ID: 955753939

View in Genome Browser
Species Human (GRCh38)
Location 3:62209019-62209041
Sequence GCGCCAAAGCCAGCATCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 98}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955753939 Original CRISPR GCGCCAAAGCCAGCATCACA TGG (reversed) Intronic
900634009 1:3652900-3652922 GCGCCAAAGACAGCCCCGCAGGG + Intronic
900946044 1:5831987-5832009 GCCCCAAAGTAAGCACCACAAGG + Intergenic
901139192 1:7017211-7017233 CCATCAGAGCCAGCATCACAAGG - Intronic
902618041 1:17634620-17634642 GCCCCATATCCAGAATCACATGG - Intronic
903813201 1:26046165-26046187 GCGCCGACGGCAGCTTCACACGG - Intergenic
907514723 1:54986344-54986366 CCGTCAAGGCCAGCATCCCAGGG + Exonic
915808375 1:158878914-158878936 TTGCCAAAACCAGCATCACCTGG - Intergenic
916637681 1:166691306-166691328 GCTCCAAAGCCAGACTGACATGG + Intergenic
919678252 1:200409017-200409039 AGGCCAAAGCCAGAATCTCAGGG - Exonic
920540941 1:206777543-206777565 GCTCCAGAGCCACCCTCACAAGG - Intergenic
922488925 1:225999658-225999680 GGGCCAAAGCCTACAGCACAAGG - Intergenic
924096452 1:240556343-240556365 GCTCCAAAGCCAGTATCATTAGG - Intronic
1063951190 10:11224905-11224927 GAGCCAAGGCCAGGATCAGAGGG + Intronic
1064112664 10:12552143-12552165 GCCCCAGAGCCAGCACCCCAGGG - Intronic
1065916812 10:30359827-30359849 TGGCCAGAGCCAGCTTCACAGGG - Intronic
1070753245 10:78976177-78976199 GCGGCAAAGCCTCCATCACAAGG - Intergenic
1075397638 10:122139445-122139467 GCCCCAAAGCCAAAATCAGAAGG - Intronic
1076854069 10:133106633-133106655 GCGGGGAAGCCAGCATCTCATGG - Intronic
1078088095 11:8246851-8246873 GCCCCATGGCCAGCCTCACAGGG + Intronic
1080913288 11:36627436-36627458 GAGCCAAACCCAGGATCACAAGG - Intronic
1091238066 11:134034757-134034779 GGGCCAATGCCAGCATCAGAGGG - Intergenic
1094842510 12:34348009-34348031 GGCCCAAACCCAGGATCACAGGG + Intergenic
1095655081 12:44659861-44659883 GGACCAAAGCCAGCATCAGAAGG + Intronic
1096840775 12:54378353-54378375 GTGTCCAAGCCAGCATCCCAGGG - Intronic
1098257449 12:68631627-68631649 GCACAAAAGGCAGCATAACATGG - Intronic
1099960477 12:89392274-89392296 GCTCCAAAGCCATCATTTCAAGG + Intergenic
1102039983 12:109794460-109794482 GCTCCACAGCCAGCATCTCGTGG + Exonic
1102608371 12:114088706-114088728 GAGACAATGCCAGCTTCACATGG + Intergenic
1103870618 12:124088683-124088705 GGACCAAAGCCAGCATCAGCAGG + Intronic
1104274339 12:127310971-127310993 GTGGGAACGCCAGCATCACATGG + Intergenic
1105454652 13:20528897-20528919 GATCAAAAGCCAGCCTCACAAGG + Intergenic
1106568682 13:30907542-30907564 GCACCAAAGCCTGCTTCAGATGG - Intronic
1112234475 13:97623331-97623353 GGAGCAGAGCCAGCATCACATGG + Intergenic
1122723749 14:103736817-103736839 GGGCCAAAGAGGGCATCACATGG + Intronic
1127880348 15:63151821-63151843 GCTCCAAACCCAGCTTCACAAGG - Exonic
1131549642 15:93346201-93346223 GCTCTAAAGCCAGCAACACAGGG + Intergenic
1132803890 16:1766916-1766938 CCGCCAGAGCCACCAGCACACGG - Exonic
1137435197 16:48448962-48448984 GCGCCTCAGGCAGCATCAGAGGG - Intergenic
1138521683 16:57574887-57574909 GCGCCCAGGCCAGCACCACCAGG - Exonic
1140580316 16:76223698-76223720 CCGCCAAAGACAGCTTTACAAGG - Intergenic
1141516452 16:84548251-84548273 GCTCTAAAGACAGCAGCACACGG + Intronic
1141824352 16:86468552-86468574 CCGCTCAAGCCAGGATCACAAGG + Intergenic
1142392461 16:89810934-89810956 GCTCCACAGTCAGCAGCACAGGG + Exonic
1152605029 17:81285312-81285334 GCGCCACAGCCTGCACCAGAGGG + Intronic
1153142523 18:1990010-1990032 GGGCCAAAGATGGCATCACAAGG + Intergenic
1162018822 19:7859559-7859581 GCCACAACGCCAGCATCATACGG - Intronic
925080612 2:1061239-1061261 GCGTCCAACCCAGGATCACACGG - Intronic
937069864 2:119054830-119054852 GGGCAAAAGCAAGGATCACAAGG + Intergenic
937239775 2:120452481-120452503 GGGCCACAGCCAGCATGAGAGGG + Intergenic
938204333 2:129404541-129404563 GAGCCATGGCCAGCTTCACAGGG + Intergenic
941650866 2:168091265-168091287 GAGCCAATGACTGCATCACAAGG + Intronic
948201023 2:236129922-236129944 ACACCAAAACCAGCATCTCATGG - Exonic
948322613 2:237082761-237082783 ACTCCAAAGCCAGCATCTCCAGG + Intergenic
1173645606 20:44631416-44631438 GCCCCAAAGTCACCCTCACAAGG + Intronic
1180057240 21:45365265-45365287 GCGGCCAAGCCAGCGTCACCGGG + Intergenic
1180057247 21:45365297-45365319 GCGGCCAAGCCAGCGTCACCGGG + Intergenic
1181117564 22:20642526-20642548 GCTCCAAAGCCAGTATCTCCTGG + Intergenic
950547523 3:13647348-13647370 TGGGCAACGCCAGCATCACAAGG - Intergenic
950679376 3:14574450-14574472 GCTCCAAAGGCAGCATCAGGTGG + Intergenic
950938979 3:16874183-16874205 GCTCCCAAGCCAGCCACACAAGG + Intronic
952407202 3:33015269-33015291 GCACCTCAGCCATCATCACAGGG + Intronic
953023948 3:39134214-39134236 GCGCCAGCTCCAGCATCACCTGG - Exonic
953561812 3:43998171-43998193 GCGCCAACTCCAGCAACACGTGG - Intergenic
953889668 3:46742754-46742776 GGGCAAAAGTCAGCATCACAGGG + Intronic
955753939 3:62209019-62209041 GCGCCAAAGCCAGCATCACATGG - Intronic
961329161 3:126128748-126128770 GGTCCAAGGCCAGCCTCACAGGG + Intronic
961404213 3:126667327-126667349 TCTCCAAGGGCAGCATCACAAGG + Intergenic
962272554 3:133988712-133988734 GGACTAAAGCCAGCAGCACATGG - Intronic
969268910 4:6085584-6085606 TCTCCAAGGCCAGAATCACACGG + Exonic
970243690 4:14035881-14035903 GCACCAAAGCACACATCACAGGG + Intergenic
975723919 4:77273982-77274004 GTGCCAAAGCCAACATAACATGG + Intronic
976904399 4:90218395-90218417 CCCCAAAACCCAGCATCACACGG + Intronic
980776519 4:137444078-137444100 ACGCCAAAGCCTGTACCACATGG - Intergenic
982341928 4:154309245-154309267 TCCCCAGACCCAGCATCACAGGG - Intronic
985823981 5:2179488-2179510 AAGCCAAAGCCAGGATCACAGGG + Intergenic
986103052 5:4631631-4631653 GTGCCAAACCCAGCAGCTCAGGG - Intergenic
988004917 5:25397180-25397202 GAGCCAGAGACAGGATCACATGG + Intergenic
989974832 5:50572548-50572570 GCTCCAAAGAAAACATCACAGGG - Intergenic
999829353 5:155304104-155304126 CCTCCAAAACCAGCATCACACGG - Intergenic
1003527394 6:6909652-6909674 TCGCCAGAGCCAGCACCACCTGG - Intergenic
1003946179 6:11078026-11078048 GCGACAAGACCAACATCACAGGG + Intergenic
1012081691 6:94766355-94766377 GTTCCAAAGCCATCACCACATGG - Intergenic
1012219786 6:96635243-96635265 GAGCCCCAGCCAGCTTCACAGGG + Intergenic
1014162570 6:118186876-118186898 GAACCAAAGCCAGCTTCCCAGGG + Intronic
1015142370 6:129949671-129949693 CGACCAAAGCAAGCATCACAGGG - Intergenic
1016392676 6:143591123-143591145 GGGCAAAAGGAAGCATCACAAGG - Intronic
1016417746 6:143850931-143850953 GCACCAAACCCAGCATCACAGGG + Intronic
1016581061 6:145629711-145629733 CTGCCACAGCTAGCATCACATGG + Intronic
1018003575 6:159600668-159600690 GTAACAAAGCCAGCAACACAGGG - Intergenic
1024101066 7:46033382-46033404 GAGCCAATGCCAGCAGCACCAGG - Intergenic
1028220282 7:88188972-88188994 GCCGCAAAGCCAACACCACAGGG - Intronic
1029278283 7:99420434-99420456 GCCCCCAAGCCAGAATCACTGGG + Intronic
1030056357 7:105586905-105586927 GCCCCAGACCCAGCAGCACAGGG - Intronic
1030395517 7:108981403-108981425 GCTCCTAAGGCAGCATCCCAAGG + Intergenic
1034945071 7:155256611-155256633 ACCCCATATCCAGCATCACAGGG + Intergenic
1034990308 7:155543772-155543794 TAGCCCAGGCCAGCATCACACGG - Intergenic
1040429118 8:47320711-47320733 AAACCAAATCCAGCATCACATGG + Intronic
1042338720 8:67656522-67656544 GCTCACAACCCAGCATCACATGG - Intronic
1043031375 8:75137493-75137515 GTGCCAAAGTCAGCATGCCAGGG - Intergenic
1049154480 8:141058550-141058572 ACCTCAAAGCCTGCATCACAGGG - Intergenic
1049955718 9:690793-690815 GTTCCAAAGCCACCATCCCAGGG + Intronic
1050504183 9:6330099-6330121 GCATAACAGCCAGCATCACAGGG - Exonic
1050618806 9:7431122-7431144 TAGGCAAAGCCAGCATCACCTGG - Intergenic
1050635399 9:7607062-7607084 GTGCCACACCCAGGATCACATGG - Intergenic
1055870333 9:80869876-80869898 GCTCAAAATTCAGCATCACAGGG + Intergenic
1060479946 9:124012092-124012114 GCGCCAAAGCCAGGGTCACAAGG - Exonic
1061355496 9:130101690-130101712 GGGCCAAGGCCAGCCTTACAAGG + Intronic
1186153832 X:6705416-6705438 GGTCCAAAGGCAGAATCACAAGG + Intergenic
1190260593 X:48794410-48794432 CCGCCTCAGCCAGCCTCACATGG - Intergenic
1192691080 X:73365361-73365383 ACTACAAAGCCAGCACCACAAGG - Intergenic
1194789575 X:98130110-98130132 GCCCCAAATTCAGCATCATAGGG + Intergenic