTGCAGGAACAGGAGGTGCAGGG - Intergenic
1050141979 9:2525463-2525485 CTGTAGGCAGAGCAGTGGCATGG - Intergenic
1050977846 9:11964932-11964954 CTGTGGCCAGAGGAGGTGAAAGG + Intergenic
1053067402 9:35078319-35078341 CTGGAGACACAGGAGCAGCAGGG - Exonic
1053433659 9:38060729-38060751 ATGGAGCCACAGGAGATGCAGGG - Intronic
1056591334 9:87968212-87968234 ATGGAGCCACAGGAGGGCCCTGG + Intronic
1059438076 9:114288443-114288465 CTGTGTCCACAGGGGGAGCAGGG + Exonic
1059545372 9:115170704-115170726 CTGTAGCCACCAGGGGAGCAGGG - Intronic
1059921662 9:119167233-119167255 CCGGGGCCACAGGAGGGGCCAGG + Exonic
1060074634 9:120580208-120580230 CTGGCGCCAGAGGACGGGCAGGG + Intergenic
1060219585 9:121757256-121757278 CTGTGGCCTCAGCAGGGGCCAGG + Intronic
1060359756 9:122943590-122943612 CTTTATCTACATGAGGGGCATGG + Intronic
1060585560 9:124783155-124783177 CTGCAGCCTGCGGAGGGGCAGGG - Intronic
1060799054 9:126532237-126532259 CAGAAGCCACAGGAGGGCCAGGG - Intergenic
1061943304 9:133894412-133894434 CTGTGGCCACAGGAGCCACAAGG + Intronic
1062320204 9:135986933-135986955 CTCCAGCCAGGGGAGGGGCAGGG - Intergenic
1062357180 9:136170517-136170539 CTGTAGACCCAGCAGGGGCAGGG + Intergenic
1062364466 9:136202303-136202325 CTGGAGCCGCAGGATGGGGAAGG - Intronic
1062607612 9:137355153-137355175 CTGAAGCCCCATGAGCGGCAGGG + Intronic
1203433226 Un_GL000195v1:111192-111214 CAGTAGCCAGGGGATGGGCAGGG - Intergenic
1189236224 X:39489380-39489402 CTCAAGCCACAGGAGCTGCAGGG + Intergenic
1193583608 X:83294251-83294273 CTCTAGCCACAGGTGAGGCCTGG + Intergenic
1195277740 X:103298865-103298887 CTGTGACCCCTGGAGGGGCAAGG + Intergenic
1195313209 X:103654089-103654111 CTGTGACCCCTGGAGGGGCAAGG + Intergenic
1198256161 X:134925867-134925889 CTGCTGCCTCCGGAGGGGCAGGG + Intergenic
1198721881 X:139631114-139631136 ATATAGCCACAGGAGGGGATGGG + Intronic
1199579316 X:149345523-149345545 CCGTACACACAGAAGGGGCATGG - Intergenic
1199702466 X:150392633-150392655 CTGAAACCACAGGAGAGGGATGG + Intronic
1199894243 X:152116501-152116523 CTGGAGTGACAGCAGGGGCAGGG + Intergenic
1200124399 X:153806444-153806466 GTGTATCCCCAGGAGGGGGATGG - Intronic
1201610735 Y:15840246-15840268 ATGTGGCCACAGGATGGGGATGG + Intergenic