ID: 955751363

View in Genome Browser
Species Human (GRCh38)
Location 3:62188084-62188106
Sequence AATTCTAGGGCCAGTCATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1688
Summary {0: 1, 1: 1, 2: 27, 3: 218, 4: 1441}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955751358_955751363 11 Left 955751358 3:62188050-62188072 CCCATGAGTTGTTGAGTAAAACA 0: 1
1: 0
2: 1
3: 11
4: 176
Right 955751363 3:62188084-62188106 AATTCTAGGGCCAGTCATGGTGG 0: 1
1: 1
2: 27
3: 218
4: 1441
955751359_955751363 10 Left 955751359 3:62188051-62188073 CCATGAGTTGTTGAGTAAAACAC 0: 1
1: 0
2: 0
3: 9
4: 134
Right 955751363 3:62188084-62188106 AATTCTAGGGCCAGTCATGGTGG 0: 1
1: 1
2: 27
3: 218
4: 1441

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955751363 Original CRISPR AATTCTAGGGCCAGTCATGG TGG Intronic