ID: 955751360

View in Genome Browser
Species Human (GRCh38)
Location 3:62188070-62188092
Sequence ACACAACAACAAAAAATTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1498
Summary {0: 1, 1: 1, 2: 13, 3: 155, 4: 1328}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955751358_955751360 -3 Left 955751358 3:62188050-62188072 CCCATGAGTTGTTGAGTAAAACA 0: 1
1: 0
2: 1
3: 11
4: 176
Right 955751360 3:62188070-62188092 ACACAACAACAAAAAATTCTAGG 0: 1
1: 1
2: 13
3: 155
4: 1328
955751359_955751360 -4 Left 955751359 3:62188051-62188073 CCATGAGTTGTTGAGTAAAACAC 0: 1
1: 0
2: 0
3: 9
4: 134
Right 955751360 3:62188070-62188092 ACACAACAACAAAAAATTCTAGG 0: 1
1: 1
2: 13
3: 155
4: 1328

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955751360 Original CRISPR ACACAACAACAAAAAATTCT AGG Intronic