ID: 955751358

View in Genome Browser
Species Human (GRCh38)
Location 3:62188050-62188072
Sequence TGTTTTACTCAACAACTCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 176}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955751358_955751362 8 Left 955751358 3:62188050-62188072 CCCATGAGTTGTTGAGTAAAACA 0: 1
1: 0
2: 1
3: 11
4: 176
Right 955751362 3:62188081-62188103 AAAAATTCTAGGGCCAGTCATGG 0: 1
1: 0
2: 9
3: 103
4: 758
955751358_955751361 -2 Left 955751358 3:62188050-62188072 CCCATGAGTTGTTGAGTAAAACA 0: 1
1: 0
2: 1
3: 11
4: 176
Right 955751361 3:62188071-62188093 CACAACAACAAAAAATTCTAGGG 0: 1
1: 0
2: 8
3: 129
4: 1074
955751358_955751360 -3 Left 955751358 3:62188050-62188072 CCCATGAGTTGTTGAGTAAAACA 0: 1
1: 0
2: 1
3: 11
4: 176
Right 955751360 3:62188070-62188092 ACACAACAACAAAAAATTCTAGG 0: 1
1: 1
2: 13
3: 155
4: 1328
955751358_955751363 11 Left 955751358 3:62188050-62188072 CCCATGAGTTGTTGAGTAAAACA 0: 1
1: 0
2: 1
3: 11
4: 176
Right 955751363 3:62188084-62188106 AATTCTAGGGCCAGTCATGGTGG 0: 1
1: 1
2: 27
3: 218
4: 1441

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955751358 Original CRISPR TGTTTTACTCAACAACTCAT GGG (reversed) Intronic