ID: 955750465

View in Genome Browser
Species Human (GRCh38)
Location 3:62181213-62181235
Sequence CAGGGTCCCACATCGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 120}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955750456_955750465 13 Left 955750456 3:62181177-62181199 CCTAGCACTTAGGAGAATCTGGG 0: 1
1: 0
2: 2
3: 11
4: 221
Right 955750465 3:62181213-62181235 CAGGGTCCCACATCGGAAGAAGG 0: 1
1: 0
2: 0
3: 6
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955750465 Original CRISPR CAGGGTCCCACATCGGAAGA AGG Intronic
900004235 1:34177-34199 CAGAGTCCCAGGTGGGAAGAAGG + Intergenic
900023963 1:204693-204715 CAGAGTCCCAGGTGGGAAGAAGG + Intergenic
900639930 1:3683856-3683878 CAGGGACCCCCAAAGGAAGATGG + Intronic
900951912 1:5862981-5863003 GAGGGTCCCACATGCGTAGATGG + Exonic
902742943 1:18452588-18452610 CAGGGTCCCAGATGGGTAGAAGG + Intergenic
905480175 1:38256362-38256384 CAGAGCCCCACATCTGAAGCAGG + Intergenic
911628092 1:100150016-100150038 CAAGGTCGCACAACTGAAGATGG - Exonic
912379090 1:109237212-109237234 CAGGGTCCCAGAGGGGAAGTCGG - Intronic
912624343 1:111195116-111195138 CAGGGTGCTACATAAGAAGATGG - Intronic
915308748 1:154996492-154996514 CAGGATCCCACATCAGTACACGG + Intergenic
917365771 1:174230645-174230667 CAGGTTCCCACAACGATAGAAGG - Intronic
917636625 1:176943361-176943383 CATGGTCCCCCATCATAAGATGG - Intronic
917711025 1:177685442-177685464 CAGGGTCCCACCTCTGTAGTGGG - Intergenic
918310789 1:183283862-183283884 CAGGGTCTCCTCTCGGAAGAGGG - Intronic
922120863 1:222666212-222666234 CAGGCTCCCAGAACTGAAGATGG + Exonic
922196312 1:223363522-223363544 CCGGGTCCCAGAGCGGAGGAGGG - Exonic
922578448 1:226679243-226679265 CAGGGAGCCACATCTGAAAAGGG - Intronic
1063636483 10:7787776-7787798 CAGGGGCCCTCCTGGGAAGACGG + Intronic
1064359399 10:14650044-14650066 CAATGTCCCAGATAGGAAGAAGG + Intronic
1065687408 10:28300365-28300387 CAGTGTCCCACAATGCAAGAGGG + Intronic
1072249601 10:93571226-93571248 CAGTGACCCACATCGGCAGGTGG + Intronic
1072619320 10:97069091-97069113 CAGCATCCCACTTAGGAAGATGG - Intronic
1074000030 10:109362611-109362633 GAGGGTCCCACATCCTAAGATGG + Intergenic
1075260191 10:120956765-120956787 CAAGGTCATACATCTGAAGAGGG - Intergenic
1077699838 11:4431341-4431363 CAGGGCCCCACTTCAGAAGCCGG + Intergenic
1078670823 11:13363767-13363789 CAGGGTCACTCTTGGGAAGATGG - Intronic
1083486174 11:62984276-62984298 CAGGGGCCAAGATGGGAAGATGG - Intronic
1085380591 11:76113991-76114013 CCAGGTTCCACAACGGAAGATGG - Intronic
1085476718 11:76793813-76793835 GAGGGTCCCACATGGGGAGGGGG + Intronic
1085745424 11:79110714-79110736 CAGGCTCCCACCTGGGAGGATGG + Intronic
1087716296 11:101612619-101612641 CAGGGTCACCCATCGGAAGTTGG - Intronic
1088597561 11:111451388-111451410 CAGCAACCGACATCGGAAGATGG + Exonic
1089370470 11:117952074-117952096 CAGGGTCCCACAGCCGCAAAGGG - Intergenic
1090274332 11:125409053-125409075 CACGGTTCCTCATCTGAAGACGG - Intronic
1090709595 11:129373477-129373499 CAGGGTCCCGCCGCGGAAGCAGG + Intergenic
1091103842 11:132899982-132900004 CAGGGTCCCCCATATGTAGACGG + Intronic
1091377659 12:36225-36247 CAGAGTCCCAGGTGGGAAGAAGG + Intergenic
1092515465 12:9207192-9207214 CAGAGTCCCAAATCGGGAAAGGG - Intronic
1092978015 12:13764477-13764499 CAAGGTCCCACAGGGGAGGATGG - Intronic
1094741507 12:33294869-33294891 CAGGGTATCACATGGCAAGAGGG - Intergenic
1097376533 12:58849747-58849769 CAGGATCCCACAGGGGAAGCTGG - Intergenic
1100207945 12:92371449-92371471 AAGGGGCCCAGATCTGAAGATGG + Intergenic
1105441818 13:20421552-20421574 CTGGCTCCCACAAGGGAAGAGGG + Intronic
1107029364 13:35834995-35835017 CAGGGCCCCACATCTCATGAGGG - Intronic
1111460002 13:88526675-88526697 CAGGTTCCCACAGTGGGAGAAGG - Intergenic
1116404232 14:44548849-44548871 CAAGGTCCCAGTTCAGAAGAGGG - Intergenic
1119408662 14:74414358-74414380 CTGGGTCCCACAATGGGAGAGGG + Intronic
1125515795 15:40320303-40320325 CAGGGGCCCACTAGGGAAGAAGG - Intergenic
1127846986 15:62878511-62878533 CAGGGTCCCAGGTTGGGAGAAGG + Intergenic
1129990243 15:79955611-79955633 CAGGGTATCACATGGCAAGAGGG + Intergenic
1132449269 15:101956767-101956789 CAGAGTCCCAGGTGGGAAGAAGG - Intergenic
1134688265 16:16173567-16173589 CTGGGTACCATATGGGAAGAAGG - Intronic
1136004498 16:27319367-27319389 CAGGGTCACACACCTGAAGGTGG + Intronic
1142017070 16:87755141-87755163 CAGACTCCCACGTGGGAAGAGGG + Intronic
1142355773 16:89601122-89601144 CAGGGTCACACAGCGGGAGCTGG - Intergenic
1142784262 17:2208150-2208172 AAGGGTCCCACATCAAAAGATGG + Intronic
1144737547 17:17563485-17563507 CAGGGTGCCCCTTAGGAAGAAGG + Intronic
1146030345 17:29360724-29360746 TAGGGACCCACATCTGATGAGGG - Intergenic
1147596888 17:41723417-41723439 CAGGGTCCCATTTCAGAGGATGG + Exonic
1148951869 17:51320409-51320431 CAGCGTCTCACATCTGAAAATGG - Intergenic
1150967165 17:69984553-69984575 CAGGGGCCCACATCTGGTGAGGG + Intergenic
1151172967 17:72263583-72263605 CAGGGTCTCACAAAGGAAGCAGG + Intergenic
1156295026 18:35781696-35781718 CAAGGTCCCACATCAGAAAGTGG - Intergenic
1158041061 18:53094275-53094297 CAGTGTCCCAACTGGGAAGAAGG + Intronic
1158654824 18:59321318-59321340 CAAGGTACTACATCGGATGATGG + Intergenic
1160635987 19:75786-75808 CAGAGTCCCAGGTGGGAAGAAGG + Intergenic
1161669091 19:5594691-5594713 CAAGGTCCAACATCAGAGGAGGG + Intronic
1163362995 19:16859800-16859822 CTGGGTCCCACCTGGGAAAAGGG + Intronic
1163786452 19:19277273-19277295 CAGGGTCCCACACAGGAAGGAGG + Intronic
1163804615 19:19387890-19387912 CAGTGTCTCCCATCGGGAGACGG - Intronic
1168335518 19:55595216-55595238 CAGGGGCACAGATCTGAAGAAGG + Intronic
930416950 2:51101046-51101068 CTGGGTTCCACATCTGAAGCAGG - Intergenic
930774552 2:55159304-55159326 CAGGGCCACACATGGGAAGCAGG - Intergenic
934165136 2:89287340-89287362 CAGGGTCCCAGATCAGAGCAGGG + Intergenic
934202137 2:89895122-89895144 CAGGGTCCCAGATCAGAGCAGGG - Intergenic
935647069 2:105346684-105346706 CAGAGTGCAACATAGGAAGATGG + Exonic
936565493 2:113579266-113579288 CAGAGTCCCAGGTGGGAAGAAGG - Intergenic
940051064 2:149465277-149465299 CAGGGTCAGACATGGGAAAAGGG + Intronic
945153955 2:206817687-206817709 CAGTGTTCCACCTCGGAACACGG + Intergenic
1171407051 20:24918418-24918440 CAAGGTCTCACAGCTGAAGAGGG + Intergenic
1176131665 20:63498998-63499020 GGGGGTCCCTCTTCGGAAGACGG + Intronic
1179322917 21:40310075-40310097 CTGGGTCCCACCTCCAAAGATGG + Intronic
1179974809 21:44858587-44858609 CAGGGTCCCGCAGGGGAACAGGG - Intronic
1181540372 22:23569821-23569843 CAGGATCCCACATCTCCAGATGG - Intergenic
952694440 3:36249351-36249373 CAGGGGCACACATCAGAAGGAGG + Intergenic
954783658 3:53077929-53077951 CTGGGTTCCACATCTGAAAAGGG - Intronic
954787222 3:53102690-53102712 CCGAGTCCCACATCTGGAGATGG + Intronic
955406956 3:58631588-58631610 CAGGATCCCACTTCGGGATAGGG + Intergenic
955750465 3:62181213-62181235 CAGGGTCCCACATCGGAAGAAGG + Intronic
974018706 4:56674068-56674090 CAGGGTTCCACAGCTGAAAAGGG - Intronic
983843636 4:172488362-172488384 CAGGGCCTCACCTGGGAAGATGG + Intronic
984769091 4:183422167-183422189 CAGGGGCCCACAGCGCAAGCAGG + Intergenic
985880499 5:2635597-2635619 CAGGTTCCCACATCTTCAGAAGG - Intergenic
990645172 5:57835495-57835517 CTGGGTCCCACAACAGAAAATGG + Intergenic
994117165 5:96073769-96073791 CAGGGTCGCACAGCAGAAGGTGG - Intergenic
996775878 5:127131779-127131801 CTGGATCCCACAACTGAAGATGG + Intergenic
998503690 5:142654949-142654971 CAGGCTCCCACATCCAAACAGGG + Intronic
998962616 5:147504764-147504786 AAGAGGCCCACATGGGAAGAAGG + Intronic
999014639 5:148088259-148088281 GAGGGATCCACATCAGAAGATGG - Intronic
1008852746 6:56043834-56043856 CAGGGTATCACATGGCAAGAGGG - Intergenic
1013066924 6:106693017-106693039 CAGGGGTCCACACCCGAAGAGGG + Intergenic
1023561447 7:41477563-41477585 CAGAGTCCCACATGTTAAGAAGG + Intergenic
1026828808 7:73599589-73599611 CAGGGTCCCACTGCTGAAGAGGG + Exonic
1028095155 7:86751284-86751306 CAGTGTGACACATCTGAAGAGGG - Intronic
1031022705 7:116645297-116645319 CAGGGTCCCAGTTCTAAAGAGGG - Intergenic
1033670610 7:143489104-143489126 CTGGGTCCCACATCGGGCAAAGG + Intergenic
1036614753 8:10379578-10379600 CAGGGTGCCAGAGGGGAAGAGGG - Intronic
1037053453 8:14406223-14406245 CTGAGCCCGACATCGGAAGATGG - Intronic
1037883280 8:22583177-22583199 CTGGGTTCCACTTTGGAAGAGGG + Intronic
1045602730 8:103736061-103736083 CAAGGTGCCACAAAGGAAGATGG - Intronic
1047803284 8:128332047-128332069 TAGGGTCACACATGGGCAGAGGG + Intergenic
1047973728 8:130109192-130109214 CGGGACCCCACATCTGAAGAGGG + Intronic
1049285496 8:141772883-141772905 CAGGTTCTCAAATCGGAAAAAGG + Intergenic
1049886932 9:33960-33982 CAGAGTCCCAGGTGGGAAGAAGG + Intergenic
1050933784 9:11366877-11366899 CAGGCTCCCACAGGGGCAGAGGG - Intergenic
1053121758 9:35552687-35552709 CTGGGTACCACATCTTAAGAAGG + Intronic
1056547495 9:87624899-87624921 CACCCTCCCACATCTGAAGATGG - Intronic
1057705451 9:97392114-97392136 CAGGGGCCCACATCCAAACAAGG - Intergenic
1060803736 9:126562103-126562125 CAGGGTCCCACAGCAGAGAAAGG + Intergenic
1061149240 9:128819512-128819534 CAGTGTCACACAGCAGAAGAAGG + Intronic
1061276523 9:129572057-129572079 CAGGATCCCACATCTCCAGATGG - Intergenic
1061712615 9:132498491-132498513 CAGGGTCACACAGCAGAAGCGGG - Intronic
1062235759 9:135506815-135506837 CAGAGGCCCACATCAGCAGAGGG - Intergenic
1062670923 9:137708938-137708960 CAGCGTTCCACATCAGAGGAAGG - Intronic
1186709172 X:12174568-12174590 AAGGGTCCCAGAGTGGAAGAAGG - Intronic
1189847283 X:45149232-45149254 CAGAGTCCCACGGAGGAAGAAGG - Exonic
1198144867 X:133844967-133844989 GAGGGTCCCAGTTCAGAAGACGG + Intronic