ID: 955759071

View in Genome Browser
Species Human (GRCh38)
Location 3:62258822-62258844
Sequence TGGGAAACTACTCCCTGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 134}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955759071_955759076 12 Left 955759071 3:62258822-62258844 CCTTCCCAGGGAGTAGTTTCCCA 0: 1
1: 0
2: 2
3: 17
4: 134
Right 955759076 3:62258857-62258879 AAGATTGACAGCCTCTTCCTTGG 0: 1
1: 0
2: 0
3: 14
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955759071 Original CRISPR TGGGAAACTACTCCCTGGGA AGG (reversed) Intronic
900079056 1:842093-842115 AGGGAAGCTCCTCCCTGGGAGGG - Intergenic
901642713 1:10701179-10701201 TGGGCAGCTGCTCCCTGGCAGGG + Intronic
904038243 1:27570140-27570162 TGGGAAACCAGACCCTAGGATGG - Intronic
905825008 1:41020660-41020682 TGGGAAGGCTCTCCCTGGGAAGG + Exonic
907661274 1:56394625-56394647 GGGGAAACTCTTGCCTGGGAGGG + Intergenic
908502717 1:64760203-64760225 TGGGAAGCTACTTGTTGGGAAGG + Intronic
910540761 1:88354328-88354350 TCAAATACTACTCCCTGGGATGG - Intergenic
911125156 1:94334530-94334552 AGGGAAACTACCACCTTGGAAGG + Intergenic
911329809 1:96513931-96513953 AGGGAATTTACTCCCTGTGAAGG + Intergenic
916530298 1:165650143-165650165 ATGGAAACTACTCCCTAGCAGGG - Intronic
917055727 1:170978915-170978937 TGGGACAGACCTCCCTGGGAGGG - Intronic
920207743 1:204305190-204305212 TGGAAAACTGCTCCCTGGTATGG - Intronic
920501388 1:206487570-206487592 TGTGAGACTAGGCCCTGGGAAGG - Intronic
920845411 1:209589302-209589324 AGGGACACTAGTGCCTGGGATGG - Intronic
1069191623 10:65498272-65498294 TGGGAAAATAATCCCAGGAAGGG - Intergenic
1069205309 10:65675414-65675436 TGCAAGACTACTCCCTGGGAGGG + Intergenic
1070681911 10:78454686-78454708 TTAGAAAATAATCCCTGGGAAGG + Intergenic
1070782301 10:79144705-79144727 ACGGAAACTATTCACTGGGAAGG - Intronic
1072009553 10:91291334-91291356 TGGGAAACTGCCCACTGAGATGG - Intergenic
1073483602 10:103802630-103802652 TGTTGAACTTCTCCCTGGGAAGG + Intronic
1073522773 10:104150134-104150156 TGGGATAATACTCCCTTGTATGG + Intronic
1074653108 10:115547400-115547422 TGGGAATTTCCTTCCTGGGAGGG + Intronic
1075364951 10:121878202-121878224 TAGGAAAATACTGACTGGGAAGG + Intronic
1076782993 10:132734744-132734766 TGGGAAATCACTCCCAGGCAGGG - Intronic
1079034238 11:17008548-17008570 TGGAAAACTCCTTACTGGGAAGG - Intronic
1080114618 11:28607717-28607739 TGAGAAACAACTGACTGGGAGGG - Intergenic
1083809107 11:65093150-65093172 TGGGTAAATAATCCTTGGGAGGG + Intronic
1085711197 11:78830504-78830526 GGGGAGTCTGCTCCCTGGGAGGG - Intronic
1087357344 11:97111328-97111350 GCTGAAACTAGTCCCTGGGATGG + Intergenic
1089764310 11:120751845-120751867 TGGGAAGCTTCTCCCGGTGAAGG + Intronic
1090418776 11:126559065-126559087 AGGGAAACTACCCCTGGGGAAGG + Intronic
1092589704 12:9940768-9940790 TGGGAAAATCCTCAATGGGAAGG + Intergenic
1093748744 12:22773891-22773913 TTGGGAACTACTCCCTGCAAGGG + Intergenic
1094719774 12:33052369-33052391 TGGGAATCTACTCCCTGGGCTGG - Intergenic
1098612198 12:72472595-72472617 TGGGAAAATACTTCCTTGAAAGG - Intronic
1104390470 12:128387387-128387409 TGGGAAACCTGTGCCTGGGAGGG + Intronic
1105827360 13:24134327-24134349 AGGATAACTACTCACTGGGAAGG - Intronic
1106692722 13:32135642-32135664 TGGGAAAATAATTCTTGGGAAGG + Intronic
1109015835 13:57012256-57012278 TGGGAAACTATTTGTTGGGAGGG + Intergenic
1109303725 13:60616310-60616332 TGTGAAATTAGTCACTGGGAAGG + Intergenic
1111858241 13:93668118-93668140 TGGAAAATTTCTCCCTGGCATGG + Intronic
1112073554 13:95882300-95882322 TGGGAAAATTCTCCCTTGGCAGG - Intronic
1116130898 14:40854828-40854850 TGGGTAGCTACTCTCTGGGCAGG - Intergenic
1116889039 14:50249557-50249579 AGGGAACCTACTGCCTTGGAGGG + Intronic
1117690073 14:58297840-58297862 TGGTAAACTTCTCCCTGCGGCGG - Intronic
1118596091 14:67436679-67436701 TGGGAACCTGCTCTCTGGGCTGG - Intergenic
1118741369 14:68741874-68741896 TGGGAAACTCCGCCCTTGGGGGG + Intergenic
1125920914 15:43525154-43525176 TGGGGAACTAAACCTTGGGAAGG + Exonic
1126492038 15:49247683-49247705 TGGGAAACAAAGCACTGGGAGGG + Intronic
1126500911 15:49343566-49343588 TGGGAAGAAACTTCCTGGGATGG - Intronic
1129351256 15:74957107-74957129 TTGGAAATCTCTCCCTGGGAGGG - Exonic
1130018285 15:80203814-80203836 TGGGTAGCTCCTCCCTGGCATGG + Intergenic
1132048931 15:98591005-98591027 TGGGAAAATACACACTTGGAAGG - Intergenic
1135957997 16:26972283-26972305 TGGTAAACTACTCCCTGGCAGGG + Intergenic
1138297598 16:55900203-55900225 TGGGAAACTTCTCCTGGGGCAGG - Intronic
1138599670 16:58047053-58047075 TTGGAAACTATGCCCTGGGAGGG + Intergenic
1138781863 16:59798063-59798085 CAGGAAACTACTCCCTGAGTAGG - Intergenic
1139528709 16:67531137-67531159 TGGGGCTCTGCTCCCTGGGATGG - Intronic
1142022872 16:87795050-87795072 TGGGGAACTCCTACCTGGGCTGG - Intergenic
1143241214 17:5444723-5444745 AGGGAAACTACCGCCTGTGAAGG + Intronic
1144836426 17:18158838-18158860 TGGGAAAGAACCCCCAGGGAGGG - Intronic
1146936099 17:36813530-36813552 TGGGAAGCTACAGCCTGAGAAGG + Intergenic
1147815811 17:43209415-43209437 TGGGAAATTACAACCTGGGAAGG - Intronic
1151820205 17:76492991-76493013 GGGGAAACCACCCCCTGGGCGGG + Intronic
1152252603 17:79219745-79219767 TGGGAAACCGGACCCTGGGAAGG - Intronic
1152780345 17:82224963-82224985 TGGGCTGCCACTCCCTGGGAAGG + Intergenic
1158196191 18:54887335-54887357 TGGGGAAATGCTCCCTGAGATGG - Intronic
1163786482 19:19277403-19277425 TGCGAAACCACTCCCAGAGATGG - Intronic
1165012683 19:32860039-32860061 TGCGAATCTTCTCCCTGGGAGGG - Intronic
1165169050 19:33878218-33878240 CGGGAGGCTGCTCCCTGGGATGG - Intergenic
1165244855 19:34493035-34493057 AGGGAGACGACTCCGTGGGAAGG + Exonic
1165768525 19:38365129-38365151 TGGGATACTGGGCCCTGGGAGGG + Intronic
925880705 2:8350068-8350090 TGGGCTATTACTGCCTGGGAGGG - Intergenic
936904720 2:117524362-117524384 TGGGAAATCACTCATTGGGAAGG - Intergenic
937223766 2:120356719-120356741 CGAGAAGCTCCTCCCTGGGAGGG - Intergenic
938149969 2:128874331-128874353 TGGGAAACAGGCCCCTGGGATGG - Intergenic
940326894 2:152434870-152434892 TGTGATACTAATCCCTGGGATGG + Intronic
943475841 2:188354068-188354090 TATGACTCTACTCCCTGGGAAGG - Intronic
946228569 2:218277871-218277893 AGGGAGACTGCTCCCAGGGAAGG - Intronic
947812249 2:233011863-233011885 TGGGGATCCCCTCCCTGGGAGGG + Intronic
1172355115 20:34274535-34274557 AGTGAGACTACTCCCTGGGGTGG - Intergenic
1173866599 20:46316501-46316523 AGGGAAATAACTCACTGGGAAGG + Intergenic
1173971572 20:47156747-47156769 GAGGAGTCTACTCCCTGGGAGGG - Intronic
1176164807 20:63667333-63667355 TGGGAAGCTGCTGCCTGGGATGG - Intronic
1177812993 21:25944847-25944869 TGTGGAACTACTTCCTGGCATGG - Intronic
1179787272 21:43737129-43737151 TGGGCAGCTTCTGCCTGGGATGG + Intronic
1180173133 21:46071198-46071220 TGGGCATCTGCTCCCTGGGTGGG + Intergenic
1181675553 22:24449304-24449326 TGGGAGACAACTACCTGGTATGG + Intergenic
1184900068 22:47440845-47440867 TGGGAACCTGCTCCCTGCCATGG - Intergenic
1185307376 22:50127530-50127552 CGGGAAGCTACGCCCTGGGATGG - Intronic
950377494 3:12583855-12583877 TGGAAGACTGCTCCCTGAGAGGG + Exonic
955320839 3:57973129-57973151 AGGGAAAAAAGTCCCTGGGATGG - Intergenic
955759071 3:62258822-62258844 TGGGAAACTACTCCCTGGGAAGG - Intronic
959263946 3:104114219-104114241 AAGGTAACTACCCCCTGGGATGG + Intergenic
963393540 3:144701817-144701839 TAAGAAACTACTCCCAGAGATGG - Intergenic
967509376 3:190291949-190291971 TGGGAAACTCCTTCATGGGCTGG + Intergenic
968509400 4:988734-988756 TGGGTGGCTCCTCCCTGGGAAGG + Exonic
968551095 4:1223678-1223700 TGGGAAGGTGCTCCCTGAGAGGG - Intronic
969145102 4:5115649-5115671 GGAGAAACTCCTCCCTGGGCTGG - Intronic
969172795 4:5377313-5377335 TGGGAAGCTAATCCCTTTGAAGG - Intronic
973839910 4:54850804-54850826 TTGGAAAGTTCTCCTTGGGAAGG - Intergenic
974404937 4:61454159-61454181 AGGAAAACTACTTCCTGGGTAGG - Intronic
976026792 4:80697612-80697634 GTGGGGACTACTCCCTGGGATGG + Intronic
976693863 4:87897562-87897584 TGGGAAAATACTTTCTGGGTAGG - Intergenic
978053240 4:104230225-104230247 TGGGAAACTACTCTATGGAATGG - Intergenic
978922453 4:114200874-114200896 AGGGAACCTACTGCCTTGGAGGG - Intergenic
981642201 4:146957509-146957531 TAGGATACCACTTCCTGGGAGGG + Intergenic
983800140 4:171917906-171917928 TGGGCAAGTACTCTCTGAGAAGG - Intronic
985700386 5:1368264-1368286 TGGGGCACTGCTGCCTGGGAGGG + Intergenic
985794117 5:1949446-1949468 TGCGAACCTACACCCTGGGATGG + Intergenic
988122425 5:26983144-26983166 GGGTAAGATACTCCCTGGGAAGG + Intronic
992309635 5:75482430-75482452 TGGCAAGCTACCCCCTGGGCCGG - Intronic
995189389 5:109304391-109304413 TGGGAAATTAATTCCTGGCAGGG + Intergenic
1000298419 5:159933385-159933407 TGTCAAATTACTCTCTGGGAAGG + Intronic
1001333218 5:170777014-170777036 TGGGAAGCTGCTTCCAGGGAGGG - Intronic
1001419860 5:171578342-171578364 TGGGAATCCACCCTCTGGGAGGG - Intergenic
1002101174 5:176858398-176858420 TGGGAAGCTCCTGCCTCGGAGGG + Intronic
1002761804 6:208310-208332 TGGGAAAATACCCCCTGGGCAGG + Intergenic
1006160693 6:32039130-32039152 TGGGAGACTACTCCCTGCTCTGG + Exonic
1006424562 6:33956120-33956142 AAGGAAGCTACCCCCTGGGATGG - Intergenic
1007719038 6:43874569-43874591 TGGGAAACAAGCCCCAGGGAGGG + Intergenic
1011598357 6:89037659-89037681 AGGGAAACTACTGCCTTGAAGGG + Intergenic
1012419432 6:99047324-99047346 TTGGAAATTAATCCCTAGGATGG + Intergenic
1013523705 6:110955571-110955593 TGGAAAACCATTCCCTTGGAAGG - Intergenic
1014969248 6:127793426-127793448 TGGGAAAATCCTCCCAGAGAAGG + Intronic
1015650087 6:135447007-135447029 GTGGAAACGACTCCCTGGGCAGG - Exonic
1019452029 7:1103957-1103979 TGGGAACTTACTCCCTGGGCAGG - Intronic
1020071296 7:5228524-5228546 TGCGAAACTCCACCCTGGGGAGG - Intronic
1020342506 7:7127435-7127457 TGGTGAACACCTCCCTGGGAGGG + Intergenic
1022898413 7:34776805-34776827 AGGGAAACTACTGCCTTGAAGGG - Intronic
1023200017 7:37686885-37686907 TAGTAACCTACTCTCTGGGATGG + Intronic
1023850299 7:44146334-44146356 TGGGAAACTAGGGCCTGGGGCGG - Intronic
1024653420 7:51428514-51428536 TTGGAAACTACTCCATGGGGAGG + Intergenic
1026416347 7:70184791-70184813 GAGGAAACTATGCCCTGGGAAGG + Intronic
1033154768 7:138947446-138947468 TGTGAGACTACCCCCTGGGCTGG - Intronic
1033261932 7:139851501-139851523 AGGGAAACTTCACCCTGGGGTGG - Intronic
1035526574 8:317590-317612 AGGGAAGCTCCTCCCTGGGAGGG + Intergenic
1040929031 8:52714642-52714664 TGGGAAAGTACGCACCGGGACGG - Intronic
1041004558 8:53485986-53486008 TGGGAAACAACCCCCTGGATAGG + Intergenic
1042019103 8:64351034-64351056 GGGGAAAAATCTCCCTGGGATGG + Intergenic
1046800368 8:118419853-118419875 TTTGAAACTGCTCCCTTGGAAGG + Intronic
1048043527 8:130752670-130752692 TGGGAAAGTCATCCCTGGGGAGG - Intergenic
1052409286 9:28102280-28102302 TGGGAAACTAGTAACTTGGAAGG + Intronic
1058539969 9:106001609-106001631 TGTGAAACTAGCCTCTGGGAAGG - Intergenic
1060379942 9:123159090-123159112 TGGAATACTACTTCCTGGTAAGG - Exonic
1061167735 9:128933914-128933936 TGGGAATCTGCCCCCTGGGCTGG + Intronic
1187046002 X:15647672-15647694 TTGCCAAATACTCCCTGGGAGGG + Intronic
1187051981 X:15703974-15703996 TTGCCAAATACTCCCTGGGAGGG + Intronic
1187098379 X:16169180-16169202 TGGCCTACTTCTCCCTGGGAAGG - Intronic
1187125879 X:16454013-16454035 TTGGAAACTATTGCCTTGGAGGG + Intergenic
1188141780 X:26559086-26559108 AGGGAGAGTCCTCCCTGGGAGGG - Intergenic
1190437169 X:50437171-50437193 TGGGAAGTTGCTCCCTGGGAGGG - Intronic
1192203515 X:69081896-69081918 TGGGAAACTACCCCCTGTGGTGG + Intergenic
1196537311 X:116862628-116862650 GGGGAAACTACTCCCCTGAAGGG - Intergenic