ID: 955751887

View in Genome Browser
Species Human (GRCh38)
Location 3:62191757-62191779
Sequence CATGTTCACCAGACAGTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 136}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955751887_955751892 13 Left 955751887 3:62191757-62191779 CCTCACACTGTCTGGTGAACATG 0: 1
1: 0
2: 2
3: 10
4: 136
Right 955751892 3:62191793-62191815 CTGCGCTGCTCGAGAGTGCCGGG 0: 1
1: 0
2: 1
3: 2
4: 70
955751887_955751896 28 Left 955751887 3:62191757-62191779 CCTCACACTGTCTGGTGAACATG 0: 1
1: 0
2: 2
3: 10
4: 136
Right 955751896 3:62191808-62191830 GTGCCGGGGAGGACAGTGGATGG 0: 1
1: 0
2: 2
3: 26
4: 389
955751887_955751895 24 Left 955751887 3:62191757-62191779 CCTCACACTGTCTGGTGAACATG 0: 1
1: 0
2: 2
3: 10
4: 136
Right 955751895 3:62191804-62191826 GAGAGTGCCGGGGAGGACAGTGG 0: 1
1: 1
2: 0
3: 51
4: 536
955751887_955751894 17 Left 955751887 3:62191757-62191779 CCTCACACTGTCTGGTGAACATG 0: 1
1: 0
2: 2
3: 10
4: 136
Right 955751894 3:62191797-62191819 GCTGCTCGAGAGTGCCGGGGAGG 0: 1
1: 0
2: 0
3: 12
4: 107
955751887_955751893 14 Left 955751887 3:62191757-62191779 CCTCACACTGTCTGGTGAACATG 0: 1
1: 0
2: 2
3: 10
4: 136
Right 955751893 3:62191794-62191816 TGCGCTGCTCGAGAGTGCCGGGG 0: 1
1: 0
2: 0
3: 3
4: 36
955751887_955751891 12 Left 955751887 3:62191757-62191779 CCTCACACTGTCTGGTGAACATG 0: 1
1: 0
2: 2
3: 10
4: 136
Right 955751891 3:62191792-62191814 GCTGCGCTGCTCGAGAGTGCCGG 0: 1
1: 0
2: 0
3: 10
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955751887 Original CRISPR CATGTTCACCAGACAGTGTG AGG (reversed) Intronic
900962342 1:5933177-5933199 CTTGTAGACCAGACAGTGCGAGG + Exonic
902758014 1:18562106-18562128 CATGTCCCCCAGTCAGAGTGAGG + Intergenic
903557267 1:24202992-24203014 CATGTTCAACGGTGAGTGTGGGG - Intergenic
906145797 1:43559417-43559439 CATATGCATCAGGCAGTGTGTGG + Intronic
914447049 1:147758960-147758982 CATGTACACCAGAGAGGGCGTGG + Exonic
914975476 1:152356961-152356983 CAGGTTCAGGAGACAGTGGGAGG - Exonic
915322779 1:155064877-155064899 CCTGTTCTCCAGAGAGTCTGTGG - Intronic
917315045 1:173715346-173715368 CAGCTTCCCCAGACAGTGTTTGG + Intronic
917455533 1:175182676-175182698 CATATTCAGAAGCCAGTGTGTGG - Intronic
920069026 1:203289391-203289413 CATGTTCACCAGCCACCGTGAGG + Intergenic
920669437 1:207991784-207991806 CATGTTCACCTTGCAGAGTGGGG + Intergenic
1066686958 10:37990750-37990772 CCTCTTCAGAAGACAGTGTGGGG - Intergenic
1067767805 10:49100934-49100956 CCTCTTCAACAGACAGTGTAGGG + Intronic
1068094610 10:52474999-52475021 CATTTTCACATGACAGTATGAGG + Intergenic
1072624106 10:97099793-97099815 CATGGTAACCAGACACTGCGGGG - Intronic
1076714534 10:132356683-132356705 CATTTTCCCCAGACTGTATGAGG + Intronic
1092263449 12:6964153-6964175 CATCTTTACCAGACAGTGTTAGG - Intergenic
1092934435 12:13347481-13347503 TATGCTCACCAGGCAGTGGGAGG - Intergenic
1093289625 12:17303931-17303953 CATGGGCACCAGACAGCTTGTGG + Intergenic
1095845123 12:46736251-46736273 TATGGTCACCAGACTGTCTGAGG + Intergenic
1096122628 12:49097984-49098006 GGTCTTCACCAGACAGAGTGTGG + Exonic
1096282585 12:50269057-50269079 CATGTTACCCAGTAAGTGTGTGG - Intronic
1104605071 12:130182124-130182146 CATGTAAATCATACAGTGTGGGG + Intergenic
1106484369 13:30159344-30159366 CATCTCCAAAAGACAGTGTGGGG - Intergenic
1107011579 13:35675860-35675882 CATGCTCACCAGATGGTGGGAGG - Intergenic
1109941586 13:69374344-69374366 CAGCTTTACCAGACTGTGTGTGG + Intergenic
1110322711 13:74178136-74178158 TATGGTCATCAGCCAGTGTGGGG + Intergenic
1110922790 13:81110105-81110127 AATGTACAACAGACACTGTGAGG - Intergenic
1116632994 14:47357405-47357427 CAAATTCACTAGACAGTGTAGGG + Intronic
1117234060 14:53752786-53752808 CAAGTTCCCCAGACATTGGGTGG - Intergenic
1119310567 14:73642988-73643010 CCTGTTCACCAGAGAATGTGTGG - Intergenic
1121794575 14:96724423-96724445 CATGTTCACAAGTCACTGTGTGG + Intergenic
1122929696 14:104927631-104927653 CAGGGTCACCAGACAGGGCGGGG - Intronic
1127524374 15:59777617-59777639 AATGTTCACCAGGCTGTGTAGGG - Intergenic
1127905396 15:63372500-63372522 CATGTGTGCCAGACAGTGGGAGG + Intronic
1129990009 15:79953790-79953812 CATGTTCAAGAGACAATGAGAGG + Intergenic
1130301499 15:82682408-82682430 CATGATCACAATACAGTGTAAGG - Intronic
1131272048 15:90953460-90953482 CAGGATCTCCAGCCAGTGTGTGG - Exonic
1133913665 16:10088548-10088570 CATGTTCCCCAGACAGCCCGCGG - Intronic
1133988698 16:10688463-10688485 CATGTGCACCAGGCAGCGGGAGG + Intronic
1135945169 16:26858874-26858896 CACATTTCCCAGACAGTGTGAGG - Intergenic
1139067604 16:63337417-63337439 CATGTCCAACTGACAGTGTTTGG + Intergenic
1141041509 16:80676447-80676469 GTGGTTCACCAGATAGTGTGGGG + Intronic
1142809279 17:2387641-2387663 CATGTTCCCCACAGAGGGTGAGG - Exonic
1145108363 17:20139307-20139329 CATTTTCAGCAAACAGTGGGAGG - Intronic
1146107732 17:30056804-30056826 CATTTTCACCAGAAAATTTGAGG - Intronic
1146772039 17:35578053-35578075 CATGCTCACGAGAGAGTTTGTGG - Exonic
1147150656 17:38511721-38511743 CCTGTTCCCCAGACAGTTTTTGG + Exonic
1152466042 17:80466662-80466684 CAGCATCACCAGACGGTGTGGGG + Intergenic
1153467669 18:5407109-5407131 CATTTTCACCAGAGTGTTTGTGG - Intronic
1153496920 18:5708971-5708993 AATGTTATCCAGACAGTGTTCGG - Intergenic
1155521366 18:26672206-26672228 ACTGTTCAACAGAAAGTGTGTGG - Intergenic
1156306327 18:35881011-35881033 CATGTGCACTAGAAAGGGTGGGG + Intergenic
1156480826 18:37435323-37435345 CATGGACACCAGACAGGCTGGGG - Intronic
1156487168 18:37473756-37473778 CATCTCCACCAGGCTGTGTGAGG + Intronic
1160031311 18:75262695-75262717 CATGGCCACCAGAGACTGTGTGG - Intronic
1160476493 18:79194391-79194413 AATGTTCGCTAGACAATGTGTGG + Intronic
1161813452 19:6484309-6484331 CATGTCCATCAGACTGTGTGAGG - Intergenic
1166704294 19:44900257-44900279 CATGGTCACCAGCCAGCCTGTGG + Intronic
1167928660 19:52845364-52845386 AAAGTTCTCCAGACAGGGTGCGG + Intronic
926083009 2:10004028-10004050 CATCTTCCCCAGACAGCGTTAGG + Intergenic
929055309 2:37871621-37871643 CATGTTCAAAGGACAGTGTGTGG + Intergenic
931078982 2:58747669-58747691 CATGTTCACTAGACAGATTATGG + Intergenic
932422847 2:71611739-71611761 CATGTTCACAGGAAAGTGAGGGG - Intronic
932575863 2:72962029-72962051 CAGGCTCCCCAGACAGCGTGGGG + Intronic
934122376 2:88852915-88852937 CTTGTCCCACAGACAGTGTGAGG + Intergenic
936937779 2:117854621-117854643 GATTTTCACCAGCAAGTGTGGGG - Intergenic
937257812 2:120567221-120567243 CAAGGTCATCAGCCAGTGTGTGG + Intergenic
938447870 2:131391466-131391488 CATACTCACCAGACCCTGTGAGG + Intergenic
939906948 2:147928316-147928338 TCTTTTCACCAAACAGTGTGTGG + Exonic
943761997 2:191620142-191620164 TATATGCAACAGACAGTGTGTGG - Intergenic
943824912 2:192377287-192377309 CATCCTCACCAGACACTGAGAGG - Intergenic
946564212 2:220945152-220945174 CAGGGTCACCAGTCAGTTTGGGG - Intergenic
947341745 2:229147887-229147909 CATGTGCCCCATACACTGTGAGG - Intronic
948771632 2:240254231-240254253 CATCTGGAGCAGACAGTGTGGGG - Intergenic
1171235530 20:23521232-23521254 CATGTTCTCAAGACCGTCTGGGG - Intergenic
1171980268 20:31623121-31623143 CCTGTTAGCCAGACAGTGTGAGG + Intergenic
1172489208 20:35320997-35321019 CATGTTCTACAGTCATTGTGCGG + Intronic
1173667030 20:44770411-44770433 CATGTTCGCAGGACTGTGTGTGG + Intronic
1175174323 20:57101669-57101691 CATGTTCACAAGGTCGTGTGGGG + Intergenic
1175494514 20:59404356-59404378 CAAGTTCCCCAGACAGTGAGTGG - Intergenic
1176336116 21:5601616-5601638 CAGGTTCACGGGACAGTGCGCGG + Intergenic
1176391641 21:6219332-6219354 CAGGTTCACGGGACAGTGCGCGG - Intergenic
1176469778 21:7096842-7096864 CAGGTTCACGGGACAGTGCGCGG + Intergenic
1176493339 21:7478620-7478642 CAGGTTCACGGGACAGTGCGCGG + Intergenic
1176507303 21:7659763-7659785 CAGGTTCACGGGACAGTGCGCGG - Intergenic
1179999661 21:44989600-44989622 CATGCTCACCCGCCAGAGTGTGG - Intergenic
949892500 3:8743757-8743779 CATGTTGCTCAGACAGTGTTGGG - Intronic
951887600 3:27539392-27539414 CGTGTTCATGAGACAGTCTGGGG - Intergenic
954307353 3:49735737-49735759 CTTGTTCACCAAACTGAGTGAGG + Intronic
955751887 3:62191757-62191779 CATGTTCACCAGACAGTGTGAGG - Intronic
961053749 3:123768792-123768814 CATCTTCACCATACACTGTCTGG + Intronic
961053750 3:123768800-123768822 CCTGTTCACCAGACAGTGTATGG - Intronic
968529328 4:1082332-1082354 CATGTCCACCAGGCCCTGTGAGG - Intronic
970798815 4:19947676-19947698 CATCTTCACAAAACACTGTGAGG - Intergenic
970838607 4:20440336-20440358 CATTATCACCAGTCAGAGTGGGG + Intronic
970967292 4:21943345-21943367 GATTTTCACCAGGCAATGTGAGG + Intronic
971249164 4:24957953-24957975 CAAGTTCACCAGAGAGTATCTGG + Intronic
974472767 4:62339402-62339424 CATGTTCAGCAGACAGTGAGGGG - Intergenic
975516897 4:75257831-75257853 AATGTTGAACAGTCAGTGTGAGG - Intergenic
978807875 4:112819591-112819613 CATGTTCACAACACTGGGTGGGG - Intronic
985227450 4:187777953-187777975 CATGGACACCAGAGAGAGTGAGG + Intergenic
985788316 5:1911446-1911468 CATGTTCAGCAGTCAGTGTCTGG + Intergenic
994232025 5:97317592-97317614 CATGGTCACCAAAAAGTGTCTGG + Intergenic
998790097 5:145757148-145757170 CTTGTTTATCAGACATTGTGCGG - Intronic
1000475285 5:161699510-161699532 CAGGATCACCAGGCTGTGTGTGG - Intronic
1001131211 5:169065242-169065264 AATGTTCATCAGACAGTTGGAGG - Intronic
1001895492 5:175376297-175376319 AATGTTCACAATACAGTGTTAGG - Intergenic
1004144080 6:13048312-13048334 CATTTTCTCCAGACAGCATGAGG + Intronic
1005121459 6:22393674-22393696 CATGTGCCCCAAAGAGTGTGTGG - Intergenic
1006516170 6:34546938-34546960 CATGGGCACCAGGCAGGGTGGGG - Intronic
1007880827 6:45164673-45164695 CATGTATACCAGAAAGTCTGAGG + Intronic
1008139404 6:47814644-47814666 CATGTACACCAGACTGTCAGTGG + Intronic
1008263834 6:49399580-49399602 CAGGTTCCCCAGACACTCTGTGG - Intergenic
1010415592 6:75607885-75607907 CTAGTTCAACAGACAGTGTTAGG - Intronic
1011045342 6:83075752-83075774 CCTCTTCACCAGATAGTGTTGGG + Intronic
1013354938 6:109338202-109338224 CTTATTCACCAGTCAGTGTCTGG + Intergenic
1013961219 6:115902711-115902733 GATGTTTACCCTACAGTGTGTGG - Intergenic
1016349895 6:143155757-143155779 CCTCTTCACCAGACTATGTGTGG - Intronic
1022137152 7:27459270-27459292 CAGGAACCCCAGACAGTGTGTGG - Intergenic
1031654930 7:124343149-124343171 CCTCTTCACCACACACTGTGGGG + Intergenic
1034789724 7:153957318-153957340 CAAATTCAGCAGACAGTCTGTGG - Intronic
1034918054 7:155057105-155057127 CATGTCTACCAGTCAGAGTGGGG + Intergenic
1036103322 8:5811836-5811858 CATATTCAGCAGACAGTGCAAGG + Intergenic
1037329596 8:17731290-17731312 CCTGCTCACTAGGCAGTGTGAGG - Intronic
1037837164 8:22221150-22221172 CATGTCCACCAGGCTGGGTGTGG + Exonic
1039702397 8:39975469-39975491 AATGTTCAACAGACATTTTGTGG + Intronic
1042509351 8:69594958-69594980 CATGTCCACCAGGCACTGGGAGG - Intronic
1043690884 8:83150089-83150111 CATGAACACCAGAGAGTGAGTGG - Intergenic
1045209864 8:100085857-100085879 CATGTTCTGCAGAGAGAGTGAGG - Intronic
1046133806 8:110000197-110000219 AATGTTCATCAGAAAGTGAGTGG - Intergenic
1048089234 8:131220716-131220738 CATGTTTTCCAGAAATTGTGTGG + Intergenic
1048157665 8:131975294-131975316 CTTCTTTACCAGACAATGTGTGG + Intronic
1048427997 8:134340493-134340515 CATGTTTCACATACAGTGTGGGG + Intergenic
1051689372 9:19693715-19693737 CATGTACAGAAGACAGTGTTGGG + Intronic
1052459624 9:28745937-28745959 TATGTTCAACAGAGAATGTGTGG - Intergenic
1054710316 9:68504485-68504507 CATGTTCACCAAACAGCGGTTGG - Intronic
1055742229 9:79402579-79402601 TATATTCACCACACAGTTTGAGG + Intergenic
1056129401 9:83568618-83568640 AATGGTCACCAGACGCTGTGGGG + Intergenic
1056793091 9:89638870-89638892 CATATTCACCCAATAGTGTGGGG + Intergenic
1057682341 9:97200718-97200740 GGTGTTCACAAGACAGTGTGTGG - Intergenic
1059530886 9:115034399-115034421 CATGATCAACAGACATTGGGTGG + Intronic
1059727505 9:117023898-117023920 CATGTTCCAAACACAGTGTGAGG - Intronic
1190413096 X:50156329-50156351 CGTGGTCACCAGACAGTGGTGGG + Intergenic
1192200368 X:69062721-69062743 CCTGTTCACCACACAGGCTGGGG - Intergenic
1193915558 X:87357962-87357984 CATATTCATCAGAAAGTGAGTGG + Intergenic
1194161116 X:90453824-90453846 CATGTGCACTAGAAAGGGTGGGG - Intergenic
1200507405 Y:4030754-4030776 CATGTGCACTAGAAAGGGTGGGG - Intergenic
1200957941 Y:8970368-8970390 CCTGTGCACCAGAGAGTGTCTGG - Intergenic