ID: 955753921

View in Genome Browser
Species Human (GRCh38)
Location 3:62208945-62208967
Sequence GCCATGGGCCGTGTGGCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 166}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955753921_955753931 19 Left 955753921 3:62208945-62208967 CCCAGAGCCACACGGCCCATGGC 0: 1
1: 0
2: 2
3: 12
4: 166
Right 955753931 3:62208987-62209009 GGCTCTGACTCTATAGTCCAGGG 0: 1
1: 0
2: 1
3: 9
4: 171
955753921_955753932 20 Left 955753921 3:62208945-62208967 CCCAGAGCCACACGGCCCATGGC 0: 1
1: 0
2: 2
3: 12
4: 166
Right 955753932 3:62208988-62209010 GCTCTGACTCTATAGTCCAGGGG 0: 1
1: 0
2: 0
3: 7
4: 96
955753921_955753930 18 Left 955753921 3:62208945-62208967 CCCAGAGCCACACGGCCCATGGC 0: 1
1: 0
2: 2
3: 12
4: 166
Right 955753930 3:62208986-62209008 GGGCTCTGACTCTATAGTCCAGG 0: 1
1: 0
2: 1
3: 40
4: 841
955753921_955753933 21 Left 955753921 3:62208945-62208967 CCCAGAGCCACACGGCCCATGGC 0: 1
1: 0
2: 2
3: 12
4: 166
Right 955753933 3:62208989-62209011 CTCTGACTCTATAGTCCAGGGGG 0: 1
1: 0
2: 0
3: 9
4: 191
955753921_955753927 -2 Left 955753921 3:62208945-62208967 CCCAGAGCCACACGGCCCATGGC 0: 1
1: 0
2: 2
3: 12
4: 166
Right 955753927 3:62208966-62208988 GCAAGACAGAGCCCAAATATGGG 0: 1
1: 0
2: 0
3: 11
4: 125
955753921_955753926 -3 Left 955753921 3:62208945-62208967 CCCAGAGCCACACGGCCCATGGC 0: 1
1: 0
2: 2
3: 12
4: 166
Right 955753926 3:62208965-62208987 GGCAAGACAGAGCCCAAATATGG 0: 1
1: 0
2: 0
3: 18
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955753921 Original CRISPR GCCATGGGCCGTGTGGCTCT GGG (reversed) Intronic
900646993 1:3713467-3713489 ACCTTGGGCCGTGTGGGACTCGG + Intronic
900684408 1:3938954-3938976 GCCCTGGTCAGTGGGGCTCTTGG + Intergenic
900783429 1:4632510-4632532 GCCATGGGTCATGGGGCTGTGGG - Intergenic
901237236 1:7673630-7673652 GCCTTGAGCCTTGTGGCTCCTGG - Intronic
903305106 1:22407818-22407840 CCCTTGGGCCATATGGCTCTGGG + Intergenic
903779145 1:25810544-25810566 CCCATTGGCTGTGTGGCTGTGGG + Intronic
906259908 1:44379001-44379023 GCCATGGGTCGGGTGGGTCTTGG + Intergenic
906700187 1:47852141-47852163 GCCATGGGCCCTGGGGGACTAGG + Intronic
906954190 1:50358893-50358915 CCCCTGCCCCGTGTGGCTCTCGG - Intergenic
907769463 1:57445988-57446010 GGAATGGGCAGTGTAGCTCTGGG + Intronic
915073666 1:153292423-153292445 GCCAGGGGCAGGGTGGCTCTGGG - Intergenic
919769291 1:201147023-201147045 GGCATGGGCTGTGAGGCTGTGGG - Intronic
920171678 1:204075691-204075713 GCCACTGGCGGTGTGACTCTGGG + Intronic
920496902 1:206461310-206461332 GGCTTGGGCCGTGTGGCTGGTGG - Exonic
1064178347 10:13094950-13094972 GCCATGGTCCCTGGGACTCTGGG + Intronic
1064310533 10:14208481-14208503 GCTTTGGGCAGTCTGGCTCTTGG - Intronic
1064324967 10:14340997-14341019 GTCATGGGGCGTGTGGGGCTGGG - Intronic
1067523771 10:47026568-47026590 GCCCTGGGCCCTTGGGCTCTGGG + Intergenic
1067711968 10:48656809-48656831 GCCATGCTGCGTGTGGCTCTGGG - Intergenic
1074145819 10:110716326-110716348 GCCAGGTGCCCTGAGGCTCTGGG - Intronic
1076381819 10:130028678-130028700 GCCCTGGGCAGAGTGGGTCTTGG + Intergenic
1076731413 10:132440856-132440878 GCCATGGACAGTGGGGCTCAGGG - Intergenic
1076735886 10:132458746-132458768 CCCATGGGGCGTGGGGCTCAGGG - Intergenic
1077096017 11:799480-799502 GCCAGGGGCTGTGGGGCTCCTGG - Exonic
1077143026 11:1033195-1033217 TCCATGGCCCGTGGGGCTCGAGG + Intronic
1077271217 11:1682683-1682705 GACATGGGCAGTGAGTCTCTGGG + Intergenic
1083602441 11:63957350-63957372 ACCATGGGCAGCGTGGATCTGGG + Intergenic
1083745836 11:64736019-64736041 GCCCTGGGCTCTGTGGCTGTGGG - Intronic
1083997187 11:66278345-66278367 GGCATGGCCCGTGGGGCTCGGGG - Exonic
1084738361 11:71120837-71120859 GCCATGGGCTCTGTGGATGTTGG - Intronic
1084850753 11:71937994-71938016 GCCATGGGGCTTTTGGCCCTGGG + Intronic
1089254443 11:117186878-117186900 GCCTTGGGCAGTGTGGCCCACGG + Intronic
1089729918 11:120512964-120512986 ACCTTGGGCTGCGTGGCTCTTGG + Intronic
1095991064 12:48034912-48034934 ACCATGTGCAGGGTGGCTCTTGG - Intergenic
1101267108 12:103100551-103100573 GCCATTGTCCGGGTGGTTCTGGG - Intergenic
1102086729 12:110147740-110147762 GCCATGAGCCCTGTAGCTCAGGG - Intronic
1105459143 13:20567277-20567299 GCCAGGGGCCCTGAGGCACTAGG - Intronic
1105532718 13:21234757-21234779 GGCATGGGGCGTGTGTCACTGGG - Intergenic
1105826240 13:24125983-24126005 GGCTTGGGCCCTGTGGTTCTTGG + Intronic
1111415765 13:87941829-87941851 GCCATGGGCAGTGAGGCTAAAGG + Intergenic
1113279095 13:108769208-108769230 GCCCTTGGACGAGTGGCTCTAGG + Intronic
1113674654 13:112198890-112198912 GCCATGGGGCGGCTGGGTCTGGG - Intergenic
1113874238 13:113584744-113584766 GCCCTGGGCCGAGTGGCGCCGGG - Exonic
1114460052 14:22880664-22880686 GCCTTGGGCTGTGTGGCTGGGGG - Exonic
1114514098 14:23286226-23286248 GCCATTGGCTGCGTGGGTCTCGG + Intronic
1115642275 14:35342232-35342254 GCCAGGGGCCGTGTGGCGAATGG - Intergenic
1116437939 14:44914737-44914759 GTCATGGGCTGTGTAGCTTTGGG + Intergenic
1120423099 14:84313566-84313588 GCCATTGGACGTGGGGCTCCAGG + Intergenic
1123106019 14:105841405-105841427 GCCATGGGCGGTGCCACTCTTGG + Intergenic
1126403759 15:48301746-48301768 GCCATGGGCACAGTGGCTCAGGG - Intronic
1127763515 15:62164248-62164270 GCCAAGGGCACCGTGGCTCTGGG - Exonic
1128324814 15:66717434-66717456 GCCATGGGCTGTTTGTCTCCAGG + Intronic
1132104123 15:99050597-99050619 CCCATGCCCTGTGTGGCTCTGGG + Intergenic
1132882801 16:2169926-2169948 GCCTTGGGCAGTGTGGCTCTTGG + Intronic
1134856984 16:17528152-17528174 GCCGTGGGCCATGTGGGCCTTGG - Intergenic
1137568452 16:49549185-49549207 TCCTGGGGCCGTGGGGCTCTTGG + Intronic
1138093389 16:54194338-54194360 GCCATGGCCCGTGTGGCCCGGGG - Intergenic
1138531275 16:57635647-57635669 TCCCTGGGCCGTGAGGCTTTGGG + Intronic
1139531435 16:67544533-67544555 GCCAAGGGCCCTGGGGCACTGGG - Intronic
1140255168 16:73329507-73329529 GCAAGGGGCCGTGTTCCTCTTGG - Intergenic
1142400478 16:89855853-89855875 GCCCGGGGCTGTGTGGCCCTGGG + Intronic
1142696136 17:1634942-1634964 GCCATAGGCCCTGTGGCCCCAGG + Exonic
1146467477 17:33097546-33097568 GCCACGTGCCATGTGGCCCTTGG - Intronic
1146906387 17:36620986-36621008 GCCATTGGCTGAGTGGCTTTGGG + Intergenic
1147740727 17:42669841-42669863 TCCGTGGGACCTGTGGCTCTGGG + Intronic
1147948875 17:44095946-44095968 ACAATGGGCCGAGTGGCTCAGGG + Intronic
1151817817 17:76479797-76479819 GCCATCGGCTGCGTGGCTCCTGG + Exonic
1151975057 17:77479929-77479951 GCCATGGACCATGTGGCTTTGGG - Intronic
1152575868 17:81140753-81140775 GCCGTGAGCCGTGGGGCTGTGGG + Intronic
1152575897 17:81140839-81140861 GCCGTGAGCCGTGGGGCTGTGGG + Intronic
1154391680 18:13941944-13941966 TCCATGGGCCCTTTGGCTCTAGG - Intergenic
1156499383 18:37547486-37547508 GCCTGGGGCTGGGTGGCTCTTGG + Intronic
1156888690 18:42165260-42165282 GCCATGGGGCCTGTGGTTCATGG + Intergenic
1157426359 18:47587715-47587737 GCCCTGGGCTGTGTGACTTTGGG - Intergenic
1158338955 18:56444952-56444974 TCCATGGGCCATGTGACTTTAGG - Intergenic
1161162454 19:2768804-2768826 GCCGGGGGCTGTGTGGCCCTGGG + Intronic
1161223944 19:3133634-3133656 GCCAATGGCTGTGTGGCCCTGGG + Intergenic
1161261595 19:3340785-3340807 CCCATGGGCCCTGGGGCTCCAGG - Intergenic
1161513573 19:4684591-4684613 GCCCTGGGCCGTGTGGGTGCAGG - Intronic
1161744724 19:6048913-6048935 GGCACTGGCCGTGGGGCTCTGGG - Intronic
1161744740 19:6048989-6049011 GCCAATCACCGTGTGGCTCTGGG - Intronic
1161854413 19:6755040-6755062 ACCATGGGGCCTCTGGCTCTGGG + Exonic
1162511798 19:11123467-11123489 CACTTGGGCCGTGTGTCTCTGGG + Intronic
1163559258 19:18009277-18009299 CCCATTTGCCGTGTGACTCTGGG + Intronic
1163832560 19:19554119-19554141 GGGCTGGGCCGTGTGGCCCTAGG - Intergenic
1164576742 19:29409531-29409553 GTCAGAGACCGTGTGGCTCTTGG - Intergenic
1166213173 19:41320226-41320248 GCCTTGCGCTGGGTGGCTCTGGG - Intronic
1167043991 19:47039440-47039462 GCCCTGGGCCTTGTGGCCCTCGG + Exonic
926297234 2:11577700-11577722 GCCTTAGGCTGGGTGGCTCTGGG + Intronic
926840010 2:17070016-17070038 GCCAGGGGCTGTCTGGCCCTTGG - Intergenic
928028492 2:27758983-27759005 GCCAGGCACCGTGTGGCTCATGG + Intergenic
928106245 2:28472303-28472325 CACATGGGCCCTGTGGCTTTGGG + Intronic
929906877 2:46054260-46054282 GAGATGGGCAGTGTGGCTATGGG + Intronic
931757947 2:65390568-65390590 GTCAAGGGCTGTGTGGCTATGGG + Intronic
932072505 2:68635328-68635350 GTCATGGGCAGTGGGACTCTGGG - Intergenic
932468947 2:71941480-71941502 CCAATAGGCTGTGTGGCTCTGGG - Intergenic
933992994 2:87647067-87647089 TCCAGGGACCCTGTGGCTCTGGG - Intergenic
936300862 2:111303812-111303834 TCCAGGGACCCTGTGGCTCTGGG + Intergenic
937080198 2:119135186-119135208 GGCATCGGCCGTGTTCCTCTGGG + Intergenic
937206710 2:120241234-120241256 ACCTTGGGCCTTGTGGCTCTTGG - Intronic
937884354 2:126889850-126889872 TCCATGGGCTGTGTGGATCCTGG - Intergenic
938069606 2:128301347-128301369 CCCAGGGGCCATGTGGCTCCAGG + Intronic
946431664 2:219629730-219629752 GCTCTGGACCCTGTGGCTCTGGG - Intronic
947238696 2:227971031-227971053 GCCATGACCCATGTGGCCCTTGG + Intergenic
947476069 2:230448765-230448787 GCCCTGGGCAGGGTAGCTCTGGG + Intronic
947489595 2:230582129-230582151 GCCCTGGGCAGGGTAGCTCTGGG - Intergenic
948678386 2:239612362-239612384 GCCATGGCCAGCGTGGCCCTGGG - Intergenic
948887789 2:240892722-240892744 GACAGGGGCCATGGGGCTCTCGG - Intronic
1170843852 20:19945871-19945893 GCCAAAGGCCAGGTGGCTCTTGG + Intronic
1171179923 20:23084769-23084791 ACCATGGGGCCTGTGTCTCTGGG - Exonic
1176302710 21:5106181-5106203 GCCATGTGGCGTGTGGCTTGTGG - Intergenic
1182835024 22:33334835-33334857 GCCAGGAGCCGTGTAGCTCACGG - Intronic
1183069755 22:35387791-35387813 GCCATGGGGCCTGGGGCTCGGGG + Intronic
1184216001 22:43067649-43067671 AGCATGGGCTGTGTGGCTCATGG + Intronic
1184245093 22:43231720-43231742 GCCATGCCCCGGGTGGCTCTCGG - Intronic
1184920809 22:47604537-47604559 GCCATGGGCTGTCTGCCTCAAGG - Intergenic
1185031966 22:48448903-48448925 GCCAAGGGAGGTGTGGCTGTCGG - Intergenic
1185086651 22:48744469-48744491 GCCATGACCCGTGTGGTTCGTGG + Intronic
1185296913 22:50058899-50058921 GACAGGGGCCGTGTGGACCTGGG - Intergenic
949828482 3:8187691-8187713 GCCATGGACCCTGAGGCTTTGGG - Intergenic
950143018 3:10628166-10628188 GCCATGGGCCCTGAGGCCCTGGG - Intronic
952450364 3:33426594-33426616 GCCAGGGGCTGAGTGGGTCTGGG - Intronic
955363540 3:58293049-58293071 CCCATGGTCCGTGTGGCTGTAGG + Intronic
955409999 3:58649228-58649250 GCCCTGGGCCTTGTTGCCCTAGG + Intronic
955633563 3:61000873-61000895 GCGATGGGCAGTGAGGCCCTAGG + Intronic
955753921 3:62208945-62208967 GCCATGGGCCGTGTGGCTCTGGG - Intronic
966769711 3:183492819-183492841 CCCATGGGCCTTGTGACTATAGG - Intronic
970344560 4:15141007-15141029 GACATGAGCCGTGTGGCTCTGGG - Intergenic
970692003 4:18630817-18630839 GCCCTGGGCCGTGAGGGGCTTGG - Intergenic
971153926 4:24062626-24062648 ACCATGGGCTGTGTGGCACCAGG - Intergenic
973768778 4:54187914-54187936 GCCATGGGTAGGGTGGCCCTGGG + Intronic
979360028 4:119750975-119750997 GTCATCAGCCATGTGGCTCTGGG + Intergenic
980093210 4:128463477-128463499 CCCATTGGCTGTGTGGCTTTGGG + Intergenic
986140492 5:5025618-5025640 TCCATGCCCTGTGTGGCTCTCGG - Intergenic
991135276 5:63175827-63175849 GCAATGGGCAGTGAGGCTTTTGG + Intergenic
991447413 5:66715029-66715051 TCCATGGGCCCAGTGCCTCTTGG - Intronic
995224933 5:109690669-109690691 GCCAGGGGCTCTGTAGCTCTCGG + Intronic
998467486 5:142357245-142357267 GCCACGGGCCGAGCGGCTCCTGG + Intergenic
999143591 5:149378562-149378584 GGCATGGGCCATGGGGCTGTGGG - Intronic
999320753 5:150613678-150613700 GCCATGGGCAGTGGGGCCTTTGG + Intronic
1000656473 5:163885269-163885291 GCCATCTGCCGAATGGCTCTTGG + Intergenic
1001988215 5:176094034-176094056 GCCATGGTCCGTGTGTCTGGCGG + Intronic
1002100188 5:176853760-176853782 GGCATGGGCCCTGGGACTCTGGG + Intronic
1002174302 5:177392893-177392915 GCCAGGTGCAGTGTGGCTCATGG - Intronic
1002228653 5:177744106-177744128 GCCATGGTCCGTGTGTCTGGCGG - Intronic
1002266694 5:178039677-178039699 GCCATGGTCCGTGTGTCTGGTGG + Intronic
1002847585 6:961688-961710 GCCACGGTCCATGTGGCTCCTGG - Intergenic
1003068156 6:2920745-2920767 GCAATGGGTCTTGTTGCTCTGGG - Intergenic
1003298850 6:4858521-4858543 GGCTGGGGCTGTGTGGCTCTGGG - Intronic
1007958511 6:45938252-45938274 GTCAGGGGCTGTGGGGCTCTGGG + Intronic
1013844123 6:114428518-114428540 GCCATGTGCCTAGAGGCTCTTGG - Intergenic
1014245951 6:119068645-119068667 TCACTGGGCCGTTTGGCTCTGGG + Intronic
1017059524 6:150469189-150469211 GCTTTAGGCCGTGTGGCTCTAGG - Intergenic
1017818439 6:158031562-158031584 ACCACGGGCAGTGTGGTTCTGGG + Intronic
1020005970 7:4783956-4783978 CCCCTGACCCGTGTGGCTCTGGG + Intronic
1021367618 7:19800243-19800265 GCCAAGGACTGTGTGTCTCTGGG + Intergenic
1022046490 7:26626347-26626369 GCCTTGGGTTGTGAGGCTCTGGG + Intergenic
1034383735 7:150720766-150720788 GCCATGGGGCGCCTGGCTGTCGG + Exonic
1034827828 7:154282576-154282598 GCCATGGGCAGGGAGGCCCTGGG - Intronic
1037980734 8:23251516-23251538 GCCATGGGCCCTGGGACCCTGGG + Intronic
1039322867 8:36452247-36452269 GCCATGGGCAGTCTGGGTTTGGG - Intergenic
1040666428 8:49639523-49639545 GCCATGCGTCATGTGCCTCTAGG + Intergenic
1046267249 8:111846724-111846746 GCCCAGGGCAGTGGGGCTCTGGG + Intergenic
1047115933 8:121842114-121842136 GCCCAGGGCCTTGTGGCTTTGGG + Intergenic
1047200419 8:122760535-122760557 GCCTTGGGACGTGTGCCCCTTGG - Intergenic
1048801528 8:138198428-138198450 GCCATGGGACAGGTGGCTGTGGG + Intronic
1049844165 8:144792110-144792132 GCCATGGGCCGTGTGATCCGTGG - Exonic
1056808397 9:89745805-89745827 CCAATGGGCTGTGTGGCCCTGGG + Intergenic
1058707345 9:107648308-107648330 GCCATGGGCCGTGGGTCTGGAGG - Intergenic
1061274424 9:129561341-129561363 GCCAGGGGCAGTGTGGAGCTAGG + Intergenic
1061723836 9:132570605-132570627 GCCATGGGCCCTTTTCCTCTGGG - Intronic
1061877859 9:133553916-133553938 GGCCTGGGCAGTGGGGCTCTGGG + Intronic
1061980498 9:134100516-134100538 GCCAAGGGCCCCCTGGCTCTGGG - Intergenic
1062031270 9:134363141-134363163 GCCATGTGCCCTGTGCCTGTTGG + Intronic
1062044233 9:134417768-134417790 GCCAGCAGCCGTGTGGCCCTGGG + Intronic
1186985108 X:15004152-15004174 GGCATGGTCCATGAGGCTCTTGG + Intergenic
1190311016 X:49117110-49117132 GCCATGGTTCGTCTGGCTGTGGG - Exonic
1192358098 X:70422339-70422361 CCCATGGGCCTTGTGGATCCTGG - Intergenic
1195965394 X:110425438-110425460 GCCTAGGGCAGTGGGGCTCTGGG + Intronic
1196859525 X:120014614-120014636 GCCTTGGGCCTTGTGGCCTTGGG + Intergenic
1199969598 X:152849723-152849745 GGGCTGGGCTGTGTGGCTCTGGG - Intronic