ID: 955751361

View in Genome Browser
Species Human (GRCh38)
Location 3:62188071-62188093
Sequence CACAACAACAAAAAATTCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1212
Summary {0: 1, 1: 0, 2: 8, 3: 129, 4: 1074}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955751358_955751361 -2 Left 955751358 3:62188050-62188072 CCCATGAGTTGTTGAGTAAAACA 0: 1
1: 0
2: 1
3: 11
4: 176
Right 955751361 3:62188071-62188093 CACAACAACAAAAAATTCTAGGG 0: 1
1: 0
2: 8
3: 129
4: 1074
955751359_955751361 -3 Left 955751359 3:62188051-62188073 CCATGAGTTGTTGAGTAAAACAC 0: 1
1: 0
2: 0
3: 9
4: 134
Right 955751361 3:62188071-62188093 CACAACAACAAAAAATTCTAGGG 0: 1
1: 0
2: 8
3: 129
4: 1074

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955751361 Original CRISPR CACAACAACAAAAAATTCTA GGG Intronic