ID: 955751362 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:62188081-62188103 |
| Sequence | AAAAATTCTAGGGCCAGTCA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 871 | |||
| Summary | {0: 1, 1: 0, 2: 9, 3: 103, 4: 758} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 955751359_955751362 | 7 | Left | 955751359 | 3:62188051-62188073 | CCATGAGTTGTTGAGTAAAACAC | 0: 1 1: 0 2: 0 3: 9 4: 134 |
||
| Right | 955751362 | 3:62188081-62188103 | AAAAATTCTAGGGCCAGTCATGG | 0: 1 1: 0 2: 9 3: 103 4: 758 |
||||
| 955751358_955751362 | 8 | Left | 955751358 | 3:62188050-62188072 | CCCATGAGTTGTTGAGTAAAACA | 0: 1 1: 0 2: 1 3: 11 4: 176 |
||
| Right | 955751362 | 3:62188081-62188103 | AAAAATTCTAGGGCCAGTCATGG | 0: 1 1: 0 2: 9 3: 103 4: 758 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 955751362 | Original CRISPR | AAAAATTCTAGGGCCAGTCA TGG | Intronic | ||