ID: 955761784

View in Genome Browser
Species Human (GRCh38)
Location 3:62292670-62292692
Sequence AGCAAAAAAGTCTCCAGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 706
Summary {0: 1, 1: 0, 2: 35, 3: 103, 4: 567}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955761784_955761785 -5 Left 955761784 3:62292670-62292692 CCATGTCTGGAGACTTTTTTGCT 0: 1
1: 0
2: 35
3: 103
4: 567
Right 955761785 3:62292688-62292710 TTGCTTGTCACAACTGCAGATGG 0: 1
1: 0
2: 14
3: 87
4: 335
955761784_955761787 9 Left 955761784 3:62292670-62292692 CCATGTCTGGAGACTTTTTTGCT 0: 1
1: 0
2: 35
3: 103
4: 567
Right 955761787 3:62292702-62292724 TGCAGATGGATGGCATCTAGAGG 0: 1
1: 0
2: 1
3: 12
4: 157
955761784_955761786 -1 Left 955761784 3:62292670-62292692 CCATGTCTGGAGACTTTTTTGCT 0: 1
1: 0
2: 35
3: 103
4: 567
Right 955761786 3:62292692-62292714 TTGTCACAACTGCAGATGGATGG 0: 1
1: 0
2: 4
3: 23
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955761784 Original CRISPR AGCAAAAAAGTCTCCAGACA TGG (reversed) Intronic
900326916 1:2112843-2112865 AGAAAAAAAATAGCCAGACATGG - Intronic
900884885 1:5408103-5408125 ACCAAAAGTGTCTCCAGACATGG + Intergenic
901576746 1:10207429-10207451 AAAAAAAAAGTAGCCAGACATGG - Intergenic
901591505 1:10347798-10347820 AGCAAAAATGTCCCCTGGCAAGG - Exonic
901782827 1:11605349-11605371 TCCAAAAATGTCTCCAGTCATGG + Intergenic
902175442 1:14646688-14646710 AACAAAAATGTCTCCAGACATGG + Intronic
902492385 1:16793662-16793684 AACAAAAAAGTAGCCAGGCATGG - Intronic
902589205 1:17461370-17461392 TACAAAAAATTCTCCAGGCATGG + Intergenic
903429786 1:23286521-23286543 AGCAAAAGCGTCTCCAGAGGAGG - Intergenic
903494130 1:23753001-23753023 AGAAAAAAAGTAGCCAGGCATGG + Intronic
903771047 1:25764566-25764588 ACAAAAAAAGTAGCCAGACATGG - Intronic
904210323 1:28883004-28883026 AGAAAAAAATTAGCCAGACATGG - Intergenic
904635199 1:31874805-31874827 AGAAAAAAAATAGCCAGACATGG + Intergenic
904995012 1:34624937-34624959 AGGAAAAAGTGCTCCAGACAAGG + Intergenic
905751136 1:40465090-40465112 GTCAAAAATGTCTCCAGACATGG + Intergenic
905775795 1:40666301-40666323 ACCAAAAATGTCTCCAGACATGG - Intergenic
907608715 1:55846315-55846337 AGAAAGAAAGTCTCCAGAACAGG + Intergenic
907730686 1:57062568-57062590 AGGGCAAAAGTCTCCAGCCATGG - Intronic
909237818 1:73175921-73175943 AGCAAAAAATTATCCAGGCTTGG - Intergenic
909355565 1:74705099-74705121 AGCAAAAAACACTTCAGCCATGG + Intergenic
910631831 1:89363372-89363394 AGCTAAAAAATCTGCATACATGG - Intergenic
910938525 1:92507370-92507392 ACCCAAAATGTCTCCAAACATGG - Intergenic
910977239 1:92919686-92919708 AGTAAAAATTTATCCAGACAAGG + Intronic
911231096 1:95362528-95362550 AGAAAAGATCTCTCCAGACAAGG + Intergenic
911583347 1:99660728-99660750 ACCAAAAAATTATCCAGGCATGG + Intronic
911693528 1:100862325-100862347 ACCAAAAATCTCTCCAGACGTGG + Intergenic
912702005 1:111885010-111885032 ACCAAAAATGTCTCCAGACATGG + Intronic
912911380 1:113762364-113762386 AGCAACAAACTTTCAAGACAAGG + Exonic
913272460 1:117107973-117107995 TGCAAAAAATTCACCAGGCATGG + Intergenic
913353742 1:117894281-117894303 AGAAAAAAATTGGCCAGACATGG - Intronic
914046208 1:144095215-144095237 AGCTAAAAATTCTCCAGATATGG + Intergenic
914131902 1:144865470-144865492 AGCTAAAAATTCTCCAGATATGG - Intergenic
915317938 1:155040145-155040167 ACCAAAAAATTAGCCAGACATGG + Intronic
915607467 1:156961850-156961872 ACTAAAAATGTCTCCAGACATGG - Intronic
915776255 1:158490908-158490930 AGCAAGAAAGTCTCCAAGTAGGG + Intergenic
917300900 1:173573080-173573102 AGCAAAAAGGGCTCTGGACATGG - Intronic
917713871 1:177713847-177713869 AGCATAAGTGTCTTCAGACATGG - Intergenic
918417504 1:184326818-184326840 ACCAAAAATGTCTCTAGACATGG + Intergenic
918565498 1:185925762-185925784 ATCAAAAAGGTATCCAGAGAAGG + Intronic
918568860 1:185963199-185963221 AACAACAAAGTATCCAGCCATGG + Intronic
918732750 1:188018634-188018656 AGTAGAAAAGTCTCTAGAAAGGG + Intergenic
919021695 1:192114367-192114389 AGATAAAAAGTTTCCAGACCAGG - Intergenic
919624714 1:199900060-199900082 TGCAAAAAATTAGCCAGACATGG + Intergenic
919647615 1:200111074-200111096 AACAAGAAAGTCTCCACCCATGG - Intronic
920187265 1:204167624-204167646 AGCCAATAAGTCTAGAGACAAGG - Intergenic
920963627 1:210684625-210684647 GGCAAGAAAGTCCCCAGGCAAGG + Intronic
921028915 1:211319199-211319221 ATCAAAAATGTCTCCAGACATGG + Intergenic
921192015 1:212718688-212718710 ATCAAGAAAGTCTCCATAGAGGG - Intergenic
922144321 1:222923772-222923794 CCGAAAAAAGTCACCAGACAAGG - Intronic
924031269 1:239888209-239888231 TGCAAAAAAGTAGCCAGGCATGG + Intronic
924178294 1:241415529-241415551 AGCAATAATGTATCTAGACATGG + Intergenic
924191223 1:241554562-241554584 AGGAAAAAAGTGGCCAGGCATGG - Intronic
1064122493 10:12632136-12632158 AGCAACAAAGTCTGCAAACCAGG - Intronic
1065446136 10:25802952-25802974 AAAAAAAATGTCTCTAGACATGG + Intergenic
1065446474 10:25806640-25806662 AGAAATAAAGTCTCCTCACAAGG + Intergenic
1066018554 10:31273101-31273123 AGGAAAGAAATCTCCAGAGAGGG + Intergenic
1066127662 10:32357612-32357634 ATTAAAAAATTATCCAGACATGG - Intronic
1066761671 10:38760363-38760385 AGCAAAAAATTAGCCAGGCATGG + Intergenic
1066959918 10:42212058-42212080 AGCAAAAAATTAGCCAGGCACGG - Intergenic
1067059312 10:43069800-43069822 AGCAGAAGACTCTCCAGATAGGG + Intergenic
1067696409 10:48538516-48538538 AGCAGAAGACTCTCCAGACCTGG + Intronic
1068165500 10:53326673-53326695 AACAAAAATGACTCCTGACACGG - Intergenic
1068228539 10:54138577-54138599 AGCACAAAAGTCTGGATACATGG - Intronic
1068984417 10:63094085-63094107 AACAAAAATGTCCCCAAACATGG + Intergenic
1069043067 10:63714363-63714385 TGCAAAAAAGTAGCCAGGCATGG - Intergenic
1069698107 10:70402321-70402343 AATAAAAAATTATCCAGACATGG - Intergenic
1070018077 10:72555142-72555164 AGCAAAAAATTCCCCAGCAAGGG + Intronic
1070050697 10:72886789-72886811 ATGAACAAAGCCTCCAGACAAGG - Exonic
1071949556 10:90687234-90687256 TGCAAAAAGGATTCCAGACATGG - Intergenic
1072289667 10:93952523-93952545 ACCAACCAAGTCTCCCGACATGG + Intronic
1072468617 10:95691306-95691328 AACAAAAAATTATCCAGGCATGG - Intronic
1074119325 10:110481742-110481764 ACCCAAAATGTTTCCAGACATGG + Intergenic
1074241938 10:111648538-111648560 AGAATAAAAGTATCCAGAGAAGG + Intergenic
1074313375 10:112341404-112341426 ATGAGAAATGTCTCCAGACATGG - Intergenic
1075538890 10:123295708-123295730 AACTAAAATGTCTCCAGACATGG + Intergenic
1076095626 10:127733297-127733319 ACCAAAAATGTCTTCAGACATGG - Intergenic
1077590568 11:3487803-3487825 ACCAAAATTGTCTCCAGACATGG - Intergenic
1078052265 11:7976444-7976466 AGCAAAAAAGAAGCCAGAGATGG + Intronic
1078459194 11:11500475-11500497 ACCAAAAACATCTCCAGACATGG - Intronic
1081054818 11:38396448-38396470 AGCAATAAAGTCACCTGCCAAGG - Intergenic
1081591271 11:44424904-44424926 ATCAAAAATGTCTCCAGCCATGG - Intergenic
1081595402 11:44455373-44455395 AGAAAAAAAGTAGCCAGGCATGG + Intergenic
1081902283 11:46639140-46639162 TACAAAAAAGTAGCCAGACATGG - Intronic
1081955977 11:47093645-47093667 AGCAAAAAAGTATACAAACTGGG - Intronic
1082074738 11:47967458-47967480 TACAAAAAATTCGCCAGACATGG + Intergenic
1082094270 11:48115151-48115173 AGCAGAAAACTCTCCAAACCTGG + Intronic
1082735292 11:56848286-56848308 AGCTAAAAAATGTCTAGACAGGG + Intergenic
1082922427 11:58510063-58510085 GTCAAAAATGTCTCCAGACGTGG + Intergenic
1082989026 11:59191532-59191554 ACCAAAAATGTCTCCAGACATGG - Intronic
1083693788 11:64429006-64429028 ACCAAAGATGTCTCCAAACATGG - Intergenic
1084246289 11:67859584-67859606 ACCAAAATTGTCTCCAGACATGG - Intergenic
1084471528 11:69362335-69362357 AACAAAGAAGTCTCAAGACATGG - Intronic
1084826393 11:71734916-71734938 ACCAAAATTGTCTCCAGACATGG + Intergenic
1085816561 11:79743432-79743454 AGCAGAGAAGTCTCAAGTCAGGG - Intergenic
1086496747 11:87411902-87411924 CCAAAAAATGTCTCCAGACAAGG + Intergenic
1086522320 11:87683494-87683516 ATCAAAAAAATCTCCCAACAGGG + Intergenic
1087127067 11:94638931-94638953 CACACAAAAGGCTCCAGACAGGG - Intergenic
1088147387 11:106698272-106698294 AAAAAAAAAATCCCCAGACATGG - Intronic
1088353826 11:108920867-108920889 ACTAAAAATGTCTTCAGACATGG + Intronic
1089551419 11:119282015-119282037 AGCATATAAGGCTCCAGAAAAGG - Intronic
1089575000 11:119435649-119435671 ACCAAAAATGTCTCCAGACATGG - Intergenic
1090203900 11:124874630-124874652 AGGAAAATAGCTTCCAGACATGG - Intronic
1090324928 11:125877170-125877192 AACAAAGAAGTATCAAGACAAGG + Intergenic
1091492467 12:945058-945080 AGAAAAAAAGTGGCCAGGCACGG + Intronic
1092271496 12:7027436-7027458 AGAAAAAAAGCGGCCAGACATGG - Intronic
1092416855 12:8296708-8296730 ACCAAAATTGTCTCCAGACATGG - Intergenic
1092623569 12:10301230-10301252 AAGAAAAAAGTCTTCTGACAAGG - Intergenic
1093201030 12:16186260-16186282 AGCCAAACAGTTTCCTGACATGG - Intergenic
1093710827 12:22328015-22328037 ACCAAATATGTCTCCAGACTTGG - Intronic
1094165075 12:27435316-27435338 ACCAAAAATGTCTGCAGACAGGG + Intergenic
1094533220 12:31297309-31297331 AACAAAAAACTCACCAGACGTGG - Intronic
1095464726 12:42478406-42478428 AGCAAAACAGTTTTCAGAGATGG + Intronic
1096710938 12:53455080-53455102 AGCCAAAAACTCTCCATACCTGG + Intronic
1096856062 12:54484080-54484102 ATCAAAAAATTAGCCAGACAGGG - Intergenic
1097789915 12:63804146-63804168 ATCAAAAACGTCTCCAGGCCAGG - Intronic
1099398365 12:82170179-82170201 AGCAAGAAAGTCTGAAGACATGG + Intergenic
1099628742 12:85112115-85112137 AGTATAAAAGTTTCCAGAGATGG + Intronic
1099827909 12:87802271-87802293 AGCAAAAATGTTTCCAGAAATGG - Intergenic
1100234366 12:92644109-92644131 AGCAAAAAAGACTCCACTGAAGG - Intergenic
1101268116 12:103113538-103113560 ACCCAAAATGTCTCCAGACATGG - Intergenic
1101878631 12:108611452-108611474 ACCAAACACGTCTCCAGACATGG + Intergenic
1101947311 12:109147378-109147400 AAAAAAAAAGTAGCCAGACATGG - Intronic
1102401392 12:112632694-112632716 ATCAAAATTGTCTCCAGGCATGG - Intronic
1102580575 12:113884126-113884148 AACAAAAAACTCGCCAGGCATGG + Intronic
1103287146 12:119812099-119812121 ACAAAAAAAGTATCCAGGCATGG - Intronic
1103289287 12:119831019-119831041 ATCAAAAAATTAGCCAGACATGG - Intronic
1103844632 12:123892871-123892893 AGCAGAAATATCTCCAGACATGG + Intronic
1104030130 12:125058974-125058996 AGCAATTCAGTCTCCAGGCAGGG - Intergenic
1104465680 12:128988374-128988396 AGCAAAAAATTAGCCAGACATGG + Intergenic
1104615919 12:130268495-130268517 ACCAAAAATGTCTCCAGACATGG - Intergenic
1105343973 13:19556679-19556701 AGAAAAAAATTATCCAGGCATGG - Intergenic
1105412077 13:20178654-20178676 AACAAGTAAGTCTCCAGACCGGG - Intergenic
1105855407 13:24367309-24367331 TGCAAAAAGGTCTCCAGTCTAGG + Intergenic
1106056023 13:26238074-26238096 AAAAAAAAATTATCCAGACATGG - Intergenic
1106701521 13:32234265-32234287 CACAAAAAAGTATCCAGGCATGG + Intronic
1106935611 13:34715674-34715696 TGCAAAAAATTCACCAGGCATGG + Intergenic
1107377122 13:39815934-39815956 ATCAAAAATATCTCCAGACATGG + Intergenic
1107477472 13:40752892-40752914 AGAAAAAAATTATCCAGGCATGG - Intronic
1108152850 13:47554284-47554306 AGAAAAAAAGTATCCACAAATGG + Intergenic
1108669953 13:52675896-52675918 ACCCACAATGTCTCCAGACATGG + Intronic
1108698527 13:52924326-52924348 ACCAAAAATGTCTCTAGACATGG - Intergenic
1108915738 13:55608680-55608702 ACCAAAAATATTTCCAGACATGG - Intergenic
1108977634 13:56468562-56468584 AATAAAAATGTCTCCACACAAGG + Intergenic
1109204301 13:59464929-59464951 AGAAAAAAAGTCTGTGGACAGGG + Intergenic
1111402902 13:87764472-87764494 GGAAAAAAAATCTCCGGACAGGG + Intergenic
1112055680 13:95688666-95688688 TGCAAAAAAGTAGCCAGGCATGG - Intronic
1112359590 13:98705451-98705473 ACAAAAAATGTCTCCAGAGATGG + Intronic
1112739619 13:102458184-102458206 AGCATAAAAGTTTACAGCCAAGG + Intergenic
1113058176 13:106291510-106291532 AGAAAAAGAGTGTCCAGAGAGGG + Intergenic
1113627071 13:111855251-111855273 ACAAAAAAATTATCCAGACATGG - Intergenic
1114501536 14:23172687-23172709 ACCAAAAGTGTCTCCAGATACGG - Intronic
1115326750 14:32147995-32148017 TGCAAAAAATTAGCCAGACATGG + Intronic
1115692597 14:35860283-35860305 ACAAAAAAATTATCCAGACATGG - Intronic
1116352895 14:43888137-43888159 ACCATAAATGTCTTCAGACATGG + Intergenic
1117328648 14:54691257-54691279 AGGGATAATGTCTCCAGACAAGG - Intronic
1117975170 14:61290001-61290023 AGGAAAAATGTGTCCAGGCACGG + Intronic
1118391504 14:65299577-65299599 ACAAAAAAAGGCTCCTGACAGGG + Intergenic
1119362655 14:74064140-74064162 AACAAAAAATTATCCAGGCATGG + Intronic
1120210211 14:81626803-81626825 ACCAAAAATGTCTTCAGTCATGG + Intergenic
1120226180 14:81793437-81793459 AACAAAAAAGTAGCCAGGCATGG - Intergenic
1121084092 14:91132137-91132159 AGAAATCAAGTTTCCAGACATGG + Intronic
1121171462 14:91857871-91857893 AGCAAAAAAGTGTTCATGCAGGG + Intronic
1121744814 14:96279806-96279828 GCCAAAGACGTCTCCAGACATGG - Intergenic
1122702515 14:103599352-103599374 AACAAAAAATTAGCCAGACATGG + Intronic
1123179711 14:106458508-106458530 AGGAAAAAATACTCAAGACATGG + Intergenic
1202933023 14_KI270725v1_random:56720-56742 AGCAAAAAATTAGCCAGGCACGG + Intergenic
1123920955 15:25069417-25069439 AGCCAAACAATCTCAAGACACGG - Intergenic
1125082894 15:35696564-35696586 ATCAAAAAATCCGCCAGACACGG - Intergenic
1125659986 15:41386253-41386275 ACAAAAAAAGTAGCCAGACATGG + Intergenic
1128457771 15:67842191-67842213 AAAAAAAAAGAGTCCAGACATGG - Intergenic
1129918522 15:79296782-79296804 ACCAAAAATGTCTCTAGACGTGG + Exonic
1130092678 15:80834105-80834127 TCCCAAAATGTCTCCAGACATGG + Intronic
1130308577 15:82732729-82732751 AGCCTAAAAGTTTCCAGAGAAGG - Intergenic
1130359169 15:83165637-83165659 TGCAAAAAAGTAGCCAGACATGG + Intronic
1130774471 15:86964420-86964442 ACAAAAAATGTGTCCAGACATGG + Intronic
1130935170 15:88464060-88464082 ACCAAAAATATCTCTAGACATGG - Intronic
1130980444 15:88808586-88808608 ACAAAAAATGTCTCCAGACATGG - Intronic
1131156389 15:90078610-90078632 ACCATAAATGTCTCCAAACATGG - Intronic
1131205092 15:90437832-90437854 TTCAAAAAATTCTCCAGACTGGG - Intronic
1131235947 15:90697309-90697331 AGCACAAAAGCCACCTGACAGGG + Intergenic
1131277736 15:90995967-90995989 AAAAAAAAAGTATCCAGGCATGG - Intergenic
1131394191 15:92073795-92073817 AGCAAAACTGTCTTCAGACATGG + Intronic
1131529319 15:93178660-93178682 AGCCTAAATGTCTCCAGCCACGG - Intergenic
1132029576 15:98428936-98428958 ACCAAAAATATCTCCAGACATGG + Intergenic
1132195631 15:99912705-99912727 TGCAAAAAAGTAGCCAGACATGG - Intergenic
1132949898 16:2555541-2555563 AGAAAAAAAGTCACCAGGCATGG + Intronic
1132964450 16:2644626-2644648 AGAAAAAAAGTCACCAGGCATGG - Intergenic
1133174811 16:4006142-4006164 ACCAAAAATGTCTCCAGACATGG - Intronic
1133274836 16:4631464-4631486 ATCACAAATGTCTCCAGACATGG - Intronic
1133355937 16:5136888-5136910 ACCAAAACTGTCTCCAGACATGG - Intergenic
1133755377 16:8758679-8758701 ACCAAAAATGTCTGCAGACATGG + Intronic
1133826244 16:9280707-9280729 ACCAAAAATGTCTCTAGATATGG - Intergenic
1134213406 16:12297014-12297036 ATCACAAATGTCTCCAGACATGG + Intronic
1134394194 16:13848095-13848117 AGCCAAAATGTCTCCAGACATGG + Intergenic
1134827411 16:17295707-17295729 AACAAAAATGTCTCCAGACATGG - Intronic
1134860430 16:17555670-17555692 ATCAAAAATGTCTCCAGACATGG + Intergenic
1135142441 16:19933171-19933193 TCCAAAAATGTCTCCAGACATGG - Intergenic
1135350064 16:21721375-21721397 ACCAAAAATGTTTGCAGACATGG - Intronic
1135550837 16:23397062-23397084 AGTAAAAAATTATCCAGGCATGG - Intronic
1136342191 16:29651623-29651645 AGAAAAAAAGTAGCCAGGCATGG - Intergenic
1136736344 16:32471036-32471058 AACAAAAAAGTGTCAAGAAAAGG - Intergenic
1137294064 16:47073409-47073431 AGCAAAACTGTCCCCAGACATGG - Intergenic
1137883905 16:52081349-52081371 AGTAAACAGGTCTCCAGTCAGGG + Intergenic
1138969111 16:62123576-62123598 ATCAAAAAAGTATCCAGGCATGG - Intergenic
1139509309 16:67417406-67417428 AGCAAAAAACTCTCTGGTCAGGG + Intergenic
1139928274 16:70504304-70504326 AACAAAAAATTATCCAGTCAAGG + Intronic
1140533288 16:75685089-75685111 AGAAAAAAATTCACCAAACAAGG - Intronic
1140556293 16:75925224-75925246 ACCCAAAATGTCTCAAGACATGG + Intergenic
1140700189 16:77574536-77574558 ACCAAAAATGAATCCAGACATGG + Intergenic
1140954117 16:79846742-79846764 AACAAAAATGTCTCCATGCATGG - Intergenic
1141058793 16:80844405-80844427 AGCTCAAAAGTCTCCAATCAGGG + Intergenic
1141371930 16:83495740-83495762 AGCCAAAAAGTCTCAAAAGAGGG - Intronic
1141440007 16:84024124-84024146 ACCCAAAATGTCTGCAGACATGG + Intronic
1141521991 16:84586738-84586760 ACCAAAAAAGTAGCCAGGCATGG - Intronic
1141721340 16:85757173-85757195 AGTAAAAAAGTAGCCAGGCATGG + Intergenic
1141746713 16:85931070-85931092 ACCAAAAATGTCTCCAGACATGG - Intergenic
1141756132 16:85992200-85992222 ACAAAAAATGTCCCCAGACATGG + Intergenic
1142164134 16:88576601-88576623 AACAGAAAAGGCTCCAGACTTGG + Intronic
1203016725 16_KI270728v1_random:358539-358561 AACAAAAAAGTGTCAAGAAAAGG + Intergenic
1203035060 16_KI270728v1_random:631697-631719 AACAAAAAAGTGTCAAGAAAAGG + Intergenic
1143232737 17:5371120-5371142 AACAAAAAATTCTCCAGGCGTGG - Intronic
1143456842 17:7073564-7073586 AACACAAAAGTAGCCAGACATGG + Intergenic
1143687730 17:8532476-8532498 AGGTAAGGAGTCTCCAGACAGGG + Intronic
1144043533 17:11434032-11434054 AGAAAAAATGTTTCCAAACAAGG - Intronic
1144398244 17:14867115-14867137 AGGAAGAGGGTCTCCAGACAGGG + Intergenic
1144666658 17:17106703-17106725 AGGAAAAAAGACGCCACACATGG + Intronic
1144757867 17:17691185-17691207 ACCAAAAATGTCTCCTGACATGG - Intronic
1145183923 17:20777984-20778006 AACTAAAAAGTAGCCAGACATGG + Intergenic
1145184521 17:20782761-20782783 AACAAAAAATTAGCCAGACATGG - Intergenic
1146315471 17:31803358-31803380 AAAAAAAAAGTATCCAGGCATGG + Intergenic
1146433766 17:32823251-32823273 AGCACAAAAGTCACAAGCCAAGG + Intronic
1146720096 17:35118157-35118179 ATCAAAAATGTCTCCTGACATGG - Intronic
1147540932 17:41359007-41359029 AGTAAAAAATTAGCCAGACATGG + Intergenic
1147855119 17:43473932-43473954 ACCAAAAATGTCTCCAGACATGG - Intergenic
1147883397 17:43668519-43668541 TACAAAAAATTCTCCAGGCATGG + Intergenic
1147909083 17:43844071-43844093 ATCAAAAATGTCTCCAGGCTGGG - Intergenic
1148198818 17:45734340-45734362 GGCAAAAAAGTCATCAGAGATGG - Intergenic
1148204684 17:45772658-45772680 AAAAAAAAAGTATCCAGTCATGG - Intergenic
1150356134 17:64486515-64486537 AGAAAAAAATTAGCCAGACATGG - Intronic
1150383625 17:64740278-64740300 ACCAAAAATGTCTCCAGGCCAGG + Intergenic
1150694771 17:67395294-67395316 AGAAAAAAATTAGCCAGACATGG - Intronic
1150749163 17:67844237-67844259 AAAAAAAAATTCGCCAGACATGG - Intronic
1151179119 17:72312903-72312925 AGCAAAACTGTCTCCAGACATGG + Intergenic
1151227984 17:72660868-72660890 AACCAAAACGTCTCCAGACATGG + Intronic
1152045114 17:77930348-77930370 AGTGGAAAAGCCTCCAGACAGGG - Intergenic
1152217011 17:79039209-79039231 ACAAAAAATGTCTCCAAACATGG - Intronic
1152385777 17:79973736-79973758 AACAAAAAATTATCCAGGCATGG + Intronic
1203167142 17_GL000205v2_random:107827-107849 AACAAAAAATTAGCCAGACATGG - Intergenic
1153196186 18:2599510-2599532 AGCAAAAAAGACTCTGGAGATGG + Intronic
1153332248 18:3885743-3885765 AGCAAAAAAATCAGGAGACATGG - Intronic
1155115167 18:22757949-22757971 AGAAAAAAAGTAGCCAGGCATGG + Intergenic
1155408825 18:25519596-25519618 AACAAAAAATTAGCCAGACATGG - Intergenic
1156330065 18:36112909-36112931 AGGAAAAAACTCTCCTGTCAAGG + Intronic
1157775389 18:50391437-50391459 ACCAAAAATGTCTCCAGACATGG - Intronic
1157998749 18:52591736-52591758 AGAAAAAAAGTAGCCAGGCATGG - Intronic
1158013131 18:52751872-52751894 AGCAAAAAAGTACCCAGTCGAGG - Intronic
1158466072 18:57691017-57691039 TACAAAAAAGTAGCCAGACATGG + Intronic
1159101689 18:63965524-63965546 AGAAAAAAAGGCTCCTGATATGG - Intronic
1159158252 18:64610535-64610557 AACAAAAATGTCTCCAGATGTGG + Intergenic
1159309958 18:66694431-66694453 ACTAAAAAAATCTCCAGAAATGG - Intergenic
1159856916 18:73599738-73599760 AGGAAAAAAGTCCTCAGGCATGG - Intergenic
1161121215 19:2527810-2527832 AGCACAAATGTCCCCAGACTTGG + Intronic
1161328660 19:3675861-3675883 ACCACAGATGTCTCCAGACATGG + Intronic
1161496537 19:4589435-4589457 AACAAAAAATTAGCCAGACATGG + Intergenic
1161523049 19:4736558-4736580 ACCACAAATGTCCCCAGACATGG - Intergenic
1161774984 19:6256059-6256081 TGCAAAAAATTAGCCAGACACGG + Intronic
1161938060 19:7384294-7384316 ATCAAAAATGTCTCCAGACATGG + Intronic
1162331756 19:10034139-10034161 ATGAAAAAACTCTCCAGACTCGG - Intergenic
1162684692 19:12372301-12372323 ACAAAAAAATTATCCAGACATGG + Intergenic
1163399491 19:17083498-17083520 ACCAGAAATGTCTCCAGACATGG + Intronic
1163446549 19:17350205-17350227 TGCAAAGAATTCTCCAGAAAAGG - Intergenic
1163540205 19:17904336-17904358 ATCAAAATTGTTTCCAGACATGG + Intergenic
1163874868 19:19859527-19859549 AGAAAAAGAGGCGCCAGACACGG + Intergenic
1163932071 19:20404659-20404681 AGCAAACAATTAGCCAGACATGG + Intergenic
1163944910 19:20526958-20526980 AGCAAACAATTAGCCAGACATGG - Intergenic
1163946977 19:20546722-20546744 AGCAAACAATTATCCAGACATGG + Intronic
1163967488 19:20761056-20761078 AGCAAAAAAATAGCCAGGCACGG + Intronic
1163971470 19:20800170-20800192 AGCAAACAATTAGCCAGACATGG - Intronic
1163974131 19:20832478-20832500 AGCAAACAATTATCCAGACATGG + Intronic
1164677736 19:30112975-30112997 AGAAAAAAATTATCCAGGCATGG + Intergenic
1164940563 19:32250046-32250068 TGCAAAAAATTCGCCAGGCATGG - Intergenic
1165476468 19:36033563-36033585 CAAAAAAAATTCTCCAGACATGG - Intergenic
1165526868 19:36363550-36363572 ACCAAAATTGTCTCCAGATATGG - Intronic
1165527974 19:36372168-36372190 AGCAAAAAACTTTCCAAACCTGG + Intronic
1166154904 19:40903646-40903668 AGCAGAAAAGTCTTCAGAACAGG + Intergenic
1166552121 19:43672886-43672908 TGCAAAAAATTCGCCAGGCATGG - Intergenic
1166828125 19:45621898-45621920 AACAAAAAATTCGCCAGGCATGG - Intronic
1168168800 19:54573137-54573159 AGCAAAAAATTAGCCAGGCATGG - Intronic
1168416948 19:56175344-56175366 AACAAAACTGTCTCCAGACTTGG + Intergenic
1168421586 19:56207679-56207701 AACAAAAATGTCTCTAGACATGG - Intronic
1168504895 19:56925333-56925355 ATCACAAATTTCTCCAGACATGG - Intergenic
1168591144 19:57635001-57635023 ATCTAGAAAGTCACCAGACAGGG - Intronic
1202685761 1_KI270712v1_random:48630-48652 AGCTAAAAATTCTCCAGATATGG + Intergenic
925432323 2:3805984-3806006 AACAAAAAATTCGCCAGGCATGG - Intronic
925777686 2:7350665-7350687 TGCCAAAAAGTCTCCACCCAAGG + Intergenic
927395262 2:22643053-22643075 AGGCAAAAAGTCTTCAGTCAAGG - Intergenic
928477225 2:31640863-31640885 AAAAAAAAAGTCTCCTGCCAGGG + Intergenic
928492937 2:31803127-31803149 AAAAAAAAAGTATCCAGGCATGG + Intergenic
928961209 2:36928227-36928249 AGCTAAAAATTCTCCAGATATGG + Intronic
929085714 2:38165314-38165336 AACCAAAAAGTCTCCAGACATGG - Intergenic
929607312 2:43243290-43243312 ACCAAAAATGTCTCCAGACACGG - Intronic
930614994 2:53584572-53584594 TGCAAAAAATTAGCCAGACATGG - Intronic
931111436 2:59115497-59115519 AAAAAAAAATTATCCAGACATGG - Intergenic
931119937 2:59205236-59205258 AAAAAAAAATTCTTCAGACAAGG + Intergenic
931384309 2:61783699-61783721 ATAAAAAAATTATCCAGACATGG - Intergenic
931478276 2:62612705-62612727 AGGAAAAAAGTGGCCAGGCACGG + Intergenic
931630867 2:64297481-64297503 AGAACAAAATTTTCCAGACAAGG + Intergenic
932643431 2:73475653-73475675 AGTAAAAAAGTCTACAGAATGGG - Intronic
933486783 2:82934108-82934130 AACAAACAAGTGTCCAGCCAGGG + Intergenic
934187510 2:89760162-89760184 AACAAAAAAGTGTCAAGAAAAGG - Intergenic
934245963 2:90306194-90306216 AGCTAAAAATTCTCCAGATATGG - Intergenic
934262783 2:91490841-91490863 AGCTAAAAATTCTCCAGATATGG + Intergenic
934309121 2:91847777-91847799 AACAAAAAAGTGTCAAGAAAAGG + Intergenic
934324981 2:92005030-92005052 AGCAAAAAATTAGCCAGGCACGG + Intergenic
934463362 2:94235742-94235764 AGCAAAAAATTAGCCAGGCACGG + Intergenic
935159172 2:100514395-100514417 ATCCAAAAATTATCCAGACATGG - Intergenic
935313803 2:101811453-101811475 AGCATAAAAGAAACCAGACAAGG - Intronic
936018655 2:108978236-108978258 AGCAGAAAAGGATCCAGGCAGGG + Intronic
936407307 2:112217213-112217235 AGAAAAAAATTAGCCAGACATGG + Intronic
936864938 2:117066636-117066658 ACCAAATATGTCTCCAGACCTGG - Intergenic
937342884 2:121102829-121102851 TGCAAAAAAGTGTCCTGAAAGGG + Intergenic
937524780 2:122754955-122754977 ACCAAAAATGTCCCTAGACATGG + Intergenic
937575457 2:123415540-123415562 AGCAAAAAAATCTCTGGCCATGG + Intergenic
937699900 2:124852391-124852413 AGGAATAAAGTCTCCAAAGAAGG + Intronic
938035991 2:128035433-128035455 AGCAAAAAATTAGCCAGGCATGG - Intergenic
938550704 2:132379520-132379542 AGCATAAAAGCCTGCATACATGG + Intergenic
938564611 2:132507527-132507549 AGCTAAAAAGTCCCAAGACTAGG + Intronic
938663373 2:133509675-133509697 ATGAAAACTGTCTCCAGACATGG - Intronic
938780123 2:134577141-134577163 ATCAAAAAAGGCTCAAAACATGG - Intronic
939700571 2:145386202-145386224 AGGAAAAAAGTCCCCCGAGAGGG + Intergenic
940124107 2:150304652-150304674 AACTAAAAAGTCTCCAGTGATGG + Intergenic
940150253 2:150592226-150592248 ACCAAAAATGTCTGGAGACATGG + Intergenic
941390128 2:164902182-164902204 TGCAAAAAATTACCCAGACATGG - Intronic
942380898 2:175388954-175388976 AACTAAAAAGTTTCCTGACATGG - Intergenic
943053369 2:182944809-182944831 AGCAAAGAAGTGGCCAGGCATGG + Intronic
943673983 2:190698624-190698646 TTCAAAAAATTATCCAGACATGG - Intergenic
943743822 2:191440131-191440153 AGCAAAATAGTGGCCAGGCACGG - Intergenic
945340518 2:208647367-208647389 AGTAAAACAGTCTTCAGAAAAGG + Intronic
945366880 2:208965441-208965463 AGCATAAAAGTCTGGATACATGG + Intergenic
945883829 2:215354017-215354039 AAAAAAAAAGTTTCCTGACAAGG - Intergenic
946848566 2:223882881-223882903 ATCAAAAAATTAGCCAGACATGG - Intronic
947704386 2:232262506-232262528 ATCAAAAATGTCTCCAGACATGG - Intronic
947868434 2:233418193-233418215 AGCACCTCAGTCTCCAGACAGGG - Intronic
948127232 2:235573238-235573260 AGTAAAAAAGTAACCAGGCATGG - Intronic
948477577 2:238230236-238230258 TGCAAAAAATTAGCCAGACATGG - Intronic
948830342 2:240595541-240595563 AGCAACAGAGTCTGCAGCCAGGG + Intronic
949048477 2:241883744-241883766 AGGAAAAAAGTGGCCAGGCACGG - Intergenic
1169012294 20:2260622-2260644 ATAAAAAAATTATCCAGACACGG + Intergenic
1169050770 20:2576169-2576191 AGGAAAAAAGTTTCAAGTCATGG - Intronic
1169189991 20:3652533-3652555 AGTCAAAAAGTCAGCAGACATGG - Intergenic
1169255885 20:4098138-4098160 TGCAAAAAATTATCCGGACATGG - Intergenic
1169320467 20:4628976-4628998 AGCAAAGAAATTACCAGACACGG + Intergenic
1169441456 20:5637202-5637224 AAAAAAAAAGTTACCAGACATGG - Intergenic
1170472645 20:16683623-16683645 ATCAAAAATGTCTCCAGACCAGG - Intergenic
1170642462 20:18166676-18166698 GGCAAAAGAATCTCCAGAGAGGG - Intronic
1171163906 20:22954000-22954022 AACAAAAAAAGCTACAGACAGGG + Intergenic
1171220751 20:23394788-23394810 TGCCAGAAAGTCTCCAGGCAAGG + Intronic
1172301327 20:33852571-33852593 ACCAAAAATGTCTTCAGACATGG + Intronic
1172805253 20:37607308-37607330 TGTAAAACAGTCTCCAGGCAAGG - Intergenic
1172953461 20:38738021-38738043 ATAAAAAAAGTAGCCAGACATGG - Intergenic
1173200060 20:40947875-40947897 AGAAAAAAATTATCCAGGCATGG - Intergenic
1174091618 20:48053242-48053264 ATCAAAAAATTAGCCAGACATGG - Intergenic
1174177551 20:48654526-48654548 AACAAAAATGTCTCCGGGCAGGG + Intronic
1174204750 20:48830066-48830088 ATCAAAAATGTCTCCAGGCTGGG + Intergenic
1174254026 20:49240857-49240879 ATCAAAAAATTAGCCAGACATGG + Intronic
1174371159 20:50089041-50089063 AGGAAAAAAGACTCCACACTAGG + Intronic
1174483770 20:50848855-50848877 AAGAAAAGAGTCTCCAGAAAGGG + Intronic
1174498722 20:50968486-50968508 AATCAAAATGTCTCCAGACATGG - Intergenic
1174565032 20:51458361-51458383 ACCAAGATTGTCTCCAGACAAGG + Intronic
1174569951 20:51494333-51494355 AGCAGAAAAGCCACCAGCCAGGG - Intronic
1175154339 20:56959554-56959576 ACCAAAAATGTCTCCGGACATGG + Intergenic
1175266339 20:57705777-57705799 GCCAGAAATGTCTCCAGACATGG - Intronic
1175545619 20:59775974-59775996 ATCTAAAATGTCTCCAGACTTGG + Intronic
1176404617 21:6351272-6351294 AACAAAAAATTAGCCAGACATGG + Intergenic
1176432540 21:6637832-6637854 AACAAAAAATTAGCCAGACATGG - Intergenic
1176594409 21:8678793-8678815 AGCAAAAAATTAACCAGGCATGG + Intergenic
1177594289 21:23215447-23215469 GGCAAGAAAGTCTGAAGACATGG + Intergenic
1177844840 21:26277319-26277341 AGCAAAAAGTACTCCAGAAAAGG - Intergenic
1178292584 21:31381674-31381696 AACAAAAAAATAGCCAGACATGG + Intronic
1178662318 21:34518117-34518139 AGCCAAAAATTATCCAGACCAGG - Exonic
1179025700 21:37676705-37676727 ATCAAAAATGTCTCCAGACATGG - Intronic
1179143623 21:38748905-38748927 AGCAAAAATGACTGCAGGCAAGG - Intergenic
1179355571 21:40655596-40655618 AGAAAAAAATTAGCCAGACATGG - Intronic
1179371581 21:40810747-40810769 ATTAAAAAACTATCCAGACATGG + Intronic
1179578975 21:42326747-42326769 AAAAAAAAAGTGGCCAGACATGG + Intergenic
1179601633 21:42481505-42481527 AGAAAGAAAGTATGCAGACATGG + Intronic
1180277262 22:10655927-10655949 AGCAAAAAATTAACCAGGCATGG + Intergenic
1180536206 22:16394891-16394913 AACAAAAAAGTGTCAAGAAAAGG + Intergenic
1180584486 22:16874815-16874837 AGCAAAAAATTAGCCAGGCACGG + Intergenic
1181775017 22:25153329-25153351 ACCAAAAATGTCTCCAGACAAGG - Intronic
1181895008 22:26099516-26099538 ATCAAAAAATTATCCAGGCATGG - Intergenic
1181974850 22:26721662-26721684 ACCAAAAACATCTCAAGACATGG - Intergenic
1182125333 22:27811629-27811651 AGCAAAAAGCCCTCCAGCCATGG - Intergenic
1183173756 22:36206797-36206819 AGCAAAAGAATCTCCAGTCACGG + Intergenic
1183396744 22:37575998-37576020 ACCAAGAATGTCTCCAGACAGGG + Intronic
1183725807 22:39589120-39589142 ACCAAAAATGTCTCCAGACACGG + Intronic
1184429424 22:44432647-44432669 AGAAAAAAAGTCTTCACACCTGG + Intergenic
1184461892 22:44642684-44642706 ATCCAAAAAGTAGCCAGACATGG + Intergenic
1184588132 22:45461552-45461574 ACCAAAAAATTATCCAGGCATGG + Intergenic
1184898076 22:47423984-47424006 AGCAGAGAAGTCTCCAGGCCTGG - Intergenic
1203290730 22_KI270735v1_random:35812-35834 GGCAAAAAAGGGTCCAGAAATGG - Intergenic
949809043 3:7986087-7986109 AGGAATAAAATCTCAAGACAGGG + Intergenic
950510462 3:13422827-13422849 ATACAAAAAGTCGCCAGACATGG + Intergenic
951072199 3:18343452-18343474 AGAAAAAAAATCTCTAAACAGGG - Intronic
951902178 3:27667603-27667625 AAAAAAAAATTGTCCAGACAGGG + Intergenic
952000144 3:28775698-28775720 ATCAAAAATGTCTCCAGGCATGG - Intergenic
952246176 3:31595005-31595027 ACCAATAAAGTCTCCATAAAAGG - Intronic
953394640 3:42558024-42558046 ACCAGAAATGACTCCAGACATGG - Intronic
954092428 3:48295695-48295717 AGCAAAAAATTAGCCAGGCATGG - Intronic
954185267 3:48912200-48912222 AAAAAAAAATTCTCCAGGCATGG + Intergenic
955063925 3:55518119-55518141 ATCAAAAATGTCTCAGGACATGG + Intronic
955246944 3:57233926-57233948 AGAAAAAAAGTAGCCAGACATGG + Intronic
955738836 3:62067867-62067889 ACCAAAAATGTCTCTAGACATGG + Intronic
955744952 3:62131257-62131279 ACGAAAAACGTCTCCAGACATGG + Intronic
955761784 3:62292670-62292692 AGCAAAAAAGTCTCCAGACATGG - Intronic
955775435 3:62427595-62427617 ACCAGGAATGTCTCCAGACATGG + Intronic
956067846 3:65415787-65415809 ACCAATAATGTCTTCAGACAGGG - Intronic
956591470 3:70919690-70919712 AGCAAAAGAAACTTCAGACACGG + Intergenic
957355142 3:79073738-79073760 AGCACAAATGTGTTCAGACAAGG - Intronic
957667265 3:83248812-83248834 AACAAAAAATTAGCCAGACATGG + Intergenic
958948852 3:100395400-100395422 AACAAAAAATTCACCAGGCATGG + Intronic
959541517 3:107544859-107544881 AGAAAAAAAGTAGCCGGACATGG + Intronic
960198481 3:114800801-114800823 AGCAAGAATCTTTCCAGACAGGG + Intronic
960603741 3:119483808-119483830 ATCAAAAATGTCTACAGACATGG + Intronic
961587643 3:127947154-127947176 AAGAAAAAAATCACCAGACATGG - Intronic
961894407 3:130155309-130155331 ACCAAAATTGTCTCCAGACATGG - Intergenic
962399689 3:135047800-135047822 AACCAAAATGTCTCCAGACATGG - Intronic
962439912 3:135403903-135403925 AGTAAAGAAGTCAACAGACAGGG + Intergenic
962485874 3:135841717-135841739 AGCAAACATGCCTCCAGCCAAGG + Intergenic
962676045 3:137759505-137759527 AGCAAAAAAGTCTCCTTACCTGG + Intergenic
962857758 3:139364372-139364394 AACTAAAGAGTCTCCAGACCAGG + Intronic
963151610 3:142051242-142051264 ATCAAAAATGTCTCCAGGCCTGG + Intronic
963646064 3:147915910-147915932 ATCAAAAATGTCTCCAGGCCGGG - Intergenic
963897460 3:150702569-150702591 ATCAAAAATGTCTCCAGGCCGGG - Intronic
964195467 3:154059257-154059279 TACAAAAAATTCGCCAGACATGG - Intergenic
964249330 3:154692363-154692385 ACCAAAAATGTCTACAGACATGG - Intergenic
965238824 3:166165414-166165436 AGCAAAAAAGACATGAGACATGG - Intergenic
965803931 3:172523151-172523173 AGCAGGAAAGTCTTCAGAGAGGG + Intronic
966633752 3:182108659-182108681 AGCAAAAGATTCTCCAAGCAAGG - Intergenic
966957965 3:184903618-184903640 AAAAAAAAATTCTCAAGACAGGG + Intronic
966976592 3:185089396-185089418 AGTAAAGAAGTCTTCAGTCAAGG - Intronic
967232208 3:187350606-187350628 ACCAAAACTGACTCCAGACAAGG + Intergenic
967398273 3:189031133-189031155 AACAAAAAATTATCCAGACGTGG + Intronic
967826346 3:193880652-193880674 ACAAAAAAAGTAGCCAGACATGG + Intergenic
968132983 3:196202842-196202864 AGCAGCCAAGTCTCCTGACAGGG - Intronic
969004497 4:4008388-4008410 ACCAAAACTGTCTCCAGACATGG - Intergenic
969130963 4:4990917-4990939 AGCCAAAAACGCCCCAGACATGG - Intergenic
969249716 4:5959036-5959058 ACCAAAAATGTCTCCAGACATGG + Exonic
969748371 4:9091760-9091782 ACCAAAACTGTCTCCAGACATGG + Intergenic
969809402 4:9636319-9636341 ACCAAAACTGTCTCCAGACATGG + Intergenic
971359790 4:25926544-25926566 AGCAAGAAAGTGTGAAGACAGGG + Intronic
971796253 4:31232694-31232716 AGTAAAAGGGTCTCTAGACATGG + Intergenic
972004436 4:34081602-34081624 AGCAAAAAAACCTTCAGGCATGG + Intergenic
972601727 4:40578961-40578983 AACAAAAAATTAGCCAGACATGG + Intronic
973045224 4:45528985-45529007 AACAAAAAATTAGCCAGACATGG + Intergenic
973348600 4:49083309-49083331 AGCAAAAAAGTCTCTCCCCATGG - Intergenic
973700625 4:53533693-53533715 ATCAAAAATGTCTCCAGGCTGGG - Intronic
973906299 4:55535082-55535104 AGAAAAAAATTAGCCAGACATGG - Intronic
974560084 4:63506214-63506236 AGCACAGCAGTCTCCAGACTGGG + Intergenic
975600346 4:76093269-76093291 ATAAAAAAAGTATCCAGGCATGG + Intronic
976064846 4:81174008-81174030 AGCAAAAAATTATCTAAACAGGG - Intronic
976337393 4:83906162-83906184 ACCAAAAATGTCTCCAGACATGG + Intergenic
976426580 4:84910859-84910881 AGAAAAAAATTAGCCAGACATGG - Intronic
977620284 4:99128278-99128300 TACAAAAAAGTAGCCAGACATGG + Intronic
978343185 4:107738875-107738897 GGCTAGAATGTCTCCAGACAAGG + Intergenic
978359840 4:107919271-107919293 AGGAAAAAAGTAGCCAGACGTGG + Intergenic
978611844 4:110550250-110550272 AGCAAAAGAGTTTCCTGACAAGG + Intronic
979971904 4:127145916-127145938 AAAAAAAAAGTGTCCAGAAAAGG + Intergenic
982190778 4:152853440-152853462 AGAAAAAAACTGTCCAGCCAAGG - Intronic
983423796 4:167556324-167556346 AACAAAAAATTAGCCAGACATGG - Intergenic
983646828 4:170000010-170000032 ACCAAAAATGTCTCCAGACTTGG + Intronic
983840088 4:172447177-172447199 AGGAAAAGAGTCTCCAGAAGAGG + Intronic
984498736 4:180532013-180532035 ACCAAAAATGTCTCCAGAAATGG - Intergenic
984800043 4:183706365-183706387 TGCAAAAAATTAGCCAGACATGG + Intronic
985384344 4:189429561-189429583 AGAAAAAAAGTCTCTACAGAGGG + Intergenic
986704831 5:10446361-10446383 ATCAAAAATGTCTCCAGGCCGGG + Intronic
986732554 5:10645906-10645928 ACCAAAAATGTCTACAGACGTGG - Intronic
987062566 5:14256591-14256613 AGCAAAATAGTCCCCAGACTTGG - Intronic
987259726 5:16190910-16190932 ACCAAAAATGTCTCCAGACATGG - Intergenic
988425130 5:31055147-31055169 TACAAAAAATTCGCCAGACATGG + Intergenic
988624000 5:32851640-32851662 AGCACAAAGGTCTTCAGAGATGG - Intergenic
989371725 5:40717617-40717639 AACAAAAATGTCTCTAGACATGG + Intronic
989388143 5:40873360-40873382 ACCAAAAAATTAGCCAGACATGG + Intergenic
990334983 5:54763843-54763865 ATCAAAAACGTCTTCTGACAAGG - Intergenic
990669526 5:58112558-58112580 ACTAAAAATGTCTCCAGACATGG + Intergenic
990743597 5:58936706-58936728 ATTAAAAAAGTATCCAGGCATGG - Intergenic
991390806 5:66141620-66141642 AACAAAAAAGTAGCCAGGCATGG - Intronic
992309443 5:75480595-75480617 AGTAAAAAAGTCTGGAGACCAGG - Intronic
992934939 5:81693047-81693069 ACAAAAAAATTATCCAGACATGG + Intronic
993032082 5:82716185-82716207 AGAAAAAATGTCTAGAGACAGGG + Intergenic
993034852 5:82745501-82745523 ACCAAAACTGTCTCCAGACATGG + Intergenic
994109771 5:95988136-95988158 AGCAAAAATGTCTCCACACAAGG - Intergenic
994874948 5:105409043-105409065 AGAAAAAAACTCTTCAGACATGG + Intergenic
994980390 5:106867518-106867540 AGGAAGTAAGTCTCCAGAGAAGG - Intergenic
995305032 5:110635636-110635658 TGATAAAAAGTCTCCAGACTAGG + Intronic
995415029 5:111900763-111900785 ATAAAAAAAGTCTCCTAACAAGG + Intronic
996640260 5:125743365-125743387 AGCAACAAAGCATTCAGACATGG + Intergenic
997005904 5:129815873-129815895 ATGAACACAGTCTCCAGACATGG + Intergenic
997149301 5:131475290-131475312 ACCAAAACAGTCTCCTGAGAAGG + Intronic
997868247 5:137483755-137483777 ACCAAAAATGTCTCCAGACAGGG + Intronic
997926711 5:138036826-138036848 ACCAAAAATGTCTGCACACATGG - Intronic
998189054 5:140007043-140007065 AACAAAAATGTCTCTAAACATGG - Intronic
998422780 5:142002888-142002910 AGCAAACAGATCTCCAGAAATGG + Intronic
998655869 5:144179233-144179255 AGCAGAAAAGTCTCCCCACCAGG + Intronic
999656913 5:153819558-153819580 TGTAAGAAAGTCACCAGACAAGG + Intergenic
999732414 5:154484461-154484483 AGGAAAAAATTCTCCTGACCAGG - Intergenic
1000244717 5:159439935-159439957 AATAAAAAATTCTCCAGGCATGG - Intergenic
1000306208 5:159996789-159996811 AACAAAAAATTATCCAGGCATGG + Intergenic
1000653232 5:163843768-163843790 AGCATTAAAGTCTACAGAGAAGG + Intergenic
1000971495 5:167719745-167719767 AACAAAAACATCACCAGACAGGG - Intronic
1001017975 5:168158654-168158676 ATCAAAAATGTCTCCAGACTGGG + Intronic
1002463582 5:179389608-179389630 GTCAAAAATGTCTCCAGACATGG - Intergenic
1002474730 5:179458077-179458099 ACAAAAAAAGTAGCCAGACATGG - Intergenic
1002611412 5:180420948-180420970 AATAAAAAAGTGTCCAGGCACGG + Intergenic
1002769088 6:274061-274083 AACAAAAAAGAAACCAGACATGG - Intergenic
1003614680 6:7644424-7644446 AGAAAAGAACTTTCCAGACAAGG + Intergenic
1003967420 6:11266278-11266300 ATCCAAAATGTCTCCAGATATGG - Intronic
1004487169 6:16077475-16077497 AGAAAAAAAGTCTCCATCAAAGG + Intergenic
1004608316 6:17214716-17214738 ATCAAAAATGTCTCCAGACATGG - Intergenic
1004740220 6:18452938-18452960 AACAAAAAAGTAGCCAGCCATGG - Intronic
1004938419 6:20530463-20530485 AACAAAAAAGTAGCCGGACATGG - Intergenic
1005256292 6:24007002-24007024 AGCAAAAATGTCTCCAGACGTGG - Intergenic
1005382812 6:25254568-25254590 TACAAAAAAGTAGCCAGACATGG + Intergenic
1005439997 6:25857031-25857053 AGTAAAAAATTATCCAGACATGG + Intronic
1006593429 6:35175099-35175121 ACCAAAAAAGTAGCCAGGCATGG + Intergenic
1006751203 6:36378794-36378816 ACTAAAAATGTCTCCAGACACGG + Intronic
1007500294 6:42291843-42291865 AGTAAAAACTTGTCCAGACAGGG - Intronic
1007688938 6:43685497-43685519 ACCAAAAATGTCTGCAGACATGG + Intronic
1008602969 6:53113367-53113389 TGGAAAAAAGTCTCCAGAGTTGG - Intergenic
1009037698 6:58137809-58137831 AACAAAAATGTCCCCAGATATGG + Intergenic
1009213487 6:60891436-60891458 AACAAAAATGTCCCCAGACATGG + Intergenic
1009417282 6:63429744-63429766 AAAAAAAAAGTCTGAAGACAGGG + Intergenic
1009438061 6:63640932-63640954 GCCAAAAATGTCTCTAGACATGG + Intronic
1009866654 6:69406429-69406451 AGCAAAAAAGACTGCAACCAAGG + Intergenic
1011381161 6:86743560-86743582 AGCAATGAAGTCTCCATAGAAGG - Intergenic
1011522964 6:88229842-88229864 AGCATAAAATTTTCCAAACATGG + Intergenic
1012358064 6:98340840-98340862 ACCAAAAATGTCTCCTGACATGG - Intergenic
1012555141 6:100502385-100502407 AGCAAAAAACTAGCCAGGCATGG + Intergenic
1012584060 6:100900833-100900855 AGCAACAAATTCTCCACATAGGG - Intergenic
1013187006 6:107768115-107768137 AGTAAAAAAGTAGCCAGGCATGG + Intronic
1013425364 6:110007822-110007844 ATTAAAAAATTATCCAGACATGG - Intergenic
1013750901 6:113404990-113405012 ACTAAAAGTGTCTCCAGACATGG + Intergenic
1015867512 6:137741971-137741993 AGCAAAAAAATAGCCAGGCATGG - Intergenic
1015967847 6:138712785-138712807 TGCAAAAAATTAGCCAGACATGG - Intergenic
1016222471 6:141691950-141691972 TACAAAAAATTATCCAGACATGG + Intergenic
1016304958 6:142674284-142674306 AGCAAAAAAGCAGCCAGCCAGGG + Intergenic
1016718979 6:147270684-147270706 AGAATGAAAGACTCCAGACATGG + Intronic
1016941897 6:149489276-149489298 AGAAAAAAAGTCTACAGAATAGG - Intergenic
1017264107 6:152422656-152422678 TTCAAAAAAGTATCCAGGCATGG - Intronic
1017826005 6:158082504-158082526 AAAAAAAAAGTAGCCAGACATGG + Intronic
1019184653 6:170214053-170214075 AGCACTAAAGACTCCAGACGGGG + Intergenic
1019184663 6:170214106-170214128 AGCGCTAAAGACTCCAGACAGGG + Intergenic
1019184672 6:170214159-170214181 AGCACTGAAGACTCCAGACAGGG + Intergenic
1019712047 7:2522255-2522277 AGTAAAAAAGTGCCCAGAAAGGG + Intronic
1019794678 7:3041069-3041091 ACCAAAAAATTAGCCAGACATGG - Intronic
1019935113 7:4249680-4249702 AGCAAAGAGCTCTACAGACAAGG - Intronic
1020021514 7:4872232-4872254 ACCAAAGATGTCTGCAGACATGG - Intronic
1020324633 7:6964887-6964909 ACCAAAATTGTCTCCAGACATGG - Intergenic
1020814950 7:12893972-12893994 AGGAAAAAAGATCCCAGACATGG + Intergenic
1021523662 7:21562302-21562324 ATCATAAATGTCTCCAGACATGG + Intronic
1021793041 7:24225514-24225536 AACAAAAATATCTCCACACATGG + Intergenic
1021910687 7:25383347-25383369 AAGAAAAAGGTTTCCAGACAGGG - Intergenic
1022282773 7:28927606-28927628 AACACAAATCTCTCCAGACAAGG - Intergenic
1022341920 7:29476708-29476730 ATAAAAAATGTCTCCAGACATGG - Intronic
1022441133 7:30434360-30434382 ATCAAAAATGCCTCCGGACATGG - Intronic
1022617734 7:31949302-31949324 TGCAAAAAATTAGCCAGACATGG + Intronic
1022633248 7:32105819-32105841 AGAAAAAAATTTTCCAGACCAGG - Intronic
1022761126 7:33352532-33352554 AGCAAAAAAGACTCAATAAAGGG - Intronic
1023151855 7:37209043-37209065 AGCAGAACACTCCCCAGACAGGG + Intronic
1023413923 7:39914689-39914711 AACAAAAAATTCACCAGGCATGG + Intergenic
1023561947 7:41484292-41484314 GGAAAAAAAGACTCTAGACAAGG + Intergenic
1024037497 7:45521008-45521030 AACCAAAAATTCTCCAGGCATGG - Intergenic
1024251138 7:47506525-47506547 GGCAGAAAAGTCTCCAGGCCAGG + Intronic
1024315635 7:48014119-48014141 ATCAAAAAATTAGCCAGACATGG - Intronic
1024477574 7:49829869-49829891 AGATAAAGAGTCTCCAGAGATGG - Intronic
1024795386 7:53013290-53013312 AGCAAAAATGTCTCCACATAAGG + Intergenic
1025565057 7:62424170-62424192 GGCAAAAAAGGTTCCAGAAATGG + Intergenic
1025758979 7:64372699-64372721 AGCCAAAAAGTCTCAACACAGGG - Intergenic
1026384860 7:69836514-69836536 AGAAAAAAAATCACCACACAAGG - Intronic
1026624312 7:71978772-71978794 AGCATAATAGTCACCAGAGATGG - Intronic
1026647086 7:72180941-72180963 TACAAAAAATTATCCAGACATGG + Intronic
1026853888 7:73740608-73740630 AGAAAAAAATTAGCCAGACATGG - Intergenic
1027520870 7:79205072-79205094 AGCAAAAAACTTCCCAAACATGG + Intronic
1027809757 7:82880592-82880614 ACCAAAAATGTTTCTAGACATGG - Intronic
1027915040 7:84306931-84306953 AAAAAAAAAATCTCCAGACTTGG - Intronic
1029575023 7:101397690-101397712 AACAAAAAATTATCCAGGCACGG - Intronic
1029935967 7:104424578-104424600 ACCAAAAATGTCTCCAGACCTGG - Intronic
1030490025 7:110220699-110220721 ACCAAAAATATCTTCAGACATGG - Intergenic
1032022695 7:128418539-128418561 ACCAAAAATGTCTTCAGACACGG - Intergenic
1033203532 7:139395794-139395816 AGAAAAAAATTATCCAGGCATGG - Intronic
1034276462 7:149826037-149826059 AGCACAAAGGGCTCCAGTCAGGG - Intergenic
1034528207 7:151679355-151679377 AGCAACAAAGTCTCCAGCAGGGG + Intronic
1035170708 7:157015828-157015850 AGAGAAAAAGACTCCAGAGAAGG - Intergenic
1036117219 8:5971521-5971543 AAAAAAAAAGTATCCAGACATGG + Intergenic
1036371433 8:8166054-8166076 ACCAAAATTGTCTCCAGACATGG + Intergenic
1036510431 8:9395012-9395034 AAAAAAAAAATGTCCAGACAAGG + Intergenic
1036879470 8:12499590-12499612 ACCAAAATTGTCTCCAGACATGG - Intergenic
1037650779 8:20836574-20836596 ATCGTAAAACTCTCCAGACATGG - Intergenic
1037766190 8:21773838-21773860 AACAAAGATGTCCCCAGACAGGG - Intronic
1037779401 8:21857432-21857454 TTCAAAAAAGTGTCCAGGCATGG + Intergenic
1037881560 8:22575785-22575807 ATCAAAACAGTCTGCAAACAAGG - Exonic
1038323251 8:26548721-26548743 AAAAAAAAAGTCACCAGACATGG + Intronic
1038700584 8:29846128-29846150 AGCAAAACATTCTCCATCCAAGG - Intergenic
1038810850 8:30841071-30841093 AACAAAAAATTAGCCAGACATGG - Intronic
1039214132 8:35250648-35250670 AGAAAAAAATTAGCCAGACATGG - Intronic
1039226024 8:35389182-35389204 AGAATACAAGTCTCCAGAAATGG - Intronic
1039622197 8:39008324-39008346 ACCAAAAAATTAGCCAGACATGG - Intronic
1040358184 8:46639704-46639726 AGCCAAAAAGTCTCAACACCTGG - Intergenic
1040381156 8:46874691-46874713 AGCCAAAAAGTCTCAACACCTGG + Intergenic
1040382248 8:46884279-46884301 AGCCAAAAAGTCTCAACACCAGG + Intergenic
1040412489 8:47168510-47168532 AGCAAGAATGTCTCCATCCAAGG - Intergenic
1041811851 8:61920314-61920336 ATGAAAAAAGTCCCCAAACAAGG - Intergenic
1042569681 8:70149394-70149416 ATCAAAAAATTAGCCAGACATGG - Intronic
1043037024 8:75211105-75211127 GGCAGAAAAGTTTCCAGAGAGGG - Intergenic
1043531519 8:81156513-81156535 AGAAAAAATATCTCTAGACATGG - Intergenic
1043875613 8:85482931-85482953 ATTGAAAAAGTCTCCAGAAAAGG + Intergenic
1044018628 8:87076596-87076618 TACAAAAAATTATCCAGACATGG - Intronic
1045537799 8:103049030-103049052 TGTAAAAAAGTCTACAGAAAAGG + Intronic
1045602828 8:103737337-103737359 AGAAAAAAATTAGCCAGACATGG - Intronic
1045690390 8:104754165-104754187 ACCAAAAATGTCTCCAGGCTGGG - Intronic
1046016415 8:108610639-108610661 AGAAAAAAAGTGTCCAGGCTGGG + Intronic
1046017586 8:108623798-108623820 ATCAAAAATGTCTCCAGACATGG - Intronic
1046279774 8:112011527-112011549 ACTAAAAAAGTTTCCAGACATGG - Intergenic
1046617051 8:116489258-116489280 ATCAAAAATGCCTCCAGACGTGG + Intergenic
1047477086 8:125243042-125243064 GGAAAAAAAATCACCAGACATGG + Intronic
1047573023 8:126121671-126121693 AATAAAAAAGTATCCAGGCAGGG - Intergenic
1047646270 8:126873823-126873845 ACCAAAAAAGGCTTCAAACAAGG - Intergenic
1047650778 8:126917826-126917848 AGTAAAACAGTGTCCAGAGAGGG - Intergenic
1047693751 8:127383120-127383142 CCCAAAAATGTCTCCAGACATGG + Intergenic
1047978751 8:130158357-130158379 AAAAAAAAAGTATCCAGGCATGG + Intronic
1050026268 9:1337429-1337451 GCCAAAAATATCTCCAGACACGG - Intergenic
1050668613 9:7969882-7969904 ACCAAAAATGTCTCTGGACATGG - Intergenic
1050723213 9:8614957-8614979 AGCAAAGAAGTCTCAAGAGTGGG - Intronic
1052084016 9:24241564-24241586 GGAAAAAAAGGTTCCAGACATGG + Intergenic
1052905360 9:33828887-33828909 TACAAAAAAGTATCCAGGCATGG - Intronic
1053940416 9:43242778-43242800 AGCAAAAAATTAGCCAGGCACGG + Intergenic
1054271402 9:63027701-63027723 AGCAAAAAATTAGCCAGGCACGG - Intergenic
1054304671 9:63411612-63411634 AGCAAAAAACTAGCCAGGCACGG + Intergenic
1054403418 9:64735633-64735655 AGCAAAAAATTAGCCAGGCACGG + Intergenic
1054437040 9:65221121-65221143 AGCAAAAAATTAGCCAGGCACGG + Intergenic
1054493358 9:65800871-65800893 AGCAAAAAATTAGCCAGGCACGG - Intergenic
1054849854 9:69836433-69836455 CGCAACAATGTCTCCAGGCATGG + Intronic
1055420208 9:76132298-76132320 AGCAAAAAACTTTCAAGAAAGGG - Intronic
1055461932 9:76527824-76527846 AGCAAAAATGTGTCCAGAATTGG + Intergenic
1055475717 9:76661564-76661586 AGCAAAACAGACTTCAGAAAAGG + Intronic
1055645140 9:78356102-78356124 ACCAAAAATGTCTCTAGACATGG - Intergenic
1056607254 9:88096491-88096513 AACAAAAAATTATCCAGACGTGG - Intergenic
1057464427 9:95299703-95299725 ATCAAAAAATTAGCCAGACATGG + Intronic
1059269589 9:113063457-113063479 AGCTGAAAATTCTCCCGACAGGG + Intergenic
1059270722 9:113068904-113068926 AGCTGAAAATTCTCCCGACAGGG + Intergenic
1059271856 9:113074351-113074373 AGCTGAAAATTCTCCCGACAGGG + Intergenic
1059272990 9:113079798-113079820 AGCTGAAAATTCTCCCGACAGGG + Intergenic
1059274126 9:113085240-113085262 AGCTGAAAATTCTCCCGACAGGG + Intergenic
1059948032 9:119432728-119432750 AAAAAAAAAATCTCCAAACAGGG + Intergenic
1060062578 9:120474362-120474384 ACCAAAAATGTCTCCAGACATGG - Intronic
1060478533 9:124002386-124002408 AGCAATAAATTCTCCAGGAAGGG + Intronic
1060708024 9:125824753-125824775 GACAACAAAGTCTCCAGAAATGG + Intronic
1060820124 9:126656859-126656881 ATCAAAAATGTCTCCAGACATGG + Intronic
1061038495 9:128126550-128126572 ATCAAAAAAGTCTTAAAACACGG + Intronic
1061701333 9:132418218-132418240 ACCAAAAATGTCTCCAGACGTGG - Intronic
1061712000 9:132494369-132494391 ACCAAAAATATGTCCAGACATGG + Intronic
1203438996 Un_GL000195v1:170880-170902 AACAAAAAATTAGCCAGACATGG + Intergenic
1185798899 X:2991692-2991714 AACAAAAATGTCTCCAGACATGG - Intergenic
1185929659 X:4188141-4188163 AGAAAAAAACTTTCCAGAGATGG - Intergenic
1186077111 X:5892709-5892731 AGAAAGAAAGTCTCCAGACCAGG - Exonic
1186157279 X:6738628-6738650 ACCCAAAATGTCTCCAGACATGG - Intergenic
1186157369 X:6739467-6739489 ACCAAAAATGTCCTCAGACATGG - Intergenic
1186239599 X:7552331-7552353 ACCAAGAATGTCTCCAGATATGG - Intergenic
1186270370 X:7880197-7880219 GGCAAAAGAGTCTTGAGACAAGG - Intergenic
1186515521 X:10163906-10163928 ACAAAAAATGTCTCTAGACATGG + Intronic
1186524914 X:10239459-10239481 ACCACAAAAGTTTCCAGGCATGG - Intergenic
1186977257 X:14921195-14921217 AGTAATAAAATCTCCAAACATGG - Exonic
1187339979 X:18412323-18412345 ATCCAAAATGCCTCCAGACAAGG - Intergenic
1187408347 X:19024585-19024607 ACCAAAAATGTCTCCAGACATGG - Intronic
1188507822 X:30901912-30901934 AGCAAAAAAACCTCCACAAAGGG + Intronic
1189096939 X:38150433-38150455 ACCAAAAATATCTCCAGACATGG - Intronic
1189578220 X:42378263-42378285 AGCAAAAGACTCTCAAGACGGGG - Intergenic
1189726189 X:43969933-43969955 AGGAAACAAGTACCCAGACATGG + Intronic
1189742363 X:44133069-44133091 AGCAAAAAAATTACCAGGCATGG - Intergenic
1190487105 X:50938709-50938731 ACCAAAAAATTATCCAGACATGG - Intergenic
1191669502 X:63735969-63735991 AGCATAAAAGGCTTCTGACATGG - Intronic
1191820030 X:65295923-65295945 AGCAAAAATATATCCAGAAAGGG + Intergenic
1192443692 X:71194372-71194394 AGGAAAAAAAACTCCAGGCATGG - Intergenic
1193562934 X:83042264-83042286 AAAAAAAAAGTTTCCAGGCATGG + Intergenic
1193724550 X:85024049-85024071 AGAAAAAAAGTATCTAGGCAGGG - Intronic
1195641653 X:107182319-107182341 ACCAAAAATGTCTCCAGATTTGG + Intronic
1195765972 X:108297511-108297533 ACCAAAAATGTTCCCAGACATGG + Intronic
1195999056 X:110761583-110761605 ACCAAAAATGTCTCCAGACATGG - Intronic
1196580542 X:117374241-117374263 AGCATAAAACTTTCCAGACTAGG + Intergenic
1199162091 X:144624829-144624851 ATCAGAAATGTCTCCAGACAGGG - Intergenic
1199271302 X:145885625-145885647 ACCAAAAACATCTCCAGATATGG + Intergenic
1200112369 X:153747746-153747768 AACAAAAAAGTGTCAAGAAAAGG + Intergenic
1200750686 Y:6941693-6941715 ACCAAGAAATACTCCAGACAAGG - Intronic
1200853959 Y:7917319-7917341 AGCCAAAAAGTCTCAACACCTGG + Intergenic
1200892493 Y:8338844-8338866 AGCCAAAAAGTCTCAACACCTGG - Intergenic
1201146933 Y:11070021-11070043 TACAAAAAATTCTCCAGGCATGG - Intergenic
1201245150 Y:11996213-11996235 ACCAAAAATGTCTCTAGATATGG + Intergenic
1201550902 Y:15215423-15215445 ACCCAAAATGTCTCCAGACATGG - Intergenic
1201550991 Y:15216260-15216282 ATGAAAAATGTCCCCAGACATGG - Intergenic
1202248037 Y:22839631-22839653 AGCCAAAAAGTCTCAACACCTGG - Intergenic
1202251352 Y:22876893-22876915 AGCCAAAAAGTCTCAACACCTGG + Intergenic
1202401025 Y:24473379-24473401 AGCCAAAAAGTCTCAACACCTGG - Intergenic
1202404340 Y:24510642-24510664 AGCCAAAAAGTCTCAACACCTGG + Intergenic
1202466439 Y:25159440-25159462 AGCCAAAAAGTCTCAACACCTGG - Intergenic
1202469755 Y:25196707-25196729 AGCCAAAAAGTCTCAACACCTGG + Intergenic
1202587890 Y:26450963-26450985 AGCTAAAAATTCTCCAGATATGG - Intergenic