ID: 955758250

View in Genome Browser
Species Human (GRCh38)
Location 3:62249297-62249319
Sequence GAGGGCAGACAGGAGGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1214
Summary {0: 1, 1: 0, 2: 10, 3: 131, 4: 1072}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955758240_955758250 13 Left 955758240 3:62249261-62249283 CCTTGAGAGGCCTGAATTTGGCC 0: 1
1: 0
2: 0
3: 12
4: 108
Right 955758250 3:62249297-62249319 GAGGGCAGACAGGAGGGGCAGGG 0: 1
1: 0
2: 10
3: 131
4: 1072
955758244_955758250 -8 Left 955758244 3:62249282-62249304 CCTCTGAGAGACTGAGAGGGCAG 0: 1
1: 0
2: 1
3: 34
4: 323
Right 955758250 3:62249297-62249319 GAGGGCAGACAGGAGGGGCAGGG 0: 1
1: 0
2: 10
3: 131
4: 1072
955758238_955758250 20 Left 955758238 3:62249254-62249276 CCAAACACCTTGAGAGGCCTGAA 0: 1
1: 0
2: 3
3: 63
4: 937
Right 955758250 3:62249297-62249319 GAGGGCAGACAGGAGGGGCAGGG 0: 1
1: 0
2: 10
3: 131
4: 1072
955758241_955758250 3 Left 955758241 3:62249271-62249293 CCTGAATTTGGCCTCTGAGAGAC 0: 1
1: 0
2: 0
3: 19
4: 153
Right 955758250 3:62249297-62249319 GAGGGCAGACAGGAGGGGCAGGG 0: 1
1: 0
2: 10
3: 131
4: 1072

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955758250 Original CRISPR GAGGGCAGACAGGAGGGGCA GGG Intronic
900220868 1:1508723-1508745 GAGGACAGGAAGGTGGGGCAGGG + Intergenic
900296627 1:1955153-1955175 GAAGACAGACAGGAGGAGGACGG + Intronic
900313086 1:2043815-2043837 GAGGGCACCCAGGGGAGGCAGGG - Intergenic
900502855 1:3015112-3015134 GACGGGACACAGGAGGGGCCTGG + Intergenic
900511114 1:3061653-3061675 GAGGGCAGGCAGGAGGGAGAAGG + Intergenic
900570352 1:3355224-3355246 GAGGCCTGGCAGGAGGGGGAGGG + Intronic
900645899 1:3708650-3708672 GGGGTCTGTCAGGAGGGGCAAGG + Intronic
900970471 1:5989893-5989915 GAGGGCAGACACTAGGCGGAAGG + Intronic
900977571 1:6026856-6026878 GACAGCAGACAAGATGGGCAGGG - Intronic
900977599 1:6026962-6026984 GAGGGGAGAGAGGAGGGACTGGG - Intronic
901322603 1:8348874-8348896 GTGGGCAGGCAGGGCGGGCACGG - Intergenic
901365756 1:8746825-8746847 GAGGGCAGGCAGGGGAGGGAGGG + Intronic
902236381 1:15060186-15060208 GAGGGCTGCCGGGAGTGGCAGGG - Exonic
902260440 1:15221108-15221130 GAGGGGACATAGGAGGGGAATGG + Intergenic
902410046 1:16207099-16207121 GAGGGCGCAGAGGAGGGGCCGGG - Exonic
902421665 1:16285560-16285582 ATGGGAAGACAGGATGGGCATGG - Intronic
902448661 1:16483651-16483673 GAGGGCACATAGGAGGGGAGCGG - Intergenic
902468042 1:16630307-16630329 GAGGGCACATAGGAGGGGAGTGG - Intergenic
902506118 1:16939709-16939731 GAGGGCACATAGGAGGGGAGCGG + Intronic
902681153 1:18044731-18044753 GGGGGCAGTCAGGAGGGGCCAGG + Intergenic
903070068 1:20722679-20722701 AAGGGCAGGCAGGAAGGGCCAGG + Intronic
903254993 1:22091014-22091036 GAGGACTGAGAGGACGGGCACGG - Intronic
903368320 1:22818423-22818445 GAGGGCAGGCAGGGGGCGCAGGG - Intronic
904047656 1:27618183-27618205 GAGGGCAGGCAGGAGGGGGACGG + Intronic
904252369 1:29234307-29234329 GAAGCCAGCTAGGAGGGGCAGGG + Intergenic
904253394 1:29239729-29239751 GAGGGCAGACAGGACGTTCCAGG - Intronic
904495559 1:30884502-30884524 GAGGGCAGACTGGAGGTGACAGG - Intronic
904591415 1:31617625-31617647 GAGGGCCGGCGGGAGGGGCAGGG - Intergenic
905420969 1:37843839-37843861 GAGGGGAGACAGGAGGAGTAGGG - Intronic
905867957 1:41386540-41386562 GAGAGAAGACGGGAGGGGAAGGG - Intergenic
906237566 1:44221211-44221233 GAGGGGGCACAGGAGGGGCTTGG + Exonic
906322586 1:44826424-44826446 GAGGGATGACAGGCTGGGCAGGG + Intronic
906511761 1:46414027-46414049 TAGGTGAGAGAGGAGGGGCACGG - Intergenic
906769622 1:48472202-48472224 CATGGCAGCCAGGAGGGGCGGGG + Intronic
907021449 1:51070235-51070257 GAAGGAAAACAGGAGGGACAAGG - Intergenic
907049550 1:51320805-51320827 GAGGGAAGGGAGGTGGGGCAGGG + Intronic
907303731 1:53502805-53502827 GAGGAGAGAGGGGAGGGGCAGGG + Intergenic
907314731 1:53560999-53561021 GGGGGCACACAGTAGGGGCTTGG - Intronic
907406491 1:54256795-54256817 GGGGGTAGAAGGGAGGGGCAGGG + Intronic
907795384 1:57710921-57710943 TGGGGCAGGCAGGAGGGTCAGGG + Intronic
907972150 1:59393578-59393600 GAAGGGAGAGAGGAGGGGGATGG - Intronic
908252276 1:62274530-62274552 GAGGGAGGGCAGGAGGGGCAGGG + Exonic
910028509 1:82687913-82687935 AAGGGGAGGCAGGAGAGGCAGGG - Intergenic
911193353 1:94969614-94969636 AAGGGCCGACAGGAGGGACGGGG + Intergenic
912273154 1:108230194-108230216 CAGGGCATACAGCAGGTGCAAGG + Intronic
912295066 1:108464128-108464150 CAGGGCATACAGCAGGTGCAAGG - Intronic
912387679 1:109280358-109280380 GTAGGGAGACAGGATGGGCAAGG + Intronic
912470148 1:109901207-109901229 AAGGACAGAAGGGAGGGGCAGGG - Intergenic
912878895 1:113390187-113390209 GAGGGCGCAGAGGAGGGGCAGGG - Intergenic
913087127 1:115449485-115449507 GAGGGGAGACAGGAAGGGAAGGG - Intergenic
913550690 1:119914711-119914733 CCGGGAAGACAGGAGGGGAAAGG + Exonic
915033414 1:152903084-152903106 GAAGGCAGCCAGCAGTGGCAGGG - Intergenic
915091336 1:153428477-153428499 GAGAGGAGACAGGATAGGCAGGG + Intergenic
915257050 1:154641535-154641557 GGAGGTAGGCAGGAGGGGCAAGG - Intergenic
915455948 1:156040917-156040939 AGGGGCTGGCAGGAGGGGCAGGG - Intronic
916246845 1:162696797-162696819 CTGGGCAGACAGCGGGGGCAGGG - Intronic
916285891 1:163104681-163104703 AAGGTCTGACAGGAGAGGCAAGG - Intergenic
916437204 1:164788071-164788093 GAGGGAAGAGATGAGGGGGAGGG + Intronic
916512138 1:165481863-165481885 GAGGGGAGACAGGGGAGGGAGGG + Intergenic
916694085 1:167219969-167219991 GAAGGCAGAAAGGAAGGGTAGGG + Intergenic
918058881 1:181045508-181045530 GAGGGCGGGCAGGGGGAGCAGGG - Intronic
918091232 1:181296979-181297001 GAGGTTAGACAGGAGTAGCAGGG + Intergenic
918109704 1:181444669-181444691 GGGGTCAGACAGGAGGGGCAGGG - Intronic
919199232 1:194331263-194331285 GAGGGGAGATAGGAGGGGAGGGG + Intergenic
919760412 1:201094666-201094688 GAGGGCAGGTGGGACGGGCAGGG - Intronic
919837238 1:201583270-201583292 GAGAGGAGACAGCAGGGGCAAGG + Intergenic
919883847 1:201918491-201918513 GAGTGCAGGCAGGAAGGGGAGGG - Intronic
920255611 1:204652219-204652241 AAGGGGAGAGAGGAGGGGGAAGG - Intronic
920666459 1:207966107-207966129 GAGGTGAGACAGGAGGGGATGGG + Intergenic
920926535 1:210346824-210346846 CATGGCAGAGTGGAGGGGCAGGG + Intronic
921023748 1:211259339-211259361 GAGGGGAGAGAGGCGGGGCCGGG + Intronic
922160765 1:223077992-223078014 GAGGCCAGACACGAAGGCCAGGG + Intergenic
922356721 1:224783306-224783328 GAAGGAAAACAGAAGGGGCAAGG + Intergenic
922588529 1:226754158-226754180 GAGGCCAGACTGGAGGAGCAGGG + Intergenic
922705905 1:227789867-227789889 GAGGGGAGCCAGGAGAAGCAGGG - Intergenic
922748647 1:228060674-228060696 GAGGGCAGGGAGGAGGGGCTGGG - Exonic
922919954 1:229293840-229293862 GAGCCCAGACGGGAGTGGCAGGG + Intronic
923023528 1:230186249-230186271 GAGGGCACAAAGGAGGGGCTTGG - Intronic
923516812 1:234704533-234704555 GAGGTCTCAAAGGAGGGGCAGGG + Intergenic
923789512 1:237100041-237100063 AAGGGCAGGCAGGAGGGTCCTGG - Intronic
924207123 1:241725019-241725041 AAAGGCAGACAGCAGGGGCAGGG + Intronic
924376049 1:243410380-243410402 GAATACAGACAGAAGGGGCAGGG - Intronic
924539869 1:244970670-244970692 GAGGGGAGAGAGGCGGGGCGGGG - Exonic
1062857231 10:785378-785400 GAGAGCGGGCAGGAGGGGCAGGG - Intergenic
1063121346 10:3106997-3107019 CAGGGGTGAGAGGAGGGGCAGGG - Intronic
1063410194 10:5831417-5831439 GATGGCTGACAGGGGTGGCATGG - Intronic
1063482070 10:6384986-6385008 GGGGGCAGGCAGGTGGGGCCAGG - Intergenic
1063536761 10:6891224-6891246 GAGGGCAGGCAGGAGGGGCCAGG - Intergenic
1063656010 10:7989306-7989328 GAGGGCTGAAGGCAGGGGCAAGG + Intronic
1063687944 10:8256580-8256602 GATGGCAGCCAGGAGGGCCTGGG - Intergenic
1063922058 10:10943092-10943114 GAAGGACAACAGGAGGGGCAAGG - Intergenic
1064176619 10:13080839-13080861 GAGGCCAGACAGTGGGGGCTTGG + Intronic
1064215050 10:13393334-13393356 TTGGGGAGACGGGAGGGGCACGG + Intergenic
1064222723 10:13455529-13455551 GAGGGGAGACAGGAGGGCTGAGG + Intronic
1064450090 10:15434392-15434414 GAGGGAAGAAAGGAGGGAAATGG - Intergenic
1064539276 10:16389315-16389337 GAAGGAAAACAGGAGGGGTAGGG - Intergenic
1064921151 10:20519932-20519954 AAGGGTAGAAAGGAGGGGAAGGG - Intergenic
1065010735 10:21418571-21418593 GAGGACGGACAGAAGGAGCAAGG - Intergenic
1065177688 10:23095419-23095441 GAGGGAAGGAGGGAGGGGCAGGG + Intergenic
1066459127 10:35597802-35597824 CAGGGCAGAGAGGCTGGGCAGGG + Intergenic
1066471891 10:35706625-35706647 GAGGGCCTACAGGAGGTGGAGGG - Intergenic
1067145599 10:43691612-43691634 CAGGGCTGCCAGCAGGGGCATGG - Intergenic
1067719772 10:48719616-48719638 GAGGAGAAACAGGAGGGGCTGGG + Intronic
1068152031 10:53145018-53145040 GAGGGAGGAAAGGGGGGGCAAGG - Intergenic
1069642621 10:69965514-69965536 GAAGGCAGAAATGAAGGGCAGGG + Intergenic
1069694661 10:70377670-70377692 AAGGGCAGAGAGAAGGGGCATGG + Intronic
1069772181 10:70907047-70907069 GAAGGGAGGCAGGAAGGGCAGGG + Intergenic
1069829962 10:71277000-71277022 CAGGGCTGAGAGGAGGGGCGGGG + Intronic
1069840476 10:71336459-71336481 CAGGGCAGCCGGGAGGGACACGG + Intronic
1069875619 10:71561298-71561320 GGGGGCAGGGAGGAGGGGCAAGG - Intronic
1069883256 10:71607266-71607288 CAGGGAAGACAGGAAGGGCCAGG + Intronic
1069944186 10:71974693-71974715 GAGGGCAGACAGCAGGTGGGCGG - Intronic
1070311359 10:75276122-75276144 GTGGGGACGCAGGAGGGGCAGGG + Intergenic
1070328807 10:75403982-75404004 GAGGGGAGTCAGGTGGGGGAGGG - Intergenic
1070421159 10:76238556-76238578 GTGGGCATGCAGGAGGGGAAGGG + Intronic
1070497152 10:77034994-77035016 GAGGGCAGAGGGGAGGGGAGGGG - Intronic
1070629843 10:78076666-78076688 GAGGGGAGAGGGGAGGGGGAGGG + Intergenic
1070642386 10:78179222-78179244 GAGAGCAGAGAGGAGAGGCTTGG + Intergenic
1070752744 10:78973753-78973775 GAGGGGAGAAAGGAGCGGGAGGG + Intergenic
1071028359 10:81141952-81141974 GAGGGAGGGAAGGAGGGGCAAGG - Intergenic
1071038763 10:81280949-81280971 CAGGGGAGACAGTAGGGGGATGG + Intergenic
1071105552 10:82089951-82089973 GAGGGCAAAGAGCTGGGGCAGGG - Intronic
1071528890 10:86374198-86374220 GCGGTCAGAGGGGAGGGGCAGGG + Intergenic
1072097885 10:92200252-92200274 TAGGGCATACAGGCCGGGCACGG + Intronic
1072211461 10:93250339-93250361 GGGGTCAGTGAGGAGGGGCAAGG + Intergenic
1072443763 10:95480121-95480143 GATGGCAGCCAGGAGGGGACGGG + Intronic
1072871600 10:99126034-99126056 GTGAGCAGATGGGAGGGGCAGGG + Intronic
1072930242 10:99656225-99656247 AGGGGCACTCAGGAGGGGCATGG + Intergenic
1073118689 10:101108200-101108222 GAGGGGTCACAGCAGGGGCAGGG + Intronic
1073299778 10:102463927-102463949 GATGGCAGACAAGAGGGGCTAGG + Intronic
1074146370 10:110720696-110720718 GAGAGCAGGCTGCAGGGGCAGGG - Intronic
1074146386 10:110720749-110720771 GAGAGCAGGCTGTAGGGGCAGGG - Intronic
1074869225 10:117563992-117564014 AAGGGCAACCAAGAGGGGCAAGG - Intergenic
1075162038 10:120032847-120032869 GAAGGAAAACAGCAGGGGCAAGG + Intergenic
1075355408 10:121768450-121768472 TAGGTCAGAGAGGAGGGGCTGGG + Intronic
1075556104 10:123433844-123433866 GAGGCCAGACTGATGGGGCAGGG + Intergenic
1076368897 10:129939241-129939263 GAGGGCAGGAAGGAGGGCCAGGG - Intronic
1076453722 10:130575078-130575100 GAGGGAAGAAAGGAGGGGAAGGG - Intergenic
1076479732 10:130777330-130777352 CAGGGCAGACTGGAGGAGCCTGG + Intergenic
1076691335 10:132225177-132225199 GGGGGCAGAGAGCAGGGGCCTGG + Intronic
1076755700 10:132570473-132570495 GAGGGGAGAAAGGGGTGGCAAGG + Intronic
1076790545 10:132774853-132774875 ACGGGCAGGGAGGAGGGGCAGGG + Intronic
1076790576 10:132774940-132774962 ACGGGCAGGGAGGAGGGGCAGGG + Intronic
1076790597 10:132775000-132775022 AGGGGCAGAGAGGAGGGGCAGGG + Intronic
1076790603 10:132775013-132775035 AGGGGCAGGGAGGAGGGGCAGGG + Intronic
1076790646 10:132775113-132775135 AGGGGCAGGGAGGAGGGGCAGGG + Intronic
1076790662 10:132775160-132775182 AGGGGCAGAGAGGAGGGGCAGGG + Intronic
1076797168 10:132803970-132803992 GAGCTCAGCAAGGAGGGGCAGGG + Intergenic
1077016003 11:399438-399460 GAGGGAGGACAGGAGGAGTAGGG - Intronic
1077047587 11:553266-553288 GCGGGCAGGCAGGCCGGGCAGGG + Intronic
1077133228 11:985360-985382 GGGTGCAGCCGGGAGGGGCAGGG + Intronic
1077391338 11:2301962-2301984 AAGGGCAGGCAGGAAGGGGAGGG - Intronic
1077407253 11:2388256-2388278 GAGGGGAGACAGGAGTGTGAGGG + Intronic
1077414303 11:2417702-2417724 GAGGGCGGGCAGGGTGGGCAAGG - Intronic
1077486261 11:2839646-2839668 GAGGGAAGGCAGCAGGGGCTGGG + Intronic
1077489171 11:2852656-2852678 GAGTGCAGACAGCCGGGGCCAGG + Intergenic
1077497344 11:2892594-2892616 GAGGGAGGGGAGGAGGGGCAGGG - Intronic
1077887037 11:6394164-6394186 TGGGGCTGACTGGAGGGGCAAGG - Intronic
1078082334 11:8213259-8213281 CAGGGCAGACAGCAGGGGTGAGG - Intergenic
1078196832 11:9143570-9143592 GAGGGCCCATAGGAGAGGCAGGG + Intronic
1078241404 11:9534006-9534028 AAGGGCAAGCAGGAGGGGAAGGG - Intergenic
1078509256 11:11973514-11973536 GGGGGCAAACAGGAGTGGCCAGG - Intronic
1079100407 11:17538189-17538211 CAGGGCTGGCAGCAGGGGCAGGG - Intronic
1079100603 11:17539271-17539293 GTGGGGAGACAGGAGGGTAAAGG - Intronic
1080588306 11:33700442-33700464 GAGGCCAGGCCGGAGGGCCAGGG + Exonic
1080684735 11:34505580-34505602 GAGTGCAGCCAGGATGGGCTAGG - Intronic
1081593807 11:44445623-44445645 GAAGGCAGGCAGGAGAGGGAGGG + Intergenic
1081635677 11:44720079-44720101 GGAGGCAGGCAGCAGGGGCATGG + Intergenic
1081668282 11:44929241-44929263 GAGGACAGCGGGGAGGGGCACGG - Exonic
1081842872 11:46215877-46215899 GAGGACAGAGAGAATGGGCAAGG - Intergenic
1083279057 11:61614167-61614189 GAGAGAAGACAGTAGGGTCAGGG + Intergenic
1083313978 11:61802815-61802837 GAAGGCTGACAGCAGGGGCTTGG + Exonic
1083660331 11:64249082-64249104 GAGGACAGACAGAAAGGTCAGGG - Intergenic
1083713102 11:64560643-64560665 GAGGGAAGCAAGGAGGGGCTGGG - Intronic
1083714936 11:64569732-64569754 GAGAGGAGGCAGCAGGGGCAGGG - Exonic
1083848064 11:65347989-65348011 GAGGGTAGACTGTAGGGACAAGG + Intronic
1083882615 11:65555914-65555936 GAGGCCAGGCAGGATGGGCTGGG - Intronic
1083928334 11:65823185-65823207 GAGTGCCCACAGGAGGCGCACGG - Intronic
1084008743 11:66336280-66336302 CAGGGCAGCCAGGTGGGGCAGGG - Intronic
1084085481 11:66853111-66853133 GAGGGCAGGGGTGAGGGGCAGGG + Intronic
1084177901 11:67433074-67433096 GAGGACAGCCCGAAGGGGCACGG + Intronic
1084421607 11:69063304-69063326 GACGGCAGAGGGGAGAGGCAGGG - Intronic
1084612432 11:70212181-70212203 GAGAGGAAACAGCAGGGGCAAGG - Intergenic
1084877143 11:72141594-72141616 GAGGGCTCAAAGGAGGGGCATGG - Intergenic
1084882303 11:72180397-72180419 GAGGGCTCAAAGGAGGGGCATGG - Intergenic
1084952859 11:72676318-72676340 GAGGGCAGAAAGGAGGCTGAGGG - Intergenic
1085218457 11:74852278-74852300 AATTTCAGACAGGAGGGGCAAGG - Intronic
1085252586 11:75153335-75153357 TAGGGCAGACAGGTGGGGCGAGG + Intronic
1085283686 11:75346539-75346561 GCGGGCAGAGAGGAGTGGGAGGG - Intronic
1085423239 11:76381176-76381198 GAAGGCGGAAAGGAGGGGCGGGG - Intergenic
1085442288 11:76576081-76576103 GAGGGCAGTAAGGAGGGAGAAGG - Intergenic
1085472816 11:76769026-76769048 GTGGGCAGGAAGCAGGGGCATGG + Intergenic
1085511572 11:77090862-77090884 GAGGGAAGACAGGAGGGCAGCGG + Intronic
1085520928 11:77138434-77138456 GAGGGGAGAAGGGAGGGGGAGGG + Intronic
1086079835 11:82891562-82891584 GAGGACAGAAAGGAGGTTCAGGG - Intronic
1086218882 11:84417627-84417649 GTGGGCAGAGAAGATGGGCATGG - Intronic
1086892232 11:92271340-92271362 GAGGGAAGACATGAAGGACAAGG - Intergenic
1087666324 11:101053513-101053535 GAGGGAAGAAAGGAGGGAGAAGG - Intronic
1087666353 11:101053600-101053622 GAGGGAAGAAAGGAGGGAGAAGG - Intronic
1088376947 11:109151726-109151748 GAGGGGAGAGGGGAGGGGGAGGG - Intergenic
1088645476 11:111913320-111913342 GAGGGGAGTCAGGAGGAGTAGGG - Intronic
1088992249 11:114963747-114963769 GAGGCAAGACATGAGGGCCAGGG + Intergenic
1089582227 11:119488728-119488750 GAGGGCAGACTTGGGGGACAGGG - Intergenic
1090376452 11:126292933-126292955 GAGGCCCGACAGCAGGGGGATGG - Exonic
1090456652 11:126855882-126855904 GTGGGCAGGCAGGAGGGGACAGG + Intronic
1090536414 11:127646416-127646438 GAGGGCAAAAAGGAGGGTCAGGG + Intergenic
1090726323 11:129530421-129530443 GAGGGGGGAGAGGAGAGGCAGGG + Intergenic
1091106065 11:132920907-132920929 GCTGGAAGACAGGAGGGACAAGG - Intronic
1091157464 11:133386882-133386904 GAGGGCAGACAGAATGCTCAGGG + Intronic
1091706071 12:2694333-2694355 GGGGGCTGTCAGGAGGGGTATGG - Intronic
1091718211 12:2794880-2794902 GAGCGCAGACAGAGGGGGCGGGG - Intergenic
1091864250 12:3817380-3817402 GAAGGCAGAGGGCAGGGGCATGG + Intronic
1092024840 12:5231898-5231920 CAGGGCTCACAGGAGGGGCTCGG - Intergenic
1092261546 12:6955795-6955817 GAGGGGAGGCAGCTGGGGCAGGG - Intronic
1092261791 12:6956808-6956830 GGATGCAGACAGGTGGGGCAGGG - Intronic
1092261798 12:6956829-6956851 CAGGGAGGACAGGAGGGGCCTGG - Intronic
1093262056 12:16950594-16950616 GAAGGGAGACAGGAAAGGCAGGG - Intergenic
1094021415 12:25918048-25918070 GAGGGCAGAGAGGGGAGGAAAGG + Intergenic
1094489738 12:30952216-30952238 GACTGCAGACAGGAGTGGCCAGG + Intronic
1096096474 12:48938790-48938812 GAGGGGAGGCAGGGGAGGCAAGG + Exonic
1096186030 12:49581108-49581130 GTGTGCAGAGAGCAGGGGCAGGG + Intronic
1096319437 12:50598785-50598807 GAGGGGAGAGGGGAGGGGGAGGG - Intronic
1096463558 12:51836217-51836239 CAGGGCAGACAGGCGGGGCTGGG - Intergenic
1096548387 12:52356598-52356620 GTGGGCAGGCAGGCAGGGCAGGG + Intergenic
1096570394 12:52519888-52519910 GAGGGCAGACAGGAAAGCCAGGG + Exonic
1096634916 12:52952090-52952112 GGGCACAGAGAGGAGGGGCAGGG - Intronic
1096700838 12:53381500-53381522 GAGGGCAGAGGGGAGCTGCAGGG - Intronic
1096706333 12:53424663-53424685 GAGGAGAGAAAGGGGGGGCAAGG - Intronic
1096707346 12:53430521-53430543 GAGGAGAGACAGGCTGGGCAAGG - Intronic
1097141808 12:56908614-56908636 GAGGGCAGACCACAGGGACATGG - Intergenic
1097283514 12:57860483-57860505 GTGGGCAGCCAGGAGGAGAAAGG + Intergenic
1097728290 12:63099348-63099370 GAAGGAAAACAGAAGGGGCAAGG + Intergenic
1098947514 12:76605246-76605268 GAGGGCAGTCAGTAGTGGGAGGG - Intergenic
1099222851 12:79934986-79935008 GAGGGAAGAGAGGGGAGGCAGGG + Exonic
1099312982 12:81050736-81050758 GAGAGCAGACAGGAAGGTAAAGG + Intronic
1099643387 12:85319518-85319540 GAGGACAAAGAGGAGGGGGAGGG - Intergenic
1099731277 12:86506843-86506865 GAAGGCAGAAAGAAGGGGTAAGG + Intronic
1100286282 12:93169610-93169632 GAGGGAAGAAAGGAAGGGGAGGG + Intergenic
1100411613 12:94324966-94324988 GAGGGAACACAGGAGGCCCAGGG - Intronic
1100447711 12:94676565-94676587 GAGGGCAGAGGGGCTGGGCACGG + Intergenic
1101451834 12:104786942-104786964 GAGGTCAGACAGCACAGGCAGGG + Intergenic
1101452064 12:104788945-104788967 AGGGGCAGAAAGCAGGGGCAAGG + Intergenic
1101499778 12:105292200-105292222 GAGGGTAGGGAGGAGGGGCTGGG + Intronic
1101542421 12:105676991-105677013 CAGGGGAGGCAGGAGGGGCCAGG + Intergenic
1101597056 12:106177222-106177244 GATGGGAGACAGGCGGGGCACGG - Intergenic
1101728636 12:107408464-107408486 CTGGGAAGACAGTAGGGGCAGGG + Intronic
1101828178 12:108236953-108236975 GAGGGGAGACAGAAGAGGGAAGG + Intronic
1101905284 12:108820226-108820248 GAGGACAGATAAGAGGGGCATGG - Intronic
1101942592 12:109111114-109111136 CAGGGCGGGGAGGAGGGGCAAGG - Intergenic
1102212630 12:111138367-111138389 GTGGGGAGAGAGGAGGGGTAGGG + Intronic
1102445934 12:113002824-113002846 GAGGGCAGTTGGGAGAGGCAGGG + Intronic
1102786118 12:115606349-115606371 AAGGGGAGAGAGGAGGGGGATGG + Intergenic
1103612650 12:122133553-122133575 GCTGGGAGACAGCAGGGGCATGG - Exonic
1103763355 12:123266403-123266425 CAGGGCAGCCTGGTGGGGCATGG + Intronic
1103967157 12:124647072-124647094 GAGGGCAGACAGGAGGAAGTAGG + Intergenic
1104038393 12:125114219-125114241 GAGGGCAGACAGGAGTGTCAGGG + Intronic
1104088065 12:125493799-125493821 GAGGACGGAGAGGAGGGACACGG - Intronic
1104844070 12:131838170-131838192 GAGGGCAGAGAGCAGGGTGAGGG - Intronic
1104953112 12:132451262-132451284 CAGGGCATCCAGGAGGGGCCAGG + Intergenic
1105648263 13:22344766-22344788 GAAGGAAAACAGGAGGGACAAGG + Intergenic
1106865367 13:33958778-33958800 GAGGGCAGCCAGGATGCTCATGG - Intronic
1107375183 13:39796637-39796659 GGGGGCAGAGAGGAAGGGAAGGG + Intergenic
1107592634 13:41924380-41924402 GAGAGAAGAGAGGAGGGGAAGGG + Intronic
1108003273 13:45923867-45923889 GTGGGCAGACAGGCAGGGCCAGG - Intergenic
1108688895 13:52845728-52845750 GAAGGGAGACTGGAGGGGTAGGG - Intronic
1108965178 13:56289692-56289714 GAGGGCAGTCAGGTAGGGCAAGG + Intergenic
1109636460 13:65124446-65124468 AAGAGGAAACAGGAGGGGCAAGG - Intergenic
1110284212 13:73730834-73730856 TAGGGCAGACAGGATGACCAGGG + Intronic
1110553010 13:76828280-76828302 GAGGGGAGAGGGGAGGGGGAGGG + Intergenic
1110563005 13:76929354-76929376 AAGGGGAGGCAGGAGAGGCAGGG + Intergenic
1110785290 13:79517310-79517332 GAGGGGAGACAGGAGAGGAGGGG - Intronic
1111226913 13:85286608-85286630 GAGGGCAGAGGGGGGAGGCATGG - Intergenic
1111776071 13:92663446-92663468 GATGGCAAACAGGTGGGGCGCGG + Intronic
1111906053 13:94257485-94257507 GAGGGCTGACAGGTGGACCAGGG - Intronic
1112043551 13:95572767-95572789 CAGGGCAGATAAGAGGGACATGG - Intronic
1112253827 13:97809135-97809157 GGGGGGAGACAGTGGGGGCAGGG + Intergenic
1112327991 13:98456523-98456545 GATGGCAGTCAGGAGGGGCTTGG + Intronic
1113437143 13:110302007-110302029 GAGAGCTGGGAGGAGGGGCAGGG + Intronic
1113697218 13:112354922-112354944 GAAGGGAGACAGAAGGGGGAGGG + Intergenic
1113955597 13:114098632-114098654 GAGGGGAGGCAGGAAGGGCAAGG + Intronic
1114438295 14:22726283-22726305 TGGGGAAGACAGCAGGGGCATGG + Intergenic
1114486010 14:23062129-23062151 GAGGAAAGAGAGGAGGGGCAGGG - Intronic
1114552664 14:23542325-23542347 GGGAGCAGACAGGAGGAGAAGGG + Intronic
1114635402 14:24184242-24184264 GTGGGAAGACAGGAGGGGAGGGG + Intronic
1115211345 14:30970222-30970244 GAGGAGAGTCAGGAGGGACAAGG - Intronic
1115353685 14:32424644-32424666 GAGGGTAGAGAGTAGGGGGAGGG - Intronic
1115896917 14:38099636-38099658 GATGGCAGTCAGGCTGGGCATGG + Intergenic
1116076066 14:40112626-40112648 CAGGGCAGCCAGCAGGGGTAGGG + Intergenic
1117135402 14:52730350-52730372 GAGGGCTGACAGGAGGGCGGCGG - Exonic
1117473863 14:56074087-56074109 GAGGAGAGATTGGAGGGGCAGGG - Intergenic
1118691781 14:68346931-68346953 GAGGGAAGGCAAGAGGGGAAGGG - Intronic
1118883610 14:69849267-69849289 GAGGGCTGGCACGAGGGGAAAGG - Intergenic
1119186802 14:72648941-72648963 GAGTGTGGAAAGGAGGGGCATGG - Intronic
1119401455 14:74365423-74365445 GAGGGCAGCCAGGAGGAGACTGG + Intergenic
1119428471 14:74550979-74551001 GAGGACAGAGAGGAGGAGAAGGG + Intronic
1119722580 14:76901171-76901193 GAGGGCAGAAAGGAGAGGGAGGG + Intergenic
1119756966 14:77126149-77126171 CAGGGCAGGCCAGAGGGGCAAGG - Intronic
1119986299 14:79142136-79142158 AAGGGCAGACAGGCCAGGCACGG + Intronic
1120030771 14:79638145-79638167 CAGGCTAGAAAGGAGGGGCATGG - Intronic
1120780070 14:88479189-88479211 GAGGGCAGCCAGGTGGGTCCTGG + Exonic
1121098359 14:91233480-91233502 GAAGGAAGGCAGGAGGGGGAAGG - Exonic
1121098366 14:91233498-91233520 AAGGGAAGACTGGAGGGGGAAGG - Exonic
1121329651 14:93041799-93041821 GAGGCCAGACAGGAAAGGCCAGG - Intronic
1121721900 14:96115139-96115161 TAGGGCAGTCTGGAGGGGCTGGG + Intergenic
1121725872 14:96149325-96149347 GTGGGCAGATGGGAGGGGCGAGG - Intergenic
1122355407 14:101120257-101120279 CAGAACAGACAGGAGGAGCATGG + Intergenic
1122458861 14:101879152-101879174 GAGGGCGGGCAAGAGGGGCTCGG - Intronic
1122672044 14:103379842-103379864 GAGGGGAAAGAGGAGGGGCCGGG - Intergenic
1122787652 14:104171361-104171383 GAGGGCAGGAGGGAGGAGCATGG - Intronic
1122895651 14:104755517-104755539 GAGGGCACACAGGAGGACGATGG + Intronic
1122921552 14:104882439-104882461 GAGGGGAGAGAGGAGGGGCCAGG + Intronic
1123068110 14:105628256-105628278 GAGGGGGGGCAGGAGGAGCAGGG - Intergenic
1123093634 14:105753760-105753782 CAGGGCAGAAGGGAAGGGCAGGG - Intergenic
1123114283 14:105886871-105886893 GGGTGCTGAGAGGAGGGGCAGGG - Intergenic
1123116441 14:105896286-105896308 GGGTGCTGAGAGGAGGGGCAGGG - Intergenic
1123118490 14:105905534-105905556 GGGTGCTGAGAGGAGGGGCAGGG - Intergenic
1123154450 14:106210869-106210891 GCAGGAAGACAGGAGGGGCCTGG - Intergenic
1123181010 14:106470196-106470218 GCAGGAAGACAGGAGGGGCCTGG - Intergenic
1202945898 14_KI270726v1_random:26583-26605 GCAGGAAGACAGGAGGGGCCTGG + Intergenic
1123403424 15:20006705-20006727 GTGGGCTGGGAGGAGGGGCAGGG - Intergenic
1123512762 15:21013359-21013381 GTGGGCTGGGAGGAGGGGCAGGG - Intergenic
1123706630 15:22955505-22955527 GTGGGCAGGCAGCAGGGGCTGGG + Intronic
1123774457 15:23565474-23565496 GAAGGCAGACAAAAGGGGCTGGG + Intergenic
1123871471 15:24578974-24578996 CAGGGCATGCAGAAGGGGCATGG + Intergenic
1123971230 15:25509735-25509757 GAGGGGAGAGAGAAGGGCCAGGG + Intergenic
1124163972 15:27301889-27301911 GAGGCCAGAAAGAAGAGGCATGG + Intronic
1124215911 15:27807045-27807067 GCGGGTAGACAGGGGAGGCAGGG - Intronic
1124244345 15:28056904-28056926 GGGGGCAGGCAGCTGGGGCAGGG - Intronic
1124613155 15:31222977-31222999 GAAGGGAGGCAGGAGAGGCAGGG + Intergenic
1124855255 15:33381471-33381493 GAGGACAGACAGCAGGGAGATGG - Intronic
1124973701 15:34514608-34514630 GAGGGCAGAGAGGGGGCGCCCGG - Intergenic
1125178695 15:36856707-36856729 GAGGGGAGAGGGGAGGGGGAGGG - Intergenic
1125469766 15:39991234-39991256 GAAGGCAGACAGTACGGACAGGG + Intronic
1125517710 15:40332001-40332023 GAGGGCACACAGGAGGAGGGAGG - Intronic
1125540355 15:40466450-40466472 GGGGGCGGGAAGGAGGGGCAAGG + Exonic
1125798328 15:42421343-42421365 CAGGGCAGAGAGGAGTGGCAGGG + Intronic
1125892375 15:43276181-43276203 GAGAGAGGACAGGAGGGGAAGGG + Intergenic
1126485908 15:49180777-49180799 GATGTCAGACAGGTGGGGTACGG - Intronic
1127397207 15:58552446-58552468 GAGGGCAGAGAGGAGGAGGCGGG - Intronic
1127817326 15:62622533-62622555 CAGGGCAGAGAGGAGAGTCATGG - Intronic
1128016959 15:64356111-64356133 GAAGGCGGACGGGAGGGGGAAGG + Exonic
1128133866 15:65248717-65248739 GGCCGCAGACAGGAGGGGGAAGG - Intronic
1128335837 15:66785278-66785300 GAGTTCAGACAGAAGGGCCAAGG - Intergenic
1128396198 15:67228979-67229001 GAGGGGAGACAGTAGGAGGAGGG + Intronic
1128608321 15:69054836-69054858 GAGGACAGACATGTGAGGCATGG + Intronic
1128740978 15:70083532-70083554 GAGGGGAGGGAGGAGGGGGAAGG - Intronic
1128762006 15:70223497-70223519 GAGGGGAGGCAGGAGGGGCAGGG - Intergenic
1128800784 15:70495511-70495533 CAGGGCTGACAGGAGAGGCCTGG - Intergenic
1129038680 15:72666014-72666036 GTGGGCAACCATGAGGGGCATGG + Exonic
1129211211 15:74071216-74071238 GTGGGCAACCATGAGGGGCATGG - Exonic
1129244374 15:74270741-74270763 GAAGGCAGACAGGGGAGACAGGG - Intronic
1129263899 15:74383747-74383769 GAGAGCAGACAGGGTGGGCAGGG + Intergenic
1129322430 15:74782500-74782522 GAGGGAAGAAAGGCGGGGGAAGG - Exonic
1129342055 15:74892568-74892590 GAGGGTGGACAGCAGGGGCTAGG + Intronic
1129350834 15:74955227-74955249 GAGGGGAGACACAAGGGGCCAGG + Exonic
1129389758 15:75214662-75214684 CAGGAGAGACAGGAGGGGCTTGG - Intergenic
1129399192 15:75269871-75269893 GTGGGCAACCATGAGGGGCATGG + Exonic
1129402799 15:75294147-75294169 GTGGGCAACCATGAGGGGCATGG + Exonic
1129644866 15:77420331-77420353 GAAGGCAGAGAGGAGGGGCCTGG - Intergenic
1129728344 15:77915490-77915512 GTGGGCAACCATGAGGGGCATGG - Intergenic
1129790426 15:78337460-78337482 CAGAGCAGACAGGAGGGGCCAGG - Intergenic
1130006860 15:80107871-80107893 GAGGGCAGCGGGGAGGGGGAAGG + Intronic
1130027939 15:80285991-80286013 GAGGACAGACAGAGGGGTCAGGG - Intergenic
1130139170 15:81209264-81209286 GAGGGCAGACAGTGTGGGGAGGG + Intronic
1130141391 15:81229268-81229290 GAGGGCAGACAGTGTGGGGAGGG + Intronic
1130538367 15:84802911-84802933 GAAGACAGGGAGGAGGGGCAAGG - Exonic
1131273535 15:90961230-90961252 GAGGCCAGACAGGGGAGACATGG + Intronic
1131510105 15:93045034-93045056 GAGGGCGCCCAGGAGGGGCCGGG + Exonic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1132092996 15:98960783-98960805 GAGGGCAGCCTGGAGGGGGAGGG - Exonic
1132566333 16:625245-625267 GAGGGCAGGGGTGAGGGGCAGGG + Intronic
1132578969 16:676510-676532 GTGGGCAGGCGGCAGGGGCACGG + Intronic
1132674249 16:1115094-1115116 GAGGCCAGCCAGGAGAGGCCGGG - Intergenic
1132806515 16:1777579-1777601 GAGGCCAGGCTGGAGTGGCAGGG - Intronic
1132889764 16:2197689-2197711 GAGGTCAGACAGCAGGGACAGGG + Intergenic
1132989754 16:2786679-2786701 GAGGACAGACAGAAGGACCACGG - Exonic
1132989868 16:2787065-2787087 GAGGGGAGTGAGGAGGAGCAGGG - Intronic
1133249197 16:4469202-4469224 GAGGGCAGGCAGGAGCTGCAGGG - Intronic
1133616000 16:7477485-7477507 GGGGGCAGAAGGGAGAGGCAAGG - Intronic
1133922430 16:10165692-10165714 GAGGGGAGAAAGGAGGGGAGGGG + Intronic
1133922437 16:10165709-10165731 GAGGGGAGAAAGGAGGGGAGGGG + Intronic
1133922444 16:10165726-10165748 GAGGGGAGAAAGGAGGGGAGGGG + Intronic
1133922451 16:10165743-10165765 GAGGGGAGAAAGGAGGGGAGGGG + Intronic
1134111428 16:11517710-11517732 AAGGGCAGGCGGGAGGAGCACGG - Intronic
1134492887 16:14709070-14709092 GAGTGCAGACAGATGGGGCCTGG + Intronic
1134498268 16:14748192-14748214 GAGTGCAGACAGATGGGGCCTGG + Intronic
1134582306 16:15380899-15380921 GAGTGCAGACAGATGGGGCCTGG - Intronic
1134673696 16:16074551-16074573 TAGGGCAGGAAGGAGGGGCTGGG - Intronic
1134802379 16:17097196-17097218 GAGAGCAGACAGAACAGGCAGGG + Intergenic
1135082184 16:19445767-19445789 GAAGGCAGAGAGGAGGGGACAGG + Intronic
1135183081 16:20291920-20291942 CAGGGGAGAGAGGAGGGGGAGGG + Intergenic
1135313627 16:21424950-21424972 GAGTGCAGACAGATGGGGCCTGG - Intronic
1135366551 16:21857230-21857252 GAGTGCAGACAGATGGGGCCTGG - Intronic
1135445264 16:22513928-22513950 GAGTGCAGACAGATGGGGCCTGG + Intronic
1135518565 16:23156080-23156102 AAGGGAAGACAGGAAGGGAAAGG + Intergenic
1135603337 16:23801746-23801768 GAGGGAAGACGGGAGGGGAGGGG - Intergenic
1135642403 16:24132279-24132301 TAGGGCAGGCATGAGGGGAAGGG + Intronic
1135667864 16:24351150-24351172 GAAGGAAAACAGGAGGGGCAAGG + Intronic
1135920296 16:26643415-26643437 AAGGAAAGAGAGGAGGGGCAGGG - Intergenic
1136103020 16:28009363-28009385 AAGGGCATGCAGGGGGGGCAGGG - Intronic
1136152769 16:28362674-28362696 GAGTGCAGACAGATGGGGCCTGG - Intronic
1136169127 16:28477640-28477662 GAGGGCAGAGAGCAGGGGTGAGG + Intronic
1136187670 16:28597576-28597598 GTGGGCAGAGTGAAGGGGCAGGG + Intergenic
1136190149 16:28610556-28610578 GTGGGCAGAGTGAAGGGGCAGGG + Intronic
1136210314 16:28752599-28752621 GAGTGCAGACAGATGGGGCCTGG + Intronic
1136310289 16:29403654-29403676 GAGTGCAGACAGATGGGGCCTGG - Intronic
1136323738 16:29505444-29505466 GAGTGCAGACAGATGGGGCCTGG - Intronic
1136365813 16:29808751-29808773 GAGGGCTGCCGGGAGGGCCAGGG + Intronic
1136438423 16:30245425-30245447 GAGTGCAGACAGATGGGGCCTGG - Intronic
1136573646 16:31110785-31110807 GTGGGCAGACATCTGGGGCAGGG + Intronic
1136595221 16:31244283-31244305 GAGGCCAGACAGGAGCTCCAGGG - Intergenic
1137275048 16:46927823-46927845 GAGGGCTGCCAGGAAGGCCAGGG + Intronic
1137440587 16:48495708-48495730 GATGGCAGACAGGAAAGACAGGG + Intergenic
1137610567 16:49814511-49814533 GAGGGCAAGCAGGACAGGCATGG + Intronic
1137717002 16:50604063-50604085 GAGGCCAGAGGGGAGGGGCCTGG + Intronic
1138112560 16:54336571-54336593 GAGGGCAGGAAGGTGGGGGAGGG + Intergenic
1138427466 16:56945605-56945627 GACGGCTGACAGGTGGGACATGG + Intergenic
1138503011 16:57460125-57460147 AATGGGAGAGAGGAGGGGCAGGG - Intronic
1138619768 16:58201572-58201594 GTGGGCAGAAATGAGAGGCAGGG - Intergenic
1138667777 16:58586413-58586435 GAGGGCAGGGAGGAGGGGAGGGG + Intronic
1138750232 16:59410629-59410651 GAGGGCAGAAAGGAGGTGAGAGG - Intergenic
1139352583 16:66346574-66346596 GAGGAGAGATAGGTGGGGCAGGG + Intergenic
1139612170 16:68067128-68067150 GAGGGGAGAAGGGAGGGGGAGGG - Intronic
1139857971 16:69996040-69996062 GAGTGCAGACAGATGGGGCCTGG - Intergenic
1139922516 16:70468979-70469001 GAGGGCAGCTAGGTGGGGCCTGG + Intronic
1140268610 16:73442687-73442709 GAGGAAAGAGAAGAGGGGCATGG - Intergenic
1140834006 16:78776763-78776785 GGCGGCAGGCAAGAGGGGCAGGG + Intronic
1141173224 16:81704195-81704217 GGGGGCAGGAAGGAGGGGGAGGG - Intronic
1141173234 16:81704215-81704237 GGGGGCAGGGAGGAGGGGGAGGG - Intronic
1141173317 16:81704420-81704442 GGGGGCAGGGAGGAGGGGGAGGG - Intronic
1141249981 16:82346908-82346930 AAGGACAGAGAGGAGGAGCAGGG + Intergenic
1141289638 16:82705992-82706014 GAGAGAGGACAGGAGGGGGAAGG - Intronic
1141508606 16:84497517-84497539 GAGGGCAGTCAGGAGGGACGTGG + Intronic
1141510647 16:84509766-84509788 GGGGGAAGACAGGAGGCTCAGGG + Intronic
1141522568 16:84590825-84590847 GTAGAGAGACAGGAGGGGCAAGG + Intronic
1141665101 16:85461894-85461916 GAGAGCAGGAAGGAGGGGCAGGG - Intergenic
1141775705 16:86121570-86121592 GAGGGAGGTGAGGAGGGGCAGGG - Intergenic
1142119010 16:88376838-88376860 TAGGGCAGCCAGGAAGTGCAGGG + Intergenic
1142401017 16:89858840-89858862 CAGGGCAGCCAGGGTGGGCAGGG - Intronic
1142607472 17:1090120-1090142 GAGGCCAGACGAGAGGGGGAAGG + Intronic
1142740729 17:1930539-1930561 GAGGGCAGAGAGGAGAGAGATGG + Intergenic
1142759460 17:2034614-2034636 GAGGGGAGAGAGGGGGAGCAGGG - Intronic
1142898696 17:2998958-2998980 GAGGGTGGAGAGGAGGGGCCTGG + Intronic
1143130721 17:4675282-4675304 GAGTGCAGACAGCAGGTCCAAGG + Exonic
1143258817 17:5583627-5583649 CAGGGCAGGCATGAGGGCCAGGG + Intronic
1143411322 17:6711184-6711206 GAGGGTACACAGCACGGGCAGGG - Intronic
1143451274 17:7038320-7038342 GAGGGCAGACACCAGCAGCAGGG - Exonic
1143894536 17:10125868-10125890 GAGGGTAGAGAGGAGTGGAAGGG - Intronic
1144017443 17:11209469-11209491 GAGGGCAGAGACGAGGGAGAGGG - Intergenic
1144668917 17:17120465-17120487 GAGGACCGGCAGGAGGAGCAGGG + Intronic
1144833280 17:18143568-18143590 GAGGGCAGAGTGGAGGTGCCAGG + Exonic
1144848151 17:18230712-18230734 AAGGCCACACAGGAGGGGTAGGG - Intronic
1144952394 17:19001248-19001270 CAGGGCAGAAAGCAGGGGCTTGG + Intronic
1145214566 17:21042368-21042390 GGGGACAGAGAGGAGGGGGAGGG + Intronic
1145214574 17:21042388-21042410 GGGGACAGAGAGGAGGGGGAGGG + Intronic
1145264170 17:21371617-21371639 GAGGGCAGCCACCAGGGCCAAGG - Intergenic
1145280791 17:21465467-21465489 GAGGGCTGAGAGGAGGGGTGTGG + Intergenic
1145397120 17:22505097-22505119 GAGGGCTGAGAGGAGGGGTGTGG - Intergenic
1147237734 17:39070032-39070054 TAGGGCAGACAGGGGCTGCAGGG + Intronic
1147458516 17:40553699-40553721 GAGGGCAGGGAGGAGGGGAGAGG + Intergenic
1147556931 17:41485641-41485663 GAGGGCAGTCAGGGAGAGCAGGG - Intergenic
1147605519 17:41771932-41771954 GTGGGAAGACAGGCGGGGCTTGG - Intronic
1147656576 17:42094617-42094639 GGGAGCACACAGGAGGCGCAGGG + Intergenic
1148070718 17:44907086-44907108 AGGGGCAGTCTGGAGGGGCATGG - Intronic
1148086267 17:44995564-44995586 AAGGGCAGCCAGGAGGGGTCAGG - Intergenic
1148560652 17:48604091-48604113 GAGGGATGGCAGGAGGGGGAGGG + Intronic
1148577154 17:48720087-48720109 GAGGGCCCACAGGATGGGTACGG + Intergenic
1148748737 17:49932486-49932508 GAGGGCAGGCAGCGGGGGCCTGG - Intergenic
1148790748 17:50171354-50171376 GGGGGCACATAGGAGGGGTAAGG - Intronic
1149585246 17:57782188-57782210 GGGGGCTGTCAGCAGGGGCAAGG + Intergenic
1149752421 17:59158762-59158784 GAGGACAGAACGGAGGGGGATGG + Intronic
1149905810 17:60525764-60525786 GAGAGCAGAGAGGAGGCCCACGG + Intronic
1150947705 17:69765663-69765685 GAGGGAAGAGAAGAGGGGGAGGG - Intergenic
1151323818 17:73366875-73366897 GAGGGGAGAGAGTAGAGGCAGGG - Intronic
1151374672 17:73679068-73679090 GCAGACAGACAGGAGGGGCAGGG - Intergenic
1151659577 17:75511833-75511855 GAGGGCAGGCGGGAGGGGTTTGG - Intronic
1151700931 17:75742264-75742286 GAAGACAGGCAGGAGGGACAGGG + Intronic
1151784884 17:76270555-76270577 GTGGGGACACAGGAGGGCCAGGG + Exonic
1151823308 17:76509017-76509039 GTGGGAAGAAAAGAGGGGCAAGG + Intergenic
1151974677 17:77477664-77477686 GAGGGAGGTCAGGAGGTGCATGG + Intronic
1152002102 17:77653421-77653443 GAAGGCAGACAGGAGAGAGAGGG - Intergenic
1152161523 17:78671314-78671336 GTGGGCAGAGAGGAGAGGCCAGG + Intergenic
1152382066 17:79947229-79947251 GAGTGCAGACAGGAAGAGGAGGG - Intronic
1152589727 17:81205490-81205512 GAGGGGAGGTAGGAGGGGCAGGG + Intronic
1152591792 17:81217183-81217205 GTGGGCACACAGCTGGGGCAAGG + Intronic
1152641352 17:81450574-81450596 TGGGGCAGGCAGGAGGGCCATGG - Intronic
1152695820 17:81794579-81794601 GTGGGCAGGTAGGAGGGGCAGGG + Intergenic
1152790036 17:82273799-82273821 GAGGGCAGAGGGGCTGGGCACGG - Intergenic
1152858216 17:82678704-82678726 CGGGGCAGAGGGGAGGGGCAGGG + Intronic
1152922842 17:83074366-83074388 GCGGGCTGCCAGGAGGGCCACGG + Intergenic
1152930032 17:83104701-83104723 GAGGGCTGACAGGAGAGGCTTGG + Intergenic
1153526421 18:5998794-5998816 GAGGACAGAAAGGAGGGGACAGG - Intronic
1153711866 18:7808294-7808316 GAGGGCACAGAGGAGAAGCAGGG + Intronic
1154119421 18:11639317-11639339 GAGTGCAGACAGATGGGGCCTGG - Intergenic
1154248512 18:12722033-12722055 GATTGCAGACAGGAGGTGAAGGG - Intronic
1154299512 18:13180925-13180947 GAGGGGAAAGAGGAGGGGTATGG - Intergenic
1155202187 18:23526993-23527015 GTGGGCACACAGGAGGGGAGTGG + Intronic
1155585104 18:27355610-27355632 GCAGGCAGACAGGAGGAGAATGG - Intergenic
1156454124 18:37283274-37283296 GAGAGCAGACAGCAGGGGCTTGG - Intronic
1156472213 18:37384406-37384428 GAGGACACATAGGTGGGGCAGGG + Intronic
1156825945 18:41430127-41430149 GAGGGAAGACAGGAGGGAAGGGG + Intergenic
1156959239 18:43003028-43003050 CAGGGCAGCCAGGAGGAGCTGGG + Intronic
1157388072 18:47276701-47276723 GAGGCCTGACAGTAGGGGCTGGG - Intergenic
1157410047 18:47455872-47455894 GGGGGCAGAGTGGTGGGGCAGGG - Intergenic
1157867292 18:51197494-51197516 GAGGGCGGGGTGGAGGGGCAGGG + Intronic
1157892075 18:51427408-51427430 GAGGGGAAACAGGGAGGGCATGG - Intergenic
1158179981 18:54703405-54703427 GATGGAAGACAGGAAGGTCATGG - Intergenic
1158891821 18:61879524-61879546 GAGGGCAGAGAGGAAGGATAGGG + Intronic
1159941359 18:74411395-74411417 GTGGGCACCCAGGAGGGGCTAGG - Intergenic
1160225694 18:77009201-77009223 GAGGACAGCCAGGAGGAGAAGGG - Intronic
1160233632 18:77068067-77068089 CTGGGCAGACAGGAGGGGATGGG + Intronic
1160540467 18:79617655-79617677 GAGGGCAGACCGTGGGGTCAGGG - Intergenic
1160846990 19:1170402-1170424 GAGTGCAGAGGCGAGGGGCAAGG + Intronic
1161148826 19:2695861-2695883 GAAAGCAGACAGAAGGGGCCGGG + Intronic
1161203174 19:3027524-3027546 GAGGGCACATAGCAGAGGCAGGG - Intronic
1161220017 19:3114122-3114144 GAGGACGGGCAGGAGGGGCGGGG - Intronic
1161238868 19:3210895-3210917 GAGGACAGACGGGAGTGGCGAGG + Intergenic
1161326766 19:3667892-3667914 GAGGGCAGGCTGGAGTTGCAGGG + Intronic
1161404032 19:4081895-4081917 AAGAGCAGGGAGGAGGGGCAGGG - Intergenic
1161621371 19:5299083-5299105 GAGGACAGACTGGAGGGCGAGGG - Intronic
1161790667 19:6357984-6358006 CAGGGCAGGCAGGGGGTGCAGGG + Intergenic
1161811833 19:6475808-6475830 GAGGGCAGCTGGGAGGGGCAGGG - Intronic
1161954070 19:7483164-7483186 GAAGTCAGAGAGGAGGGGAAGGG - Intronic
1162030284 19:7914315-7914337 GAGGGCGGACCGGGTGGGCAGGG + Exonic
1162124452 19:8491723-8491745 GAGGGCTGCCATGAGGGGCGTGG - Intronic
1162363182 19:10231454-10231476 GGGGGCCGACAGGAGCTGCACGG + Intergenic
1162419505 19:10558072-10558094 GAGAACAGACAGGTGGGGCCAGG + Intronic
1162496330 19:11025186-11025208 GAGGGCAGATGGCAGGGACAGGG - Intronic
1162529475 19:11227615-11227637 GAGGCTTGACAGGAGGGGCGGGG + Intronic
1162607033 19:11717160-11717182 GAGGACAGGCAGGCGGGGTATGG - Intergenic
1163475600 19:17524220-17524242 GAGGGGATAGAGGATGGGCATGG - Intronic
1163611529 19:18304389-18304411 GAGGAGAGAGAGGAGGGGGATGG + Intergenic
1163613450 19:18312457-18312479 GGGGTCAGTCAGGAGGGACAGGG - Intronic
1163729188 19:18940046-18940068 GGGGGAAGACAGGTGGGGGAGGG + Intronic
1164153171 19:22571708-22571730 GAGGTCAGACATGATTGGCAGGG - Intergenic
1164467758 19:28502231-28502253 GAAGTCAGAGATGAGGGGCATGG + Intergenic
1164476442 19:28579355-28579377 GGGGGCAGAGATGAGGAGCAGGG - Intergenic
1164659487 19:29949922-29949944 GTGGGGAGACGGGAGGGGGAGGG + Intronic
1164834296 19:31347963-31347985 AAGGGCAGAGAGTAGGGTCAGGG - Intronic
1164921791 19:32093818-32093840 GGCTGCAGAGAGGAGGGGCAGGG + Intergenic
1165022338 19:32935117-32935139 GAGGGCAGAAAGGCAGGGCAGGG + Intronic
1165305138 19:34999085-34999107 GAGAACAGACAGTAGGGGCAGGG + Intronic
1165346750 19:35253425-35253447 GAAGGCAGAGAGGAAGGGGAGGG + Intronic
1165888847 19:39098822-39098844 GAAGGCAGACCGAAGGGGCATGG + Intronic
1165927358 19:39335369-39335391 GAGGGCAGATAGGGAGGGCTGGG - Intronic
1166213017 19:41319544-41319566 GAGGAGAGACAGGGTGGGCATGG - Intronic
1166297675 19:41896953-41896975 GAGGAAAGAGAGGAGGGGGAAGG - Intronic
1166728310 19:45042319-45042341 GAGGACAGACTGGAGGAGCCAGG + Intronic
1166793742 19:45413847-45413869 GTGGGAAGGCAGGACGGGCAAGG + Intronic
1166999752 19:46738893-46738915 GAGGGCAGACAGGAGGCAAAGGG + Intronic
1167072465 19:47228653-47228675 ATGGGCACACAGGAGGGACAGGG + Intronic
1167146307 19:47682195-47682217 GAGAGCGGGCAGGAGGGGCGAGG - Intronic
1167486652 19:49766942-49766964 GCGGGCGGAGGGGAGGGGCAGGG + Intergenic
1167572522 19:50297979-50298001 GAGGGCATGGGGGAGGGGCATGG + Intronic
1167578604 19:50329328-50329350 GAGAGCAGGGAGGAGGGGCGGGG + Exonic
1167609715 19:50501275-50501297 GTGGGCGGGCAGGAGGTGCAGGG + Intergenic
1168179477 19:54651059-54651081 GAGGGTGGAGAGGAGGGGGATGG - Intronic
1168332579 19:55578858-55578880 GAGGGCGAACAGGAAGGGGAAGG - Exonic
1168348424 19:55661945-55661967 GAGTGTAGGGAGGAGGGGCAGGG - Intronic
1168520158 19:57043697-57043719 GAGGTCAGTCAGGAGGGTCTGGG - Intergenic
1168573917 19:57492373-57492395 GAGGACAGAGAGGTGGGGAATGG - Intronic
1168578462 19:57533744-57533766 GAGGGCATACAGGAGAATCAAGG - Intronic
925077068 2:1025678-1025700 GAGAGGGGACAGGAGGGCCAGGG - Intronic
925144841 2:1574324-1574346 CAGGGCAGACAGGCGGTGAAGGG + Intergenic
925167819 2:1729331-1729353 GAGGGCTGAAGGGAGGGTCAGGG - Intronic
925212331 2:2060679-2060701 AAGGGCAGAGAGGAGGGGAGGGG - Intronic
925242825 2:2347605-2347627 GAGGGCAGGCAGGTGGGTCCAGG - Intergenic
925379678 2:3416564-3416586 GAGGGCACAGTGAAGGGGCAGGG - Intronic
925379686 2:3416587-3416609 GAGGGCATAGTGAAGGGGCAGGG - Intronic
925379695 2:3416611-3416633 GAGGGCACAGTGAAGGGGCAGGG - Intronic
925379703 2:3416634-3416656 GAGGGCACAGTGAAGGGGCAGGG - Intronic
925379712 2:3416658-3416680 GAGGGCACAGTGAAGGGGCAGGG - Intronic
925379728 2:3416704-3416726 GAGGGCACAGTGAAGGGGCAGGG - Intronic
925379737 2:3416728-3416750 GAGGGCACAGTGAAGGGGCAGGG - Intronic
925379755 2:3416774-3416796 GAGGGCACAGTGAAGGGGCAGGG - Intronic
925379764 2:3416798-3416820 GAGGGCACAGTGAAGGGGCAGGG - Intronic
925379782 2:3416844-3416866 GAGGGCACAGTGAAGGGGCAGGG - Intronic
925379791 2:3416868-3416890 GAGGGCACAGTGAAGGGGCAGGG - Intronic
925379800 2:3416892-3416914 GAGGGCACAGTGAAGGGGCAGGG - Intronic
925384726 2:3454233-3454255 GAGGGCACACAGGTAGGACACGG - Intronic
925434772 2:3827294-3827316 AAGGGGAGGCAGCAGGGGCAGGG + Intronic
925593728 2:5535076-5535098 GAGGGCATACTTGAGGGGGAAGG + Intergenic
925611676 2:5706762-5706784 AAGGGCGGGCAGGTGGGGCACGG + Intergenic
926122864 2:10254270-10254292 GAGGGCTGACGGGTGGGGCTGGG + Intergenic
926125299 2:10268114-10268136 GGGGGCCCACAGGAGGGGCGAGG + Intergenic
926249640 2:11147038-11147060 GAGGGCAGTGAGGAGGGCCAGGG + Intergenic
927253583 2:21019987-21020009 GAGGGAAGACAGGAGGATAAGGG - Intronic
927514759 2:23665709-23665731 GAGGGCAGACAGAAGAGAGAGGG + Intronic
927552207 2:24010274-24010296 GGGGGCAGCCCGGAGGGGCTCGG + Intronic
928028288 2:27757307-27757329 GAGGGCACCCAGGAGTGGGATGG + Intergenic
928589891 2:32803281-32803303 GAGAGCAGACAGCAAGGGCTTGG - Intronic
928916911 2:36481899-36481921 GAGGGCAGTCAGCGGAGGCAAGG + Intronic
930000245 2:46856475-46856497 GGGGGCAGCCTGGTGGGGCAGGG - Intronic
930026234 2:47030700-47030722 GAGGGGGAACAGGCGGGGCAGGG - Intronic
930302206 2:49630628-49630650 AAGGGCAGAGAGAAGGGGAAGGG + Intergenic
930752261 2:54945224-54945246 GAGGGGAGAGAGAAGGGGGAGGG - Intronic
930752270 2:54945254-54945276 GAGGGGAGAGAGAAGGGGGAGGG - Intronic
931732425 2:65165132-65165154 CAGAGCAGAAAGGAGGAGCAAGG - Intergenic
931795280 2:65702378-65702400 GGAGGGAGAGAGGAGGGGCAAGG + Intergenic
931869524 2:66443870-66443892 GAGGGAAGACAGGAGAGGAGAGG - Intronic
932144160 2:69304436-69304458 GAGGGCAGGCAGTTGGGGAAGGG + Intergenic
932301237 2:70668328-70668350 AGCGGCAGACAGGAGTGGCATGG - Intronic
932307713 2:70715755-70715777 GGGGGCAGAGAGGAGGGGGCTGG - Intronic
932528056 2:72494331-72494353 GAGGCCAGGCAGGTGGGGGATGG + Intronic
932610018 2:73191950-73191972 CAGGGGAAGCAGGAGGGGCAGGG + Intergenic
932706064 2:74026049-74026071 TAAGGCAGAGAGGTGGGGCAGGG + Intronic
932770543 2:74498542-74498564 GAGGGCATATTGTAGGGGCAAGG + Intronic
932842413 2:75095814-75095836 AAGGGCACACAGAAGGGACAGGG - Intronic
933780849 2:85799854-85799876 CAGGGCAGGCAGGTGGGGCGGGG - Intergenic
933936573 2:87208936-87208958 GAGGGGAGGGAGGAGGGGAAGGG - Intergenic
933947466 2:87299002-87299024 AAGGAGAGACAGAAGGGGCATGG - Intergenic
934046648 2:88178301-88178323 GAGGGCAGACCACAGGGGAATGG + Intronic
934738677 2:96703471-96703493 GAGTGCAGACAGCAGGAGCCGGG - Intergenic
934859891 2:97755702-97755724 GAGGGAAGACAGCAGGGACTCGG - Intergenic
934947984 2:98555757-98555779 GAGGGCATGGTGGAGGGGCATGG - Exonic
935060405 2:99602088-99602110 GAGGGCTGTCAGGAAGGGCACGG + Intronic
935259760 2:101344096-101344118 CAGGGCAGGCAGGAGGAGGAAGG + Intergenic
935308365 2:101759563-101759585 GAGGGGAGAGAGGAGGGGAATGG - Intronic
935319017 2:101867112-101867134 GTGGGCAGACAGGAGTGGGCGGG + Intronic
935388240 2:102523706-102523728 GAGGTGAGACTGGAGGGGCATGG - Intronic
935595093 2:104872206-104872228 GGGAGCGGACAGGAGGAGCAGGG - Intergenic
936332729 2:111562565-111562587 AAGGAGAGACAGAAGGGGCATGG + Intergenic
936356571 2:111756890-111756912 GAGGGGAGGGAGGAGGGGAAGGG + Intergenic
936401951 2:112171340-112171362 GAAAGGAGACAGGAGGGGCCGGG + Intronic
936458427 2:112693154-112693176 GAGGGCAGGCAGGAGAGCCCTGG + Intergenic
937863859 2:126733318-126733340 GAGGGCAGGGAGGAGGGGGCAGG + Intergenic
937886842 2:126905671-126905693 GAGGGCGGAGAGGAAGGGGAGGG - Intergenic
937919998 2:127122214-127122236 GAGGGCAGGTTGGAGGGGGAAGG - Intergenic
937968736 2:127534131-127534153 GGGGTCAGACTGGAGGGGCCAGG - Intergenic
938314712 2:130317702-130317724 GAGGGAAGGCATGAGGGGGAGGG - Intergenic
938388205 2:130882783-130882805 GGGTGCAGGCAGGAGGGCCAGGG + Intronic
938560851 2:132470734-132470756 CAGGGGAGACAGGGAGGGCACGG + Intronic
939606591 2:144262606-144262628 GAGGGGAGATAGGAGAGGAAGGG + Intronic
940329081 2:152455152-152455174 GAGGTCAGGCAGGGAGGGCAAGG + Intronic
940656155 2:156489921-156489943 GAGGGAAGAAAGGAGGGGAGGGG - Intronic
942135976 2:172925938-172925960 GAGGGAAGGAAGGAGGGGGAGGG + Intronic
942449734 2:176101288-176101310 CAGGGCAGACAGGAGGGTGGAGG - Intergenic
944192429 2:197017887-197017909 TAGGGCAGCAAGGAGGGGAAGGG - Intronic
945035026 2:205697200-205697222 GAGGGGAGGCAGGAAAGGCAGGG + Intronic
945205712 2:207329680-207329702 GAAGGAAGAAAGGAGGGGTATGG + Intergenic
945655376 2:212616613-212616635 GAGGGGAGAGAGGAGGGGAAGGG - Intergenic
945655391 2:212616647-212616669 GAGGGGAGAGAGGAGGGGAAGGG - Intergenic
945829213 2:214763045-214763067 GAGGCCAGAGAAGATGGGCAGGG - Intronic
945992817 2:216410727-216410749 GTTGGGAGACAGGAAGGGCAGGG + Intergenic
947331653 2:229035334-229035356 GTGGGCAGACAGGAGATCCAGGG - Intronic
947491463 2:230598759-230598781 GAGGGGAGGGAGGAGGGCCAGGG + Intergenic
947520537 2:230842665-230842687 GAAGGAAAACAGGTGGGGCAAGG - Intergenic
947594048 2:231399840-231399862 GAGGGAAGGGAGGAGGGCCAGGG - Exonic
947789596 2:232856880-232856902 GTCGGCAGACAGGAGAGGGATGG - Exonic
948118492 2:235511395-235511417 GGGGGCAGCCAGGAGCCGCAGGG + Intronic
948221189 2:236270971-236270993 GAGGGAAGAGAAGAGGGGCAAGG + Intergenic
948422072 2:237865771-237865793 GAGGCCAGAGAGGACGGCCAGGG + Intronic
948544371 2:238716634-238716656 GAAGACAGACTGGAGGCGCATGG - Intergenic
948657764 2:239487202-239487224 AAGGGCTGAAAGGAGGGACACGG + Intergenic
948743009 2:240060507-240060529 GTGGGCAGGCAGGTGGGCCATGG - Intergenic
948949099 2:241237239-241237261 TAGGGGAGACAGAAAGGGCAAGG + Intronic
949041651 2:241852416-241852438 GAGGGCAGACTAGAGGGGCTGGG + Intronic
1168830415 20:842343-842365 GAGGTCAGACGGGCGGGGCCGGG - Intronic
1169084144 20:2816474-2816496 GGGGGCAGAGAGGGGGTGCAGGG - Intronic
1169331938 20:4723010-4723032 AAGGGAAGACAGGAGGGCCTGGG - Intronic
1169657669 20:7942965-7942987 GAAGGCAGCCAGGCCGGGCACGG - Intergenic
1169773760 20:9229847-9229869 GAGGGCAGGAAGTAGGGGGAGGG - Intronic
1170030117 20:11935749-11935771 GAGAGGAGTCAGGAGGGGCCTGG - Intergenic
1170075831 20:12417735-12417757 CAGTGCAGACAGCAGGGGCTGGG - Intergenic
1170664705 20:18376288-18376310 GACGGGAGACGGGAGGGGGAGGG + Intergenic
1170715452 20:18827407-18827429 GATGAGAGACTGGAGGGGCAGGG - Intronic
1171245831 20:23608767-23608789 AAAGGAAGACAGCAGGGGCAGGG + Intergenic
1171249663 20:23638158-23638180 CAGGGAAGCCTGGAGGGGCAGGG - Intronic
1171465274 20:25323664-25323686 GAGGCCAGCCAGCATGGGCAGGG + Intronic
1171869580 20:30514301-30514323 GAGAGTGGACAGGAGTGGCAGGG - Intergenic
1171971450 20:31567440-31567462 GAGGGCAAACAGTGGGGGCAGGG - Intronic
1172050082 20:32110349-32110371 GAGAGAAGACAGGAAGGGCAGGG - Intronic
1172272894 20:33664328-33664350 GATGGCAGTCAGCTGGGGCAAGG + Intronic
1172409666 20:34711680-34711702 TGGGGGAGACAGAAGGGGCAGGG + Exonic
1172485587 20:35296116-35296138 GAGGGCAGACAGGTGGCTCCCGG + Intergenic
1172656293 20:36540862-36540884 TTGGGCAGACAGGAGGTGCAGGG - Intergenic
1172692043 20:36796752-36796774 GAGGGCAAAGGGGCGGGGCAGGG + Intronic
1172700595 20:36851555-36851577 CAGGGCAGAGATGGGGGGCAGGG - Intronic
1173082115 20:39878067-39878089 CAGGGCAGACAGGAGTAGCCAGG + Intergenic
1173416842 20:42864345-42864367 GAGGGGAGAGAGGAGAGGGATGG + Intronic
1173484863 20:43433532-43433554 GAGGAAAGAAAGGAGGGGAAGGG + Intergenic
1173847596 20:46197901-46197923 GAGGGCTGGCAGGAGGAGCTTGG + Intronic
1173896475 20:46554874-46554896 CAGGGCAGGGAGGAGGAGCATGG - Intergenic
1173903886 20:46611748-46611770 GAGGTCAGACAGGAGGGTACGGG - Intronic
1173957013 20:47041104-47041126 GCGGGCTGGCAGGAGGAGCAGGG - Intronic
1174229950 20:49038377-49038399 GTGGACAGACACGAAGGGCATGG + Intergenic
1174400841 20:50275059-50275081 GGCTGCAGACAGGATGGGCAAGG - Intergenic
1174554003 20:51381157-51381179 GAGGACAGGCAGAAGGGGAAAGG + Intergenic
1174776249 20:53345733-53345755 GAGGGAGGGGAGGAGGGGCAGGG - Intronic
1174905246 20:54543607-54543629 GAGGAGAGAGAGGAGGGGAAGGG + Intronic
1174983912 20:55428201-55428223 GAGGGGAGACAGGAAGAGGAAGG + Intergenic
1175045586 20:56101911-56101933 GAAGGAAAACAGGAGGGGGAAGG + Intergenic
1175131855 20:56795253-56795275 GAGGGGAAACAGGCTGGGCATGG - Intergenic
1175412203 20:58777739-58777761 CAGGGCAGGCAGCAGGGGCCAGG - Intergenic
1175829032 20:61952007-61952029 CAGGGCAGACAAAAGAGGCATGG + Intergenic
1175872961 20:62217037-62217059 GAGGGAGGACAGGAGGGGAAAGG - Intronic
1176018852 20:62952651-62952673 CAGGGCGGGCAGGCGGGGCAGGG - Exonic
1176033148 20:63023541-63023563 GGGGACAGAAAGGAGAGGCATGG - Intergenic
1176084203 20:63288650-63288672 GTGGCCAGGCAGGAGGGGCCGGG + Exonic
1176104487 20:63379521-63379543 GAGGCCAGGCAGCGGGGGCAGGG - Intergenic
1176119384 20:63447120-63447142 GAAACCAGACAGAAGGGGCAGGG - Intronic
1176125478 20:63472862-63472884 GAGGGGAGACAGGAGGGGAGGGG + Intergenic
1176125507 20:63472934-63472956 GAGGGGAGACAGGAGTGGAGGGG + Intergenic
1176266930 20:64214531-64214553 GAAGCCAGGCAGGATGGGCAGGG - Intronic
1176301619 21:5101514-5101536 GAGGGCAGGGACGTGGGGCAGGG + Intergenic
1176309379 21:5141710-5141732 GAGGCAGGACAGGAGGGGCAGGG + Intronic
1178337861 21:31759857-31759879 GAGAGGAGAGAGGAGGGGAAGGG - Intergenic
1178672096 21:34600481-34600503 GAAGGGAGAAAGGAGGGGAAGGG + Intronic
1178723048 21:35027122-35027144 AAGGGCAGGGTGGAGGGGCAGGG + Intronic
1179084973 21:38207935-38207957 GAGGGCAGAGGGGAGGGGAGAGG - Intronic
1179488921 21:41727919-41727941 CAGCGCAGACAGGAAGAGCACGG + Intergenic
1179502338 21:41818071-41818093 GCGTAGAGACAGGAGGGGCAGGG - Intronic
1179612310 21:42560260-42560282 GAGGGCTGAGAGCAGGGGCGTGG + Intronic
1179646925 21:42781940-42781962 GAGGGGAGGGAGGAGAGGCAGGG - Intergenic
1179646971 21:42782055-42782077 GAGGGGAGAAAGGAGAGGCAGGG - Intergenic
1179655172 21:42840038-42840060 GGGGGCAGATGGGAGGGGCTGGG + Intergenic
1179847682 21:44120323-44120345 GAGGCAGGACAGGAGGGGCGGGG - Intronic
1179855412 21:44160385-44160407 GAGGGCAGGGACGTGGGGCAGGG - Intergenic
1179951563 21:44711503-44711525 CAGGGCAGACATGAGGGGCTTGG + Exonic
1180220349 21:46354630-46354652 GAGGGCAGGGAGGAGACGCAGGG + Intronic
1180800085 22:18627663-18627685 GAGGGCGGGCACAAGGGGCAGGG - Intergenic
1180903642 22:19393006-19393028 GAGGGCAGGCAGGAATGGCCGGG + Intronic
1180927681 22:19567383-19567405 GGGGTCAGAGAGGAGAGGCAGGG + Intergenic
1180940346 22:19656682-19656704 GAGGGCAGTCTGGCGGGGCACGG + Intergenic
1180957412 22:19747197-19747219 GTGGGCATGCAGGAGGGCCAGGG - Intergenic
1181465160 22:23106955-23106977 GAGGGCAGACAGGACTGCCCAGG + Intronic
1182356321 22:29723749-29723771 GAGGCCAGAGTGGTGGGGCACGG + Intronic
1182363547 22:29762777-29762799 GACGGGATACAGGAGGGGGATGG - Intronic
1182374774 22:29838413-29838435 GAAGGGAGATAGGAGGGGAAGGG - Intergenic
1182520315 22:30881211-30881233 GGGGGTAGGCAGAAGGGGCAGGG + Intronic
1182573211 22:31254606-31254628 GAGGGCTGGCAGTAGGAGCAGGG - Intronic
1182623437 22:31630201-31630223 GAGGGCAGGCAGGACTCGCAGGG + Intronic
1182779924 22:32859386-32859408 GAGGGAAGTGAGGTGGGGCAGGG - Exonic
1182876360 22:33694707-33694729 GTGGAGAGACAGGAGGGGGAAGG + Intronic
1183019884 22:35018547-35018569 GAGGGCAGACAGCAGGGATATGG - Intergenic
1183186680 22:36295450-36295472 GAGGGCAGCCAGGGGGGCCTTGG - Intronic
1183232441 22:36591382-36591404 GAGGGAAGAAGGGAGGGGCTGGG + Intronic
1183392227 22:37552232-37552254 GGGTGGAGAGAGGAGGGGCATGG - Intergenic
1183487461 22:38097264-38097286 GAGGGCAGTCAGGAAGAACAGGG - Intronic
1183546939 22:38459362-38459384 GAGGGCTGAGAGGAGTGGAAGGG + Intergenic
1183734188 22:39634838-39634860 GAGGTCAGGTAGGAGGGGAAAGG + Intronic
1183848432 22:40562652-40562674 GAAGGCAGAAAGGAGGGAAAGGG + Intronic
1183957763 22:41392230-41392252 AATGGCAGCCAGGTGGGGCAGGG + Intronic
1184120120 22:42444588-42444610 GAGGCCGGACAGGAAGGGCCAGG + Intergenic
1184149891 22:42631740-42631762 GATGCCAGACAGGACGGGGAGGG + Intronic
1184240676 22:43209928-43209950 CAGGGCAGAGAGGAGGGCCCTGG - Intronic
1184389499 22:44195124-44195146 GAAAGGAGAAAGGAGGGGCAAGG + Intronic
1184693711 22:46128669-46128691 GTGGACAGACAGGAGGAGCGAGG - Intergenic
1185062152 22:48612656-48612678 GAGGGCAGACACTCGGGGAAAGG - Intronic
1185105968 22:48870055-48870077 CAGGGCAGAGAGAAGGGGAATGG - Intergenic
1185128194 22:49023300-49023322 CAGGGTAGACAGGAGGGGAGAGG + Intergenic
1185249223 22:49791011-49791033 CAGTGCAGTCAGGAGGAGCAGGG - Intronic
1185299632 22:50072605-50072627 GAGGGCTGACTGCAGGGACAGGG + Intronic
1185305708 22:50114695-50114717 GAGGGCGGGCAGCAGGGGCCAGG + Intronic
1185330590 22:50250534-50250556 ATGGGCAGGCAGGAGAGGCAGGG + Intronic
1185338336 22:50280697-50280719 GAGGGCACACAGGTGGCGCCGGG - Intronic
949977031 3:9470382-9470404 AAGGGCAGAAAGGAGGGGAGAGG - Intronic
950105588 3:10386330-10386352 GAGGGCACAAAGGAGGGTCTGGG + Intronic
950138929 3:10601868-10601890 GAGGGTAGGGAGGAGGGCCATGG - Intronic
950453398 3:13078447-13078469 GAGGGGAGAAAGGAGGGGTATGG - Intergenic
950508017 3:13407727-13407749 GGGAGCTGATAGGAGGGGCATGG - Intronic
950544351 3:13629791-13629813 GAGGGCAGGCAGCAGGTACAGGG - Intronic
951420786 3:22482357-22482379 GAGGGAAGGCAGGAGGGGTGTGG - Intergenic
951706847 3:25552243-25552265 GTGGGCAAACAGGCTGGGCAAGG + Intronic
952132002 3:30374684-30374706 GAGGGAACACAGGAGTGGCAGGG + Intergenic
953576958 3:44120624-44120646 GAGAGCAAACAGAATGGGCAAGG + Intergenic
953916095 3:46922148-46922170 GATGGCAGACAGAAGGGGTGGGG + Intronic
954036025 3:47851701-47851723 GAGGGGAGGGAGGAGAGGCAAGG - Intronic
954039575 3:47874645-47874667 GAGGGCAGAGGGGAGGTGCCTGG - Intronic
954145429 3:48632058-48632080 AGGGGCAGTCAGGAGAGGCAGGG + Intronic
954297229 3:49681036-49681058 GTGGGCAGAAGGGAAGGGCAGGG + Intronic
954329511 3:49882086-49882108 GGGGTCAGACAGGGGGGCCATGG - Intergenic
954420501 3:50416543-50416565 GAGGGCAGACAGGAATGGTGGGG + Intronic
954538605 3:51379500-51379522 ATGGGCAGACAGGAAGGGCTGGG - Intronic
954626159 3:52023017-52023039 CAGGGCAGACAGGAGCTGCAGGG - Intergenic
954912732 3:54122513-54122535 GAGGGCGGAGAGGAGAGGGAGGG - Intergenic
955592353 3:60551495-60551517 GAGGGGAGACGGGAGGGGGAGGG + Intronic
955592378 3:60551547-60551569 GAGGGGAGACGGGAGGGGGGAGG + Intronic
955758250 3:62249297-62249319 GAGGGCAGACAGGAGGGGCAGGG + Intronic
956554130 3:70498922-70498944 GAAGGAAAACAGGAGGGGCAAGG - Intergenic
956684576 3:71812907-71812929 GATGGCAGGGTGGAGGGGCAGGG + Intergenic
957733602 3:84177521-84177543 GAGGGCAGAGAGTAGGAGGAAGG + Intergenic
959153687 3:102639887-102639909 GAGAACAGACTGGAGGTGCAGGG + Intergenic
959584725 3:108015422-108015444 CAGGGCATGCAGGAGGGGCATGG - Intergenic
959925421 3:111915846-111915868 TAGGGAAGAAAGTAGGGGCAGGG + Intronic
960084474 3:113575904-113575926 CAGGGCACATTGGAGGGGCAGGG + Intronic
960694568 3:120383449-120383471 GGAGGCAGAGAGAAGGGGCAGGG + Intergenic
960711881 3:120538386-120538408 GAGGGCAGGCAGGGTGGGAAGGG - Intergenic
960972497 3:123149882-123149904 GGGGGCAGAAAGGAGGGGCCTGG + Intronic
961377649 3:126476996-126477018 GAGGGCAAACAGGTAGGGGAGGG - Intergenic
961478143 3:127161375-127161397 GAGAGCAGACAGAAGGGGCCAGG - Intergenic
961482592 3:127193534-127193556 GGGGGCAGGCAGGAGGGTCCTGG - Intronic
961629476 3:128285492-128285514 GAGGGGAGTGAGGAGGGCCAGGG + Intronic
962134878 3:132722579-132722601 GCGGGGAAACAGGAGGGGCGGGG + Intergenic
962257676 3:133883602-133883624 GAGGGCAAACAGGGGAAGCAAGG - Intronic
962298873 3:134219210-134219232 GAGAGCAGGTAGGAGGGGCTCGG - Intronic
962498306 3:135965280-135965302 GTGGGAAGACAGGAGCGCCAGGG + Intergenic
962572445 3:136724160-136724182 GAGGGGAGAAAGGCGGGGAAAGG + Intronic
962600719 3:136989059-136989081 AAGTGGTGACAGGAGGGGCATGG + Intronic
962867316 3:139458420-139458442 TGGGGCAGACAGTAAGGGCAGGG - Intronic
962875238 3:139530975-139530997 CAGGGCAGGCAGCAGGGACAAGG + Intronic
962916716 3:139911190-139911212 GAGGGCAGAGATGAGAGGTAAGG + Intergenic
962932087 3:140048070-140048092 GAGGGGAGAAAGGAGGAGGAAGG + Intronic
963119622 3:141765009-141765031 GATCACAGACAGAAGGGGCAAGG - Intergenic
963265722 3:143238426-143238448 GAGGGTAGAGCAGAGGGGCAGGG - Intergenic
964186782 3:153955022-153955044 GCAGGAAGACAGGAGGGGGAGGG + Intergenic
964186986 3:153957980-153958002 GAGGGAAGACAGGAGAGGAGAGG - Intergenic
964756103 3:160092094-160092116 AAGGTCAGACAGCAAGGGCAGGG - Intergenic
965008492 3:163056438-163056460 GAGAGCAGAAAGGAGGAGAAGGG - Intergenic
965634314 3:170766195-170766217 AAGGGGAGACAGGAGTGGCTGGG - Intronic
966862749 3:184239661-184239683 GAGGCAAGACAGCAGGGGCATGG - Intronic
966863549 3:184243805-184243827 GAGGGCAAACAGCAGGAGCAGGG + Exonic
966921807 3:184616975-184616997 GAAGCAAGACAGGCGGGGCATGG + Intronic
967206312 3:187125657-187125679 GAAGGAAGACAGGAGAGGCAAGG - Intronic
967392708 3:188972831-188972853 GAGGTCAGAGAGGAGGAGAAAGG - Intronic
967997843 3:195180135-195180157 GGGAGCAAACAAGAGGGGCAGGG + Intronic
968046626 3:195627677-195627699 GCCGGCAGCCTGGAGGGGCAGGG + Intergenic
968454080 4:688496-688518 GAGGGCACACAGGGCGGGAAAGG + Intronic
968547433 4:1206183-1206205 GGGGGCACACATGAGGAGCAGGG - Intronic
968613612 4:1567787-1567809 GAGGGGAGGCTGGAGGGGCCGGG - Intergenic
968616163 4:1578809-1578831 GAGGGGAGAGAAGAGGGGGAGGG + Intergenic
968616170 4:1578827-1578849 GAGGGGAGAGAAGAGGGGGAGGG + Intergenic
968616177 4:1578845-1578867 GAGGGGAGAGAAGAGGGGGAGGG + Intergenic
968616184 4:1578863-1578885 GAGGGGAGAGAAGAGGGGGAGGG + Intergenic
968616191 4:1578881-1578903 GAGGGGAGAGAAGAGGGGGAGGG + Intergenic
968616198 4:1578899-1578921 GAGGGGAGAGAAGAGGGGGAGGG + Intergenic
968752405 4:2396825-2396847 GAGGGCGGACAGCTGGGGGAGGG + Intronic
968915347 4:3494835-3494857 TAGGGGAGACAGGCAGGGCAGGG - Intronic
969075135 4:4572275-4572297 GAGGCCAGGCAGGATGAGCAGGG - Intergenic
969112979 4:4855111-4855133 GAGAGCAGACAGTGGGGGAAGGG + Intergenic
969226502 4:5801925-5801947 GAGGGAAGAAAGGAAGGACAGGG - Intronic
969690495 4:8701552-8701574 GAGGGAAAACAGGAGGAGCTGGG + Intergenic
969885243 4:10209440-10209462 GAAGGGAGACAGGATGGGGAAGG + Intergenic
970401399 4:15720969-15720991 CAGGGCAGCCGTGAGGGGCAAGG - Intronic
970608876 4:17707540-17707562 GGGAGCAGAGAGGAGGGGCAGGG - Intronic
971243959 4:24912492-24912514 GCGGGCAGGCAGGTGGGGCTTGG + Intronic
971262497 4:25069839-25069861 GAGGGCAGAAAGGAAGCCCAGGG + Intergenic
971473943 4:27055201-27055223 GAAGGCAGATGGGAGGGACAAGG + Intergenic
971664707 4:29467454-29467476 CAGGGCAGACAGGAGGAGCTGGG + Intergenic
972127619 4:35789218-35789240 CAGGGGAGAGAGGAGGGGAAGGG + Intergenic
972364609 4:38362602-38362624 GAGGTCAGTCAAGAAGGGCATGG + Intergenic
972698617 4:41472348-41472370 GAGGGAGGAAGGGAGGGGCAGGG - Intronic
974524952 4:63038832-63038854 AAGAGCAGACAGGAGGGGAAGGG + Intergenic
975623172 4:76314942-76314964 GTGGGCAGACAGGAAGGGGCAGG + Intronic
975830498 4:78363499-78363521 GATGGCAGTCTGGAGGGGGAAGG - Exonic
976364860 4:84221961-84221983 GAGAGAAGTCAGAAGGGGCAGGG + Intergenic
977997669 4:103514804-103514826 GAGTGCAGACTGGAAGGGGAAGG + Intergenic
978016236 4:103749833-103749855 GAAGGAAAACAGGAGGAGCAGGG - Intergenic
979469281 4:121074753-121074775 GAGGGTAGACAGGAGCTGGAAGG + Intergenic
979506404 4:121502617-121502639 GAGGGAAGGAAGGAGGGGGAGGG - Intergenic
979774594 4:124573357-124573379 GAGGGCAGAAAGAAGGGACGTGG + Intergenic
979977477 4:127214461-127214483 TAGGGAAAAAAGGAGGGGCATGG + Intergenic
980070091 4:128234727-128234749 CATGGCAGAAAGGATGGGCAAGG + Intergenic
980281743 4:130731978-130732000 GAGGGCAAACGGGACAGGCAGGG + Intergenic
980896925 4:138868967-138868989 GAGGGGAGAGAGGAGGGGAGTGG + Intergenic
980981792 4:139660602-139660624 GATGGCAGAGAGAATGGGCAGGG + Intergenic
981177903 4:141703215-141703237 GAGGGCAGACGAGAGGAGGAGGG - Intronic
982115675 4:152096563-152096585 GAAGGAAAACAGGAGGGGCTAGG + Intergenic
982276618 4:153642216-153642238 GAAGGAAAACAGGCGGGGCAAGG - Intergenic
982710691 4:158755956-158755978 CAGGCCAGAGAGGAGGGGGAGGG - Intergenic
983654203 4:170065030-170065052 GAGGGAAGAAGGGAGGGGTAGGG + Intronic
984640876 4:182163136-182163158 GAGGATGGAAAGGAGGGGCAAGG - Intronic
985314674 4:188643940-188643962 GAGGGGAGACAGGAGGAACATGG - Intergenic
985552076 5:538802-538824 TTGGGCTGGCAGGAGGGGCACGG + Intergenic
985605738 5:857273-857295 GGGGGCAGACAGGAGGCGCCTGG - Intronic
985626962 5:994085-994107 GAGGGGAGAGAGGAGAGGAAAGG + Intergenic
985650217 5:1104087-1104109 GAGGGGACCCAGGAGGGGCCTGG + Intronic
985652222 5:1112409-1112431 AAGGGCGTGCAGGAGGGGCAGGG - Intergenic
985658057 5:1142297-1142319 GAGGGGAGACGGGAGGGGCGAGG - Intergenic
985680878 5:1254973-1254995 CAGGGCAAACAGGAGAGGCCAGG + Intronic
985805058 5:2037697-2037719 GAGGGGAGAGAGGAGGGGAGAGG - Intergenic
986010443 5:3709854-3709876 GAGGAAAGACAGGAGGGGGCCGG - Intergenic
986251001 5:6058595-6058617 TTGGGCAGACAGGAGGCGGAAGG - Intergenic
986689976 5:10306362-10306384 GGGGGCAGAGAGGAGGAGGAGGG + Intronic
986787063 5:11124165-11124187 GAGAGCAGGCAGGAGAGGCTGGG - Intronic
987059224 5:14226101-14226123 GAGCTCACACAGGAGAGGCAAGG + Intronic
987373697 5:17216652-17216674 GAGGGAAGAGAAGAGGGGAAAGG - Intronic
987449813 5:18068850-18068872 TAGTGCAGATAGGAGGGGCCAGG - Intergenic
988607339 5:32690180-32690202 GAGGGCAGGAAGGAGGGATAAGG - Intronic
990201158 5:53376372-53376394 GAGAGAAGAGAGGAGGGGAAGGG + Intergenic
990725134 5:58745012-58745034 GAAGGCAGAGAGGAAAGGCAAGG - Intronic
990863731 5:60357094-60357116 GAAAGCAGACAGAAAGGGCAAGG + Intronic
990990026 5:61675412-61675434 GTGGCCAGGGAGGAGGGGCAGGG - Intronic
991021079 5:61980755-61980777 GAGGGCAGGTAGCAGGTGCATGG + Intergenic
991247791 5:64526190-64526212 AAAGGAAAACAGGAGGGGCAAGG + Intronic
991476215 5:67022536-67022558 GGAGGCAGGCAGCAGGGGCAAGG + Intronic
991638816 5:68733324-68733346 CTGGGCAGGCAGGTGGGGCAAGG - Intergenic
992074266 5:73176455-73176477 GAGGGCAGGAGGGAGGGGCCTGG + Intergenic
992700208 5:79334320-79334342 GAGGGCAGCCAGGAGTCTCACGG - Intergenic
992804669 5:80324936-80324958 GAGAGAAAAAAGGAGGGGCACGG - Intergenic
995016711 5:107318219-107318241 GAGGTCAGACTGGAGTAGCATGG + Intergenic
996179347 5:120399916-120399938 GAAAGCAGCCAGGAGGGGGATGG + Intergenic
997472568 5:134124962-134124984 GAGGTCACACAGCAGGGGGAGGG - Intronic
997722944 5:136095077-136095099 GAGTGCAGAGAGGATGAGCAGGG - Intergenic
997964077 5:138344249-138344271 GAGGGCAAACAGGGTGGGGAAGG - Intronic
998028014 5:138837501-138837523 GAGGGGAGGGAGGAGGGGGAGGG - Intronic
998190675 5:140021641-140021663 GAGTTCAGACAGAAGGGCCATGG + Intronic
998407579 5:141882816-141882838 GAGGGGAGACAGGAGCAGGAAGG + Intergenic
998979756 5:147689224-147689246 GAGGGCAGACAGTAATGGGAGGG + Intronic
999189966 5:149739881-149739903 GAGCTCAGAGAGGAGGGGCCTGG + Intronic
999427399 5:151499910-151499932 CAGGCCAGAAGGGAGGGGCAGGG - Intergenic
999614364 5:153406444-153406466 GAGTGCAGCCTGGATGGGCAAGG + Intergenic
999672815 5:153972507-153972529 GAGGGCACACAAGAAAGGCAGGG + Intergenic
999808500 5:155106374-155106396 GGGGGCAGAGGGGATGGGCAGGG + Intergenic
1001403670 5:171461204-171461226 GAGGGCAGTGGGGAGGGGGAGGG + Intergenic
1001403679 5:171461222-171461244 GAGGGCAGTGGGGAGGGGGAGGG + Intergenic
1001403687 5:171461240-171461262 GAGGGCAGTGGGGAGGGGCAGGG + Intergenic
1002181415 5:177432924-177432946 CAGGTCACACAGCAGGGGCAAGG - Intronic
1002193156 5:177489325-177489347 GTGGGCAGACAGGTGGGGCTGGG + Intronic
1002193676 5:177491321-177491343 GAGGGCAGCCAGGGTGGGGAGGG + Intronic
1002327618 5:178420352-178420374 GAGGAAAGAGAGGAGGGGCAGGG - Intronic
1002327732 5:178420651-178420673 GGGGAAAGAGAGGAGGGGCAGGG - Intronic
1002467404 5:179414459-179414481 GTGGCCCGACAGCAGGGGCAAGG - Intergenic
1002535666 5:179874154-179874176 GAGTGTAGCCAGGAGGGGCCGGG + Intronic
1002575595 5:180172150-180172172 TAGGCCAGGCAGGACGGGCAGGG + Intronic
1002704517 5:181151260-181151282 GAGGGCAGACAGCTGCGGGAGGG + Intergenic
1002915691 6:1526185-1526207 GTGGACAGACAGGTGGGGCTGGG - Intergenic
1003072102 6:2952927-2952949 GATGTCAAGCAGGAGGGGCAGGG + Intronic
1004002237 6:11605995-11606017 GAATGCAGGCAGGTGGGGCAGGG + Intergenic
1004094263 6:12537551-12537573 TAGGGCAGACTCGAGGGACAAGG - Intergenic
1004364613 6:15001116-15001138 GAGGGGAGGCAGGAGAGGCAGGG + Intergenic
1004653065 6:17630717-17630739 GAGGGGAGACAAGAGGGGAGAGG + Intronic
1004764736 6:18713464-18713486 GAGGGGAGACACGAGGAGAAAGG + Intergenic
1004947940 6:20636146-20636168 CAGGGGAGACAAGAGGGACAAGG + Intronic
1006107912 6:31727908-31727930 TAGGACAGATAGGAGGGGCTGGG - Intronic
1006152326 6:31996167-31996189 GATGTCAAACAGGAGGGGGAAGG - Intronic
1006158627 6:32028905-32028927 GATGTCAAACAGGAGGGGGAAGG - Intronic
1006193287 6:32222476-32222498 GGGGGCAGCCAGGAGGGGACAGG - Intronic
1006322580 6:33328960-33328982 GAGGGGAGACAGGAGGGAAATGG - Intronic
1006382095 6:33704915-33704937 CAGGACAGACAGGAGGGGCATGG + Intronic
1006385564 6:33728887-33728909 AAGGGCAGACAGACGGGGGAGGG - Intronic
1006454144 6:34122438-34122460 GGGGGCAGTGAGGAGAGGCAGGG - Intronic
1006471348 6:34230893-34230915 GAGGGCAGACTGCAGGGCCTTGG + Intergenic
1006640372 6:35486405-35486427 GAGGGCAGAGAGCAGGGGGAAGG + Intronic
1006641279 6:35491015-35491037 TGAGACAGACAGGAGGGGCAGGG + Intronic
1006669166 6:35718963-35718985 GAGGGCCTGGAGGAGGGGCAGGG + Intronic
1006728261 6:36215656-36215678 GAGGGCAGACTGGAAAGGAATGG + Intronic
1006813681 6:36837081-36837103 GAAAGCAAACAGGAGGGGCCAGG + Intronic
1007187024 6:39980562-39980584 GAGGGGAGACGGTAGGGGCAGGG + Intergenic
1007236297 6:40393129-40393151 GAGGGGAGGAGGGAGGGGCAGGG + Intronic
1007274839 6:40665665-40665687 GAGGACAGACAGGTTGTGCAAGG + Intergenic
1007308987 6:40930108-40930130 GAGGGCAACCAGGAGAGGTAGGG - Intergenic
1007394534 6:41570018-41570040 GAGGGATGACAGCAGGGGAAGGG + Intronic
1007402868 6:41614369-41614391 GGGAGCAGGCAGGAGAGGCAGGG + Intergenic
1007665018 6:43508848-43508870 GAGGGCAGGGTGGAGGGCCAGGG + Exonic
1007724204 6:43904849-43904871 GAGGGGACACAGGAGTGGGAGGG + Intergenic
1007741072 6:44009702-44009724 GAGGGCGGAGGGGAGGGGAAGGG + Intergenic
1007902171 6:45422512-45422534 GAGGGTGGAAATGAGGGGCAAGG - Intronic
1007924920 6:45643025-45643047 GAGGGCAGAGAGAAGGGGAAAGG - Intronic
1008502886 6:52200817-52200839 GAGGGGAGAGAGGAGGGAAAAGG + Intergenic
1008913077 6:56757681-56757703 GAGGGAAGGAAGAAGGGGCAAGG - Intronic
1009554712 6:65148513-65148535 GAAAGCAGCCAGGAGGGGCACGG - Intronic
1011547799 6:88499882-88499904 GAGAGATGGCAGGAGGGGCAGGG + Intergenic
1011744927 6:90400239-90400261 CAGGGCAGTCCGCAGGGGCATGG - Intergenic
1012142091 6:95636765-95636787 CAGAGCAGACAAGAGGAGCAGGG + Intergenic
1012956514 6:105576600-105576622 GAGGAAATCCAGGAGGGGCATGG - Intergenic
1013055207 6:106576238-106576260 GGGGTGAGACAGGAGGGGGATGG + Intronic
1016211753 6:141544458-141544480 TGGGGAAAACAGGAGGGGCAGGG + Intergenic
1017711023 6:157168114-157168136 GAGGCCAGAAAGGAGGTGGAAGG - Intronic
1017889820 6:158628913-158628935 GGGGGGAGACAGGAGGCTCACGG - Intronic
1018205733 6:161435956-161435978 GAGGGCAGAGAGGAGGGGGAGGG + Intronic
1018205744 6:161435983-161436005 GAGGGCAGAGAGGAGGGGGAGGG + Intronic
1018205755 6:161436010-161436032 GAGGGCAGAGAGGAGGGGGAGGG + Intronic
1018205765 6:161436037-161436059 GAGGACAGAGAGGAGGGGGTGGG + Intronic
1018205800 6:161436174-161436196 GAGGGCAGAGAGCAGGGGGCAGG + Intronic
1018205822 6:161436255-161436277 GAGGGCAGAGAGCAGGGGAGTGG + Intronic
1018205841 6:161436311-161436333 GAGGGCAGAGAGGAGGAGGCGGG + Intronic
1018272008 6:162089880-162089902 GAGGGAAGTGAGCAGGGGCATGG + Intronic
1018631627 6:165826964-165826986 GAGGGACATCAGGAGGGGCACGG + Intronic
1018674244 6:166205370-166205392 GAGGGCTGGCGGGATGGGCAGGG + Intergenic
1018735491 6:166684634-166684656 GAGGGCAGAGAGCAGGGTGAAGG - Intronic
1018910997 6:168101017-168101039 GAGGGCAGACAGGAGGCTAGGGG + Intergenic
1018974429 6:168554522-168554544 GGGGGTGGAGAGGAGGGGCACGG + Intronic
1019196998 6:170288931-170288953 GAGAGCAGGCAGGAGGTGCGTGG - Intronic
1019493644 7:1326295-1326317 CAGGGCAGATGGGAGTGGCAGGG + Intergenic
1019496872 7:1344873-1344895 GAAGGGAGACAGGACGGGGAGGG + Intergenic
1019508355 7:1404804-1404826 GAGGGGAGGGAGGAGGGGGAAGG + Intergenic
1019508370 7:1404838-1404860 GAGGGGAGGGAGGAGGGGGAAGG + Intergenic
1019508385 7:1404872-1404894 GAGGGGAGGGAGGAGGGGGAAGG + Intergenic
1019508400 7:1404906-1404928 GAGGGGAGGGAGGAGGGGGAAGG + Intergenic
1019637178 7:2082160-2082182 GAAGGGAGGCAGGAGGGGGAGGG + Intronic
1019776136 7:2913066-2913088 GAGGGAAGTGAGGAGGGGGAGGG + Intronic
1019874029 7:3792752-3792774 GATGGGAGACTGGAGGGGGAGGG - Intronic
1019891931 7:3954327-3954349 GAGGGGAGGCAGGAGGGGAGGGG - Intronic
1019891944 7:3954358-3954380 GAGGGGAGGCAGGAGGGGAGGGG - Intronic
1019891980 7:3954448-3954470 GAGGGGAGGCAGGAGGGGAGGGG - Intronic
1020112495 7:5455515-5455537 CAGGGAGGACAGGAGGGGCTGGG - Intronic
1020197048 7:6049073-6049095 GTGGGCAGGCAGGAGGGGTGGGG - Intronic
1021128342 7:16880497-16880519 GAGGGGAAAGAGGAGGGGAAAGG - Intronic
1021312396 7:19110627-19110649 GAAGGAAAACAGGAGGGGGATGG + Intronic
1021604312 7:22394997-22395019 GAAGGAAAACAGGTGGGGCAAGG - Intergenic
1021866382 7:24962399-24962421 GAGGGCAGAAGGGAGGGGAGGGG + Intronic
1022129948 7:27395800-27395822 GGGGGCAGGCAGGAGAAGCAGGG + Intergenic
1022332562 7:29394342-29394364 GAGGGCAGGCAGAACGGGCCAGG + Intronic
1022820610 7:33956542-33956564 AAGGGGAGACAGGAGAGGCAGGG - Intronic
1022861387 7:34370687-34370709 GACTGCAGAGAGGAGAGGCAAGG + Intergenic
1023104069 7:36746659-36746681 GAAGCCTGACAGGAGAGGCAGGG + Intergenic
1023300112 7:38761176-38761198 GAGGGAAGAAAGGAAGGACAAGG - Intronic
1023737625 7:43248766-43248788 GAGGGGAAACAGGAGGAGAACGG - Intronic
1023841574 7:44101354-44101376 GGGGACAGGCAGGAGTGGCAGGG - Intergenic
1023864521 7:44232466-44232488 GAGGACAGCCAGGAGGGCCAAGG + Intronic
1023916976 7:44597020-44597042 GAGAGAAGACAGGAGGGGAAAGG + Intergenic
1024142731 7:46478667-46478689 AAGGGGAGAGAGGAAGGGCAGGG + Intergenic
1024486592 7:49926763-49926785 GAAGGAAGAGAGGAGGGGCTGGG + Intronic
1024520883 7:50303839-50303861 GCGGGCCGCCAGGAGGGGGAGGG - Intergenic
1024864758 7:53892213-53892235 GAAGGAAAACAGGAGGGACAAGG + Intergenic
1024933619 7:54690251-54690273 GAGGGCAGAAGGCAGGGCCAGGG - Intergenic
1025777106 7:64569452-64569474 CAGGGCGGAGAGGAGGGCCAGGG + Intergenic
1025854238 7:65264246-65264268 GAGGGCAGGCAGGCAGGCCAGGG + Intergenic
1026234711 7:68516883-68516905 GAGGGCACAAAGGAGAAGCAAGG + Intergenic
1026637727 7:72098851-72098873 GAAGGCAGGCAGGAGGGTCTGGG - Intronic
1026743162 7:72991340-72991362 GAGGACGGAGAGGAGGGGCATGG - Intergenic
1026881459 7:73909147-73909169 GAGGGCTGGCAGCAGGGGGAGGG + Intergenic
1027029276 7:74876037-74876059 GAGGACGGAGAGGAGGGGCATGG - Intergenic
1027100573 7:75373738-75373760 GAGGACGGAGAGGAGGGGCATGG + Intergenic
1027266290 7:76496874-76496896 CAGATCAGCCAGGAGGGGCATGG + Intronic
1027317670 7:76994992-76995014 CAGATCAGCCAGGAGGGGCATGG + Intergenic
1027397138 7:77767762-77767784 GAGGGGGGAGAGGAGGGGAAGGG - Intronic
1028415331 7:90574391-90574413 GAAGAGAGAAAGGAGGGGCATGG + Intronic
1028688478 7:93621212-93621234 CAGGGCAGACTGGAAGGGGAAGG + Intronic
1029478356 7:100798618-100798640 TAGGGGAGACAGAAGGAGCAGGG + Intergenic
1029578771 7:101421032-101421054 GAGGGCACAAAGGAGGGGAAGGG - Intronic
1029619534 7:101681309-101681331 GAGGGAAGCCAGGAGGGGGACGG - Intergenic
1029652962 7:101906327-101906349 GAGGTGAGGCAGGAGGAGCAGGG + Intronic
1029973324 7:104810580-104810602 GAGGGAAGTCAGGAGAGGAAAGG + Intronic
1031060708 7:117048225-117048247 AAGGGGAGGCAGGAGAGGCAGGG + Intronic
1031091683 7:117364482-117364504 GAGGGCTGAGAGGAGAGGGATGG + Intronic
1031586208 7:123534681-123534703 GAGGGCAGCGGGGAGGGGCCGGG + Intronic
1031595060 7:123640636-123640658 GAGGGGGGAGAGGAGGGGGAGGG + Intergenic
1031595070 7:123640654-123640676 GAGGGGGGAGAGGAGGGGGAGGG + Intergenic
1031598192 7:123671735-123671757 GTGGGAAGACAGGAGGGATAGGG - Intergenic
1031966384 7:128031038-128031060 GAGGGCAGAGGGGAGGGGAGGGG + Exonic
1032083989 7:128874210-128874232 GAGGGCAAGCGGAAGGGGCAGGG - Intronic
1032095539 7:128936888-128936910 GAAGGAAAACAGGAGGGACAAGG - Intergenic
1032180146 7:129668936-129668958 GAGAGGAGACAGGAGGGGAGGGG - Intronic
1032425592 7:131819975-131819997 GAGGGCAGTGAGGAGGAGCTGGG - Intergenic
1032527981 7:132594174-132594196 GAGGTCATACTGGAGGAGCATGG + Intronic
1032537060 7:132672956-132672978 GAGGACAGGAAGGAGGGCCAGGG - Intronic
1032684851 7:134223130-134223152 GAGGCCAGCCAGGAGAGGGAGGG - Intronic
1033048800 7:137985678-137985700 GAGGGAAGACAAGAAGGGGACGG - Intronic
1033116804 7:138632646-138632668 GAGGCCAGACAGGGGAGCCAGGG + Intronic
1033257736 7:139816783-139816805 GAAGGCAGGGAGCAGGGGCAGGG - Intronic
1033576394 7:142689397-142689419 GAGGTCAAACAGGTGGGTCAGGG + Intergenic
1033896263 7:146074154-146074176 GACAGCAGCCAGGAGGGGCGGGG + Intergenic
1034331819 7:150289350-150289372 GAGGATGGAAAGGAGGGGCAGGG + Intronic
1034439358 7:151078785-151078807 GAGGGCTGACAGGAGGAGGAAGG - Intronic
1034529543 7:151687181-151687203 CAGGGCAGACAGCAGAGGCTGGG - Intronic
1034866310 7:154645455-154645477 GAAGGAGGACAGGAGGGGAAGGG - Intronic
1034989552 7:155539463-155539485 CAGGCCAGCCAGGAGGTGCAGGG - Intergenic
1035111228 7:156483713-156483735 AGGGGGAGACAGGAGGGGGAGGG + Intergenic
1035141462 7:156766698-156766720 GTGGGCAAGCAGGAGGAGCAGGG + Intronic
1035163466 7:156968332-156968354 GAGAGCAGCCCGGAGGGGCAGGG - Intronic
1035182249 7:157097795-157097817 GAGGGCAGGAAGGAAGGGCTGGG + Intergenic
1035282357 7:157786018-157786040 GAGGCCAAACAGCAGGGGCCTGG - Intronic
1035366573 7:158352274-158352296 GGGAGCAGACAGGAGGGGAGTGG - Intronic
1035730578 8:1851041-1851063 GAGGGGTGACAGGCGGAGCACGG + Intronic
1036224396 8:6945460-6945482 AAGGGCTGAGGGGAGGGGCAGGG - Intergenic
1036649780 8:10634887-10634909 TTGGGGAGACTGGAGGGGCAAGG - Intronic
1037216336 8:16456698-16456720 GAGGGAAGAGAGGAAGGGAAGGG + Intronic
1037502202 8:19496977-19496999 GAGGGGAGGCGGGAGGGGGAGGG - Intronic
1037535314 8:19817797-19817819 GAGGGGAGAGAGGAGGGGGTGGG - Intronic
1037725875 8:21482345-21482367 GTTGGCAGACATGTGGGGCATGG - Intergenic
1037753234 8:21696089-21696111 GAGGGGACAGAGGAGGGGGAGGG - Intronic
1037814661 8:22105629-22105651 GAGGGCAGCCAAGAGAGGCAGGG + Intergenic
1037816332 8:22114668-22114690 AAGGGCAGACAGGCGGGGCAAGG + Exonic
1037816907 8:22117159-22117181 AAGGGCAGGCAGGGAGGGCATGG + Intronic
1037821591 8:22137720-22137742 GAGCACAGGCAGGAGGGGCTTGG - Intergenic
1037886581 8:22599202-22599224 GAGGGGAGAGGGGAGGGGCGAGG - Intronic
1038020903 8:23551208-23551230 GCTGGCAGAGAGGTGGGGCAGGG - Intronic
1038089648 8:24239128-24239150 GAGGAGAGTCAGGAGGGACAGGG - Intergenic
1038523805 8:28256397-28256419 GAGGGGAGAGAGGAGGGAAAAGG + Intergenic
1038596460 8:28890577-28890599 GAGGGAAGGCGGGAGGGGGAGGG - Exonic
1039255662 8:35716112-35716134 GAGAGCAGAGAGGAGACGCAAGG + Intronic
1041082374 8:54225808-54225830 GAGGACAGGCAGGTGGGGCGGGG + Intergenic
1041145412 8:54870940-54870962 CAGGGAAGGCAGGAGGGCCAAGG - Intergenic
1041738964 8:61139057-61139079 GAGGGCATCCTGGAGAGGCAAGG - Intronic
1042773427 8:72403689-72403711 GAGGAAAGACAGGAGGGCCTGGG - Intergenic
1042835340 8:73074785-73074807 GAGGGCACACAGTGGGTGCAGGG + Intronic
1042902906 8:73746576-73746598 GAGGGGAGACCGGCGGGGGAGGG - Intronic
1043973837 8:86563371-86563393 GAGGGCAGAGTGGAAGGGTATGG - Intronic
1044002415 8:86899957-86899979 ATGGGCAGAGAGGAGGGGTAGGG - Intronic
1044064636 8:87684482-87684504 AAGGACACACATGAGGGGCATGG + Intergenic
1045178891 8:99758748-99758770 GAGGGCAAAGTGGAAGGGCATGG - Intronic
1045326810 8:101123271-101123293 GAGGGGAGAGAGATGGGGCAAGG + Intergenic
1046530471 8:115438731-115438753 GAAGGAAGGCAGGAGGGGCAGGG - Intronic
1046902190 8:119535616-119535638 GAGGGCAGAGAGGAGAGAAAGGG - Intergenic
1047024850 8:120813235-120813257 GAGGGTAGACAGCAGTGGGAAGG - Exonic
1047114578 8:121826775-121826797 GAAGGCAGAGAAGAGGGGGAAGG - Intergenic
1047255193 8:123208698-123208720 GAAAGCATACAGGAGGGGCCAGG + Exonic
1047531596 8:125681829-125681851 GAGGACACCCATGAGGGGCAGGG + Intergenic
1047730604 8:127724902-127724924 GAGGGCAGAGCGGCTGGGCACGG - Intergenic
1048234935 8:132680699-132680721 AAGGGAAGAGAGGAGGGGAAAGG - Intergenic
1048836123 8:138520553-138520575 GAGGGCAGAAGGGACTGGCAGGG - Intergenic
1049161591 8:141101678-141101700 GAGGGCAGTGGGGAAGGGCACGG - Intergenic
1049227871 8:141466326-141466348 GGGGGCAGACAGGAGGGCAGAGG + Intergenic
1049279201 8:141735726-141735748 GGGGGCGGTCAGGAGGAGCATGG - Intergenic
1049316001 8:141968044-141968066 GAGGGGAGACAGCAGGGCGAAGG + Intergenic
1049370281 8:142261091-142261113 GAGGGAAGAGAGGGGGAGCAGGG + Intronic
1049387350 8:142349989-142350011 CAGGGCAGGCAGGGCGGGCAAGG + Intronic
1049387362 8:142350019-142350041 CAGGGCAGGCAGGGCGGGCAGGG + Intronic
1049387401 8:142350127-142350149 CAGGGCAGGCAGGGCGGGCAGGG + Intronic
1049387412 8:142350157-142350179 CAGGGCAGGCAGGGTGGGCAGGG + Intronic
1049387431 8:142350208-142350230 CAGGGCAGGCAGGGCGGGCAGGG + Intronic
1049393360 8:142383185-142383207 GAGGGGAGACAGGAGAACCAGGG + Intronic
1049408965 8:142464077-142464099 GGGGGCAGGGAGGCGGGGCAAGG - Exonic
1049478319 8:142807118-142807140 GAGGGCAGACAGGATGAGGAGGG - Intergenic
1049578815 8:143401568-143401590 GAGGGCAGAGGGGAGGGGAGGGG + Intergenic
1049578829 8:143401595-143401617 GAGGGCAGAGGGGAGGGGAGGGG + Intergenic
1049583572 8:143423180-143423202 CAGGGGAGACTGGCGGGGCAGGG - Intronic
1049709650 8:144057780-144057802 TAGGGCTGACAGGAGGGGCTGGG + Intronic
1049725146 8:144142330-144142352 GAGGGCTGAAAGCAGGGGCCTGG + Intergenic
1049737709 8:144218699-144218721 GAGGGGGGACAGGAGGGGAGAGG - Intronic
1049988319 9:971856-971878 GAGGGCAGGCGGGTGGGGGAGGG - Intergenic
1051136438 9:13927029-13927051 GAGAGGAGACAGGAGGAGGAGGG - Intergenic
1051787616 9:20762810-20762832 GAGGGTGGGAAGGAGGGGCAAGG - Intronic
1052376573 9:27724273-27724295 GAGGGTAGAGAGGGGGGCCAGGG + Intergenic
1052536685 9:29756417-29756439 GAGGGCATTCAGGCTGGGCATGG - Intergenic
1052918204 9:33940000-33940022 GAGGGGAAAGAGGAGGGGGAGGG + Intronic
1052951966 9:34220049-34220071 GAGGGGAGAGGGGAGGGGGAGGG - Intronic
1053307217 9:36993563-36993585 GAAGGGACACAGCAGGGGCAGGG + Intronic
1053329341 9:37188888-37188910 GAGGGGAGAAGGGAGGGGGAGGG - Intronic
1053435481 9:38070860-38070882 GAGGGCAGACAGCAAGGCCAGGG + Intergenic
1055381507 9:75712519-75712541 GAAGGAAGACAGGAGGGACCTGG - Intergenic
1056058207 9:82851822-82851844 GCGGGGAGGCAGGAGAGGCAGGG - Intergenic
1056317738 9:85407628-85407650 GAGGGCGGGCATGAGGGGAAGGG + Intergenic
1056578478 9:87873175-87873197 GAGGGAAGAAAGGAGAGGGATGG + Intergenic
1056724936 9:89106502-89106524 CAGGGCAGCCTGGAGGAGCAGGG + Intronic
1056975997 9:91254370-91254392 GGGTGCAGACAGGATGGGAAGGG + Intronic
1057167624 9:92941139-92941161 GAGGGAAAACAGCAGGGGGAAGG + Intergenic
1057204405 9:93162794-93162816 GAGGGCCATGAGGAGGGGCATGG + Intergenic
1057699854 9:97355948-97355970 GCGGGCAGACAGTGGGGGCCTGG + Intronic
1057743786 9:97735289-97735311 GAGGGGAGAGAAGAGGGGCAAGG + Intergenic
1058462751 9:105198126-105198148 GAGGTCAGGGAGGAGGGGAATGG + Intergenic
1058687126 9:107489067-107489089 GAGCGGAGACAGGAGAGTCAGGG + Intronic
1058842658 9:108925132-108925154 GAGGGAAGAGATGAGAGGCAGGG - Intronic
1059351918 9:113671541-113671563 CAGGGCGGACAGGCTGGGCATGG + Intergenic
1059550294 9:115222311-115222333 GACGGCAGACAGGAGGGAGAGGG + Intronic
1060243396 9:121924375-121924397 GAGGGCAGAGAAAAGAGGCAAGG + Intronic
1060403241 9:123360466-123360488 CAGGCCAGACAGGAGAGGCAAGG - Intronic
1060520609 9:124292013-124292035 GAGGGCAGACATGAGGTGCCTGG - Intronic
1060548378 9:124473891-124473913 GTGGGGAGACATGAGGGGTAAGG + Intronic
1060877663 9:127094893-127094915 GAGGGCAGAGTTGATGGGCAGGG - Intronic
1061192077 9:129087907-129087929 GAGGCCGGCCAGGCGGGGCAGGG - Intronic
1061196751 9:129110821-129110843 GAGGAGGGACAGGAGGGGCGGGG + Intronic
1061200654 9:129136657-129136679 GAGGGAGCGCAGGAGGGGCAGGG - Intronic
1061537365 9:131258434-131258456 AAGGGCAGAAAGAAGGGGCACGG + Exonic
1061542203 9:131283365-131283387 GACGGCAGAAAGGAAGGGGAGGG - Intergenic
1061859590 9:133461041-133461063 GAGGGCAGACAGGAAAGGAAAGG - Intronic
1061897420 9:133655697-133655719 GCGGGGAGCCTGGAGGGGCAAGG + Intronic
1061968772 9:134031995-134032017 GAGGGCAGACAGGCTCGGGAGGG + Exonic
1062098035 9:134712660-134712682 GAGGGCAGAAGGAAGGGGTAAGG - Intronic
1062156521 9:135051867-135051889 GAGGGCTGAGAGGAAGGGGAGGG + Intergenic
1062158911 9:135069142-135069164 GAGGACAGAGAGGTGGGGCGTGG + Intergenic
1062469617 9:136696842-136696864 GAGGGGAGGGAGGAGGGGGAGGG - Intergenic
1062469627 9:136696860-136696882 GAGGGGAGGGAGGAGGGGGAGGG - Intergenic
1062469637 9:136696878-136696900 GAGGGCAGGGAGGAGGGGGAGGG - Intergenic
1062469659 9:136696922-136696944 GAGGGGAGGGAGGAGGGGGAGGG - Intergenic
1062469670 9:136696940-136696962 GAGGCCAGGGAGGAGGGGGAGGG - Intergenic
1062469682 9:136696967-136696989 GAGGGGAGGGAGGAGGGGGAGGG - Intergenic
1062469692 9:136696985-136697007 GAGGGGAGGGAGGAGGGGGAGGG - Intergenic
1062469760 9:136697114-136697136 GAGGGATGATAGGAGGGGGAAGG - Intergenic
1062489983 9:136800269-136800291 GAGGGCTCACGGGAGGGGCGGGG + Intronic
1062518835 9:136949413-136949435 GTGGGCAGGGAGGACGGGCACGG - Intronic
1062534107 9:137014080-137014102 GAGGGCAGCCAGTAGGGAGAGGG - Intronic
1062562601 9:137148354-137148376 GAGGGCAGGCAGGAGAGGGCAGG + Intronic
1062588740 9:137263516-137263538 GAGAGGAGCCAGGAGGGCCAGGG - Intronic
1203548942 Un_KI270743v1:152617-152639 TAGGACAGACAGGAGAGTCATGG + Intergenic
1185459800 X:328813-328835 GGGGGCAGGGAGGGGGGGCAGGG - Intergenic
1185459829 X:328866-328888 GGGGGGAGAGAGGAGGGGGAGGG - Intergenic
1185581304 X:1213112-1213134 GAGGGGAGAGGGGAGGGGGAGGG - Intergenic
1185608452 X:1380480-1380502 GAGGGGGGAAAGGAGGGGGAAGG + Intronic
1185676954 X:1856970-1856992 GAGAGAAGACAGGAGGGAGAAGG - Intergenic
1185688279 X:1948314-1948336 GAGGGGAGACAGGAGGAGGAGGG + Intergenic
1185688580 X:2133890-2133912 GAGGGGAGACAGGAGGAGGAGGG + Intergenic
1186662169 X:11679702-11679724 GAAGGCAGACAGGAGGCAAAGGG + Intergenic
1186930638 X:14385465-14385487 CACTGCAGACAGGAGGGTCATGG - Intergenic
1187102415 X:16207637-16207659 AAGGGGAGGCAGGAGAGGCAGGG + Intergenic
1187330904 X:18338615-18338637 TAGGTTAGACAGGAGGGGCTGGG + Intronic
1187843714 X:23514810-23514832 GAGGGCAGACAGGAAGTGCCGGG + Intergenic
1187927186 X:24260985-24261007 GAGGGAAGAGAGGAGTGCCAAGG - Intergenic
1189116806 X:38351369-38351391 GAGGAAGGAGAGGAGGGGCAGGG - Intronic
1189148965 X:38685043-38685065 GAGGCCAGACAGGAGGGTGAGGG - Intronic
1189197128 X:39162170-39162192 TAGGGCAGAAAGGATGGGAAAGG - Intergenic
1189387451 X:40549067-40549089 GAGGGCAGAAAGTAGTGGCTTGG - Intergenic
1189487960 X:41447161-41447183 GAGAGAGGACAGGAGGGCCAGGG + Intergenic
1190128453 X:47725460-47725482 GAGGACAGAGAGGAGAGGGATGG - Intergenic
1190874680 X:54451234-54451256 CAGGGCAGACAGAAGAGTCAGGG - Intronic
1191873190 X:65767910-65767932 GAGGGCCCAGAGGAGGGGCCTGG + Intergenic
1192146423 X:68686001-68686023 GGGGGCAGACAGGAGGTGGAGGG + Intronic
1192231378 X:69267468-69267490 GAGGGCAGCAAGGAAGGGCAAGG + Intergenic
1192231639 X:69269429-69269451 GGGGGCAGCGAGGAAGGGCAAGG - Intergenic
1192315209 X:70045852-70045874 GAGGGCAGCAAGCAGGGCCAGGG + Intronic
1192430478 X:71108176-71108198 GGGGGCAGAGAGGAGAGGGAAGG - Intronic
1192915482 X:75646821-75646843 GAGGAGAGTCAGGAGGGACAGGG + Intergenic
1194170588 X:90575659-90575681 GAGATCAGCCAGGAGGAGCAGGG + Intergenic
1194584690 X:95717901-95717923 AAGGGCAGGCAGGAGGGGAAGGG + Intergenic
1194814108 X:98421801-98421823 GAGGGCAGTCATGAGAGGTAAGG + Intergenic
1196237470 X:113299828-113299850 GAGGGGAGAGAGGAGGGGAGAGG - Intergenic
1196237503 X:113299899-113299921 GAGGGGAGAGGGGAGGGGGAGGG - Intergenic
1196237513 X:113299917-113299939 GAGGGGGGACGGGAGGGGGAGGG - Intergenic
1196237531 X:113299952-113299974 GAGGGGAGATAGGAGGGGGAGGG - Intergenic
1196237549 X:113299987-113300009 GAGGGGAGACGGGAGGGGAGAGG - Intergenic
1197226696 X:123961667-123961689 GAGGGAAGGGAGGAGGGGAAGGG - Intronic
1197265843 X:124369896-124369918 GGGAGCAGGCAGGAAGGGCAGGG + Intronic
1198281605 X:135148275-135148297 GAGGGCACACATGTGTGGCAGGG + Intergenic
1198289354 X:135224247-135224269 GAGGGCACACATGTGTGGCAGGG - Intergenic
1198618101 X:138480350-138480372 CAGGGCTGACTGAAGGGGCAGGG - Intergenic
1198934965 X:141895648-141895670 GAGGGCTGATATGAGGAGCAGGG - Intronic
1199628549 X:149761151-149761173 CATGGCTGACAGAAGGGGCAGGG - Intergenic
1199712269 X:150477734-150477756 GTGGGCAGAGAGGAGGGGGAAGG + Intronic
1199904266 X:152208435-152208457 GACAGTAGACAGTAGGGGCAGGG + Intronic
1200065251 X:153501716-153501738 GTGGGCAGGCTGGAGGGGCGGGG - Intronic
1200516831 Y:4153419-4153441 GAGATCAGCCAGGAGGAGCAGGG + Intergenic
1200656859 Y:5912691-5912713 GAGGGGAGAGGGGAGGGGGAGGG + Intergenic