ID: 955749152

View in Genome Browser
Species Human (GRCh38)
Location 3:62169749-62169771
Sequence CTTGTGTCATTTATCAACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 1, 2: 1, 3: 18, 4: 131}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955749147_955749152 16 Left 955749147 3:62169710-62169732 CCTTCTTCAAAATTATGAGCTTG 0: 1
1: 0
2: 2
3: 17
4: 231
Right 955749152 3:62169749-62169771 CTTGTGTCATTTATCAACACTGG 0: 1
1: 1
2: 1
3: 18
4: 131
955749145_955749152 27 Left 955749145 3:62169699-62169721 CCCAGTGCTATCCTTCTTCAAAA 0: 1
1: 0
2: 0
3: 20
4: 257
Right 955749152 3:62169749-62169771 CTTGTGTCATTTATCAACACTGG 0: 1
1: 1
2: 1
3: 18
4: 131
955749146_955749152 26 Left 955749146 3:62169700-62169722 CCAGTGCTATCCTTCTTCAAAAT 0: 1
1: 0
2: 0
3: 18
4: 375
Right 955749152 3:62169749-62169771 CTTGTGTCATTTATCAACACTGG 0: 1
1: 1
2: 1
3: 18
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955749152 Original CRISPR CTTGTGTCATTTATCAACAC TGG Intronic
900861609 1:5237196-5237218 CTTGGGACATTCACCAACACCGG + Intergenic
901591244 1:10345225-10345247 CTGGTATCATTTATAAATACAGG - Intronic
907610696 1:55867335-55867357 CTTGTTTCAGTTATAAACATAGG + Intergenic
909733346 1:78924505-78924527 CCTGGGTCATTTATCAGCCCAGG - Intronic
910368628 1:86492729-86492751 CTTATGTCATTTATCTCCACAGG + Intronic
922982254 1:229837235-229837257 CTTGTGTCATTTTACAAAAATGG + Intergenic
1063566392 10:7175057-7175079 CTTGTGACGTTTGTCAACATGGG - Intronic
1064128984 10:12690881-12690903 CTTGTGGCACTTAGTAACACGGG + Intronic
1064789582 10:18941001-18941023 CTTGAGTCACTCAGCAACACTGG + Intergenic
1069256818 10:66343283-66343305 ATTGTGTCATTAATCACAACAGG + Intronic
1069552003 10:69370792-69370814 CTTCTGTTCTTTATCAACTCTGG - Intronic
1072524609 10:96260199-96260221 TCTGTGTCATCTATGAACACAGG - Intronic
1074695595 10:116047559-116047581 CTTTTGTATTTTACCAACACTGG + Intergenic
1075040036 10:119100829-119100851 CTTGTGATATTTATCAACCAGGG - Intergenic
1077788395 11:5411457-5411479 CATGTGTCACTTAGCAACAGGGG - Intronic
1077813506 11:5662494-5662516 CATGTGGCATTTCTCAACAATGG - Intergenic
1078788714 11:14521855-14521877 CTTCTCTAATTCATCAACACTGG + Intronic
1079296242 11:19237207-19237229 TTTGTGTCATTTACAAACACTGG + Intronic
1081180077 11:39974032-39974054 CTTGAATCATTTATTATCACTGG - Intergenic
1081203624 11:40248693-40248715 CTTTTTTCATTTTTCAAGACAGG - Intronic
1085801571 11:79594566-79594588 GTTTTGTCATTTATAAACATGGG - Intergenic
1094866683 12:34541477-34541499 GTTGTTTCATTTTTCACCACAGG + Intergenic
1097496786 12:60349738-60349760 ATTGAGTCATCTTTCAACACAGG + Intergenic
1100404172 12:94258669-94258691 CCTGTGTCAGTTATCATTACTGG - Intronic
1104515525 12:129421745-129421767 GCTATGTCATTTATAAACACGGG - Intronic
1106697784 13:32195910-32195932 TTTCTGCCATTTCTCAACACAGG + Intronic
1109249067 13:59996418-59996440 CTTGTGTCAATTATCAAAAAGGG + Intronic
1111002276 13:82200256-82200278 ATTTTGTCATTTATAAACACTGG - Intergenic
1111043355 13:82781363-82781385 CTTATTGCATGTATCAACACAGG - Intergenic
1111173534 13:84561686-84561708 CTTGTTTCAAATACCAACACTGG + Intergenic
1111606484 13:90546189-90546211 CTTGTGTCATGTTACAATACAGG + Intergenic
1111620895 13:90724514-90724536 CTTGTATCATTTATTAAGCCTGG + Intergenic
1111735824 13:92138210-92138232 CATGTGTCACTTATAAAAACTGG + Intronic
1113711520 13:112468181-112468203 CTTGTGGTGTTTTTCAACACAGG + Intergenic
1115623023 14:35159446-35159468 CTTGTAGCATTTATTAACCCTGG + Intronic
1115734107 14:36305281-36305303 CTTGTGTCATGTATGTTCACAGG + Intronic
1118709351 14:68506991-68507013 CTTGTGTCCTGTATAAACAAGGG - Intronic
1121482171 14:94287551-94287573 CTAGTGTCTTTTCTCAACACAGG + Intronic
1124327480 15:28780132-28780154 CATGTGTCACTTATAAAAACTGG + Intergenic
1124529488 15:30492131-30492153 CATGTGTCACTTATAAAAACTGG + Intergenic
1124769167 15:32515549-32515571 CATGTGTCACTTATAAAAACTGG - Intergenic
1124860825 15:33438974-33438996 CTTGGGTCATTTATCAGCATCGG - Intronic
1126150766 15:45522275-45522297 CTGGTGTCATTTAAAAACAGCGG + Exonic
1126978114 15:54208876-54208898 CTTATCCCATTTGTCAACACAGG + Intronic
1129985251 15:79913413-79913435 ATTGGGACATTTATCAACAAAGG + Intronic
1133792803 16:9022243-9022265 CCTCTGTCATTTATCAACACAGG - Intergenic
1135508021 16:23055876-23055898 TTGATGTCATTTACCAACACAGG + Intergenic
1137988251 16:53128786-53128808 CTTGTGACATTTATTTTCACTGG - Intronic
1141354087 16:83327085-83327107 CTTGTGTCATTTATAAAGGCAGG + Intronic
1143796376 17:9340238-9340260 CTTCTCTCATTTATCAAAGCTGG + Intronic
1144207337 17:12988435-12988457 CTTGGGTCATGTCTCTACACAGG - Intronic
1144792407 17:17867832-17867854 CTTGTGTGTTTTTTCAACAGTGG + Intronic
1149040048 17:52177206-52177228 CCTGTGTCAGTTCTCTACACTGG - Intergenic
1150954424 17:69841298-69841320 CATGTATCATTCAACAACACAGG + Intergenic
1157741714 18:50099366-50099388 CCTGTGTCACTTATCCACTCTGG - Intronic
1159027266 18:63195247-63195269 CATCTGTCATTTATCAATACAGG + Intronic
1159241925 18:65751860-65751882 CTTTTCTCATTAATCCACACTGG - Intronic
1159780273 18:72652926-72652948 ATTGTGTATTTTTTCAACACTGG + Intergenic
1161807236 19:6451662-6451684 CTTGAGACCTTTATCAACACAGG - Intronic
1164351629 19:27352161-27352183 GATATTTCATTTATCAACACAGG + Intergenic
930515676 2:52404836-52404858 CTTGTGTCATTTATAAAATGGGG - Intergenic
930910853 2:56627869-56627891 TTTGTGACATTTATAAACAAGGG - Intergenic
932011926 2:67987200-67987222 CTTGTGTCTTTGGTCCACACTGG + Intergenic
933570099 2:84000466-84000488 CTTGTGTCAGAGATCAAAACTGG - Intergenic
935327484 2:101950204-101950226 CTTCAGCCATTTATCAACAGAGG - Intergenic
938792139 2:134686101-134686123 CTTGTCTCTTTTATCAAAAAAGG + Intronic
941039380 2:160603226-160603248 CTTATGTAATGTCTCAACACAGG - Intergenic
941372990 2:164690899-164690921 GTTGTGTAATTTATTAACAAGGG + Intronic
943480972 2:188417160-188417182 CTTGTCTCATTTATTATGACAGG + Intronic
945989183 2:216379411-216379433 CTTATAGCACTTATCAACACAGG - Intergenic
948510944 2:238464829-238464851 GTGATGTCATTTATCAACACTGG - Intergenic
1172461862 20:35125141-35125163 ATTGTGTCATTTACCAAGAAGGG - Intronic
1174619798 20:51865294-51865316 CTTCTCTCCTTTATCTACACTGG + Intergenic
1178307850 21:31505472-31505494 CTGGTGTCATTCACAAACACAGG + Intronic
1180680599 22:17623700-17623722 CTTGTAGCATTTATAAACACCGG - Intronic
1183647036 22:39132893-39132915 GTTGTGTGATGTATCAGCACAGG - Exonic
1184603018 22:45554582-45554604 CTTGAGGCATTTATCGAGACTGG - Intronic
949444922 3:4124048-4124070 CTTGTTTTATTTATCAACAGGGG - Intronic
949588456 3:5467104-5467126 ATTGTGAGATTTATTAACACCGG + Intergenic
951592118 3:24277663-24277685 TTTATGTCATTTACCAACAAAGG + Intronic
955749152 3:62169749-62169771 CTTGTGTCATTTATCAACACTGG + Intronic
956944912 3:74209998-74210020 CTTGAGTCAAGTATCAACCCTGG + Intergenic
963587714 3:147214220-147214242 CTGGTGTCATTTTTCAAGATAGG - Intergenic
964409669 3:156384697-156384719 CTTGTTTCATATATTCACACTGG + Intronic
966417882 3:179708084-179708106 CTTTAGTCATTTATACACACAGG + Intronic
969556153 4:7911712-7911734 CTTGTGTCACTATTCCACACGGG + Intronic
970429355 4:15974640-15974662 TTTTTTTCATTTATAAACACAGG + Intronic
970955524 4:21806237-21806259 ATTGTGTCATGTAGCATCACAGG + Intronic
972206700 4:36782006-36782028 CATGTGTTATTAATCAAAACTGG - Intergenic
973279707 4:48346451-48346473 ATTGGGACATTTATCAACAAAGG - Intronic
974306476 4:60148983-60149005 CTTGTTTCATTTAACAAAATGGG + Intergenic
976417355 4:84793138-84793160 GTTGTGTCATTTATCAACACAGG + Intronic
981180044 4:141730959-141730981 CCTGTGTCCTTTTTCACCACTGG - Intronic
981975123 4:150718281-150718303 CTTGTTTCATTTATTATCAGAGG - Intronic
983310968 4:166060862-166060884 TTTGTGTGATTGGTCAACACTGG + Intronic
985424955 4:189820763-189820785 CTTGTGTCACTAATCAGCAGAGG - Intergenic
988958566 5:36345875-36345897 CTTGTGTCATTGAAGAACATAGG - Intergenic
990203901 5:53408836-53408858 CTGTTGTCATTTAACAACATAGG - Intergenic
990622449 5:57575540-57575562 ATTGTCTCATTTATCAAGAGGGG - Intergenic
991295203 5:65073134-65073156 CTTCTGCCATTTCTCATCACCGG - Intergenic
992431914 5:76717971-76717993 CTTGGCTAGTTTATCAACACTGG + Intronic
992755252 5:79898810-79898832 CTTGTGTCATTCTTTAACCCTGG - Intergenic
996310519 5:122099057-122099079 CTTTTCTCATTTATAAACAGAGG - Intergenic
1000426814 5:161100840-161100862 CTTGTGTAATTTATCTTCACTGG - Intergenic
1000829995 5:166091118-166091140 CTTTTGTTATTTGTCAACAGTGG + Intergenic
1003458294 6:6305244-6305266 CTAGTGTCATATGTCAACAGTGG - Intronic
1005094565 6:22100264-22100286 CTCGTGTCATTCATCAAAATTGG - Intergenic
1007330576 6:41104033-41104055 ATCGTGTCATTTACCAAGACAGG + Intergenic
1010568338 6:77446253-77446275 TCTGTGTCATTTTTCAAGACTGG - Intergenic
1011366652 6:86589407-86589429 CTTGTGCCATTTTTCAACTAAGG - Intergenic
1011848651 6:91598773-91598795 CTTGTGATAATTATTAACACAGG + Intergenic
1012555325 6:100504834-100504856 CTTGTATCTTTTGTCAACAGAGG - Intergenic
1015552297 6:134424560-134424582 CTTGTTTTACTTATCAACATTGG - Intergenic
1016488487 6:144570012-144570034 GTTTTGTCAGTGATCAACACGGG - Intronic
1017275742 6:152565897-152565919 CTTGAGTCATTTAAGAAGACTGG - Intronic
1018178653 6:161201106-161201128 CTTGTCCCATTGATCAACTCAGG + Intronic
1018728990 6:166635215-166635237 CCAGTGTCATTCATCAACCCAGG + Intronic
1023699318 7:42876776-42876798 CTTGACTCATCTATCAACACTGG - Intergenic
1024638861 7:51313682-51313704 CTTCTGTCCTTTATTAACAGAGG + Intronic
1024901864 7:54327818-54327840 CTTGTGATATATATAAACACAGG + Intergenic
1028742345 7:94290083-94290105 CTTGACTCATCCATCAACACAGG - Intergenic
1028995347 7:97094333-97094355 CGTGTGCCATTTGTCAACCCTGG + Intergenic
1029871296 7:103695746-103695768 CTGCTGTCATTGTTCAACACTGG - Intronic
1030213147 7:107016224-107016246 CCTGTGTCATTCATCAAGACTGG - Intergenic
1030452235 7:109726559-109726581 CTAGTGCCATTTATAAATACTGG - Intergenic
1032666969 7:134046580-134046602 CTTGTGTTATCTATTAATACAGG + Intronic
1033322181 7:140349939-140349961 CTTATATCATATATCATCACTGG + Intronic
1033645467 7:143299556-143299578 CTTGTGCCATTTATATACAAGGG + Intronic
1033971901 7:147051517-147051539 CTTATTTCATTAATCAACATAGG - Intronic
1036571975 8:9987931-9987953 CTTGTGTCCTTCTTCAACTCTGG + Intergenic
1038201273 8:25415060-25415082 CTTGTCCCATTTATCATCCCAGG + Exonic
1043153876 8:76753267-76753289 CTTGTGTCATTTATCCATATAGG - Intronic
1044921239 8:97171685-97171707 CTTGTGTGCTTTGTCAACAGTGG + Intergenic
1046629824 8:116612357-116612379 ATTCTGTCATTTATGACCACAGG + Intergenic
1046711759 8:117518743-117518765 TTTATGTCATTTACCAAGACAGG - Intergenic
1047618948 8:126586869-126586891 CTTGTGTCATTTTTAATCAGTGG - Intergenic
1047917446 8:129597265-129597287 GTTGTGGCATGTATCAATACAGG + Intergenic
1048744273 8:137595919-137595941 CTGGTGTCATCTATCCACGCTGG + Intergenic
1050383851 9:5062710-5062732 CTTGTATCCTTTGCCAACACTGG + Intronic
1051551478 9:18334574-18334596 TTTGTTTGATTTTTCAACACTGG + Intergenic
1053184854 9:36007065-36007087 CTTGTGTCATTTATTTTCTCTGG + Intergenic
1056315987 9:85390363-85390385 CTTATTACATTTACCAACACTGG + Intergenic
1058601112 9:106671384-106671406 ATTGTGTCACTTATCTGCACAGG - Intergenic
1060578730 9:124723570-124723592 TTTGTGTCATTAAGAAACACAGG + Intronic
1060777613 9:126387311-126387333 CTTGTTTCATTTTTAATCACTGG + Intronic
1061736699 9:132665800-132665822 ATTCTCTCATTTATCAACACAGG + Intronic
1187203429 X:17158017-17158039 AATCTGACATTTATCAACACAGG - Intergenic
1190004955 X:46726791-46726813 CTTGTGTCCCTCATCCACACAGG + Intronic
1192385058 X:70659852-70659874 CATGTGTCACTTAACAACAGGGG + Intronic
1198541708 X:137646855-137646877 CTTATAGCATTTATCAAAACTGG + Intergenic
1199092532 X:143708608-143708630 CCTGTGTAATTTATAAACAAAGG + Intergenic
1201566909 Y:15374795-15374817 CTTGTGTCATTTCTGAACCCAGG - Intergenic