ID: 955751362

View in Genome Browser
Species Human (GRCh38)
Location 3:62188081-62188103
Sequence AAAAATTCTAGGGCCAGTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 871
Summary {0: 1, 1: 0, 2: 9, 3: 103, 4: 758}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955751359_955751362 7 Left 955751359 3:62188051-62188073 CCATGAGTTGTTGAGTAAAACAC 0: 1
1: 0
2: 0
3: 9
4: 134
Right 955751362 3:62188081-62188103 AAAAATTCTAGGGCCAGTCATGG 0: 1
1: 0
2: 9
3: 103
4: 758
955751358_955751362 8 Left 955751358 3:62188050-62188072 CCCATGAGTTGTTGAGTAAAACA 0: 1
1: 0
2: 1
3: 11
4: 176
Right 955751362 3:62188081-62188103 AAAAATTCTAGGGCCAGTCATGG 0: 1
1: 0
2: 9
3: 103
4: 758

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955751362 Original CRISPR AAAAATTCTAGGGCCAGTCA TGG Intronic