ID: 955764737

View in Genome Browser
Species Human (GRCh38)
Location 3:62330272-62330294
Sequence CAATCTAAGTAGAGGGCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 99}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955764737_955764740 -5 Left 955764737 3:62330272-62330294 CCAACAGCCCTCTACTTAGATTG 0: 1
1: 0
2: 0
3: 13
4: 99
Right 955764740 3:62330290-62330312 GATTGCTCCAATGCTTGTACAGG 0: 1
1: 0
2: 0
3: 0
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955764737 Original CRISPR CAATCTAAGTAGAGGGCTGT TGG (reversed) Intronic
900645610 1:3707384-3707406 CAATGCAAGTAGTGGCCTGTTGG + Intronic
902068884 1:13714672-13714694 CAATGTAAGCAGAGGCTTGTGGG + Intronic
907632867 1:56101525-56101547 CAATCCAAGGAGAGGGCCCTTGG - Intergenic
908894643 1:68884716-68884738 CATCCAAAGTAGAGGGCTGAAGG - Intergenic
909027568 1:70501008-70501030 AAACCTAAAGAGAGGGCTGTGGG - Intergenic
911579830 1:99621778-99621800 TAATCTCAGTAGAGGCCTGTGGG + Intergenic
912780860 1:112546399-112546421 ACATGTAAATAGAGGGCTGTAGG + Intronic
913657712 1:120977108-120977130 CAATCTAAGAGGAGGGGGGTTGG - Intergenic
914009063 1:143760192-143760214 CAATCTAAGAGGAGGGGGGTTGG - Intergenic
914522278 1:148428378-148428400 CAATCTAAGAGGAGGGGGGTTGG - Intergenic
914647692 1:149668844-149668866 CAATCTAAGAGGAGGGGGGTTGG - Intergenic
916484981 1:165250733-165250755 TAATTAAAGTAGAGGGCTGTGGG + Intronic
920058414 1:203210719-203210741 AAATCTAGTTAGAGGGCTATGGG + Intergenic
922279223 1:224106912-224106934 CTATGTCAGTAGAGGGCTCTGGG - Intergenic
1065036023 10:21639410-21639432 CAACCCAAGGAGGGGGCTGTGGG - Intronic
1068312496 10:55295989-55296011 AGATCTAAGAAGAGGGTTGTGGG - Intronic
1071541957 10:86493457-86493479 CAATCTAGGCAGAGGGATATGGG + Intronic
1074684712 10:115949837-115949859 CAAAGTAGGTAGAGGGCTGTTGG + Intergenic
1075241469 10:120782681-120782703 CACTCTAAGTAAAGTGTTGTTGG - Intergenic
1075786967 10:125056712-125056734 CACTCTTAGTCGAGGGATGTTGG + Intronic
1077879206 11:6334892-6334914 CCATCTTAGTAAAAGGCTGTGGG - Intergenic
1079149179 11:17882645-17882667 CAATCTAAGTACAGGGCATGGGG + Intronic
1079702667 11:23568151-23568173 CAATCAAATTAGAGGACTGTAGG - Intergenic
1086035093 11:82405322-82405344 CTATCTTAGTAGAGGAATGTAGG + Intergenic
1089312624 11:117569857-117569879 CAATCCCAGTGGAGGGCTCTGGG + Intronic
1090325124 11:125879401-125879423 GAATCTAAGGAGGGGGTTGTAGG - Intergenic
1091930470 12:4391825-4391847 CATTCATAGAAGAGGGCTGTGGG - Intergenic
1092202245 12:6593077-6593099 CAGTCTAAGGTGAGGGCTGAGGG - Exonic
1092815894 12:12312065-12312087 CAATCCAAGAAGAGAGCAGTAGG + Intergenic
1094443728 12:30507441-30507463 AAATCCAAGGAGGGGGCTGTGGG - Intergenic
1100898968 12:99216638-99216660 AAATCTTAGTAGAGATCTGTGGG + Intronic
1102960719 12:117091706-117091728 CAAGCTCAGTAGTGGGCAGTGGG - Intronic
1103995435 12:124826940-124826962 CAATCTCAGGAGAGGGCTGGGGG + Intronic
1108343012 13:49516020-49516042 CATTCTAAGCAGAGGGCCTTGGG - Intronic
1113598519 13:111551477-111551499 CAATTTAATTAGAGGGCAGTGGG + Intergenic
1114557438 14:23570094-23570116 CAATCAGAGTAGAGGGTTCTGGG + Intronic
1115273183 14:31577379-31577401 CAATCTCAGCAGAGGCCTGTAGG - Intronic
1115295693 14:31823962-31823984 AAATCAAAATAGAAGGCTGTAGG + Intronic
1116324384 14:43513376-43513398 AAATCTAAGTAAATGGCTGGTGG - Intergenic
1118071568 14:62251562-62251584 GAAGCTAAATAGAGGACTGTGGG - Intergenic
1121170067 14:91846204-91846226 GAAAATAAGTAGAGGGCAGTTGG - Intronic
1202847213 14_GL000009v2_random:190189-190211 AAATCTAAGTAGAAGCCAGTTGG - Intergenic
1127201422 15:56656917-56656939 CAATCAAAGTAGAGGCCTAAAGG + Intronic
1138054953 16:53823123-53823145 CAATCTCAGTAGAGTGCTGGGGG - Intronic
1140828564 16:78729876-78729898 AAATCTAAATAGAGCCCTGTGGG - Intronic
1140996066 16:80260565-80260587 CAAGTTAAGTAAATGGCTGTAGG - Intergenic
1144353375 17:14421076-14421098 GAATCTAAATACAGAGCTGTGGG + Intergenic
1145115253 17:20204141-20204163 CACCCAAAGTATAGGGCTGTGGG + Intronic
1146032943 17:29381930-29381952 CAATATTAGTAGAGGGGGGTGGG + Intergenic
1146682145 17:34816100-34816122 CATTTTAAGCAGAGGGCTGGGGG - Intergenic
1147659363 17:42109082-42109104 CAATCCAAAGAGCGGGCTGTGGG + Intronic
1149355257 17:55832858-55832880 CAAGCTAAGTTGAGGGCTTTTGG + Intronic
1152852017 17:82642527-82642549 GAATCCAAGGAGGGGGCTGTGGG + Intronic
1154328152 18:13406973-13406995 CAATTTAAGTCCAGGACTGTCGG + Intronic
1157477847 18:48034876-48034898 GAATCAAAGAAAAGGGCTGTGGG + Intronic
1160399558 18:78600149-78600171 CAGTCTGAGTGGAGGGCTTTGGG - Intergenic
1161212452 19:3074448-3074470 CCATCTATCTAGTGGGCTGTGGG + Intergenic
1161510693 19:4669676-4669698 CAAGCTGAGTACAGGGCTGAGGG + Intronic
1166179415 19:41096387-41096409 GAATCTATCTAGAGGGCTATGGG - Intergenic
930841374 2:55850582-55850604 CAATCTAAGTAGAGTTCCTTAGG + Intergenic
933006182 2:76998320-76998342 CAGTCTAACTAGAGAGCTGAGGG + Intronic
933006265 2:76999256-76999278 CAGTCTAACTAGAGAGCTGAGGG - Intronic
933043335 2:77498930-77498952 TAATCTATGTAGAGATCTGTAGG - Intronic
939367378 2:141250616-141250638 ACATCTGAGGAGAGGGCTGTAGG + Intronic
1170323404 20:15127896-15127918 TAATGTAAGTAGAGGGAGGTTGG - Intronic
1170856238 20:20058191-20058213 CAATTTTACTAGAGGGCAGTAGG + Intronic
1174816022 20:53687780-53687802 AAATCTAAATATAGGGGTGTGGG + Intergenic
1175393504 20:58642764-58642786 CAATCTAGGTAGGGTGCAGTAGG - Intergenic
1182584953 22:31339660-31339682 CTAACTAAGCACAGGGCTGTGGG - Intronic
1182694011 22:32184465-32184487 CAATCTGAGTGGAGGGGTGGGGG + Intergenic
1183891069 22:40929097-40929119 CAATCCAAGGAAAGGGCTGTTGG - Exonic
953189467 3:40670089-40670111 CCATCTTAGTAAAGGGCTGTGGG + Intergenic
953193777 3:40713297-40713319 CCATCTTAGTAAAGGACTGTGGG - Intergenic
953940941 3:47096404-47096426 CTATCTAAAAAGAGGGCTGAAGG + Intronic
953998266 3:47536882-47536904 CAGTCTCAGCAGAGAGCTGTGGG - Intergenic
955589935 3:60524354-60524376 CAATCTAAATAGAGGTCTGAAGG + Intronic
955764737 3:62330272-62330294 CAATCTAAGTAGAGGGCTGTTGG - Intronic
956056484 3:65303961-65303983 CAATCTCTGTAAAGTGCTGTGGG - Intergenic
956634743 3:71352545-71352567 CCATATAAGCAGAGGGCTCTGGG + Intronic
958726457 3:97911155-97911177 AATTCTAAGTAGAGGCCTTTGGG + Intronic
960005642 3:112778048-112778070 CAAGCAAAGAAGAGGTCTGTGGG + Intronic
966388145 3:179423804-179423826 AAATCCAAGTGGAGGGCTCTTGG + Intronic
984206004 4:176788776-176788798 CATTCTAAGTCGGGGACTGTTGG + Intronic
985903599 5:2815637-2815659 CAATCTTTGTGGAGGACTGTGGG - Intergenic
985992210 5:3572693-3572715 CACTGTAAGTCCAGGGCTGTTGG - Intergenic
990951959 5:61307115-61307137 TACTCTAGGTAGAGGGCTGAGGG + Intergenic
992326615 5:75666183-75666205 CAATCTAGGCATAGTGCTGTTGG + Intronic
992669018 5:79040069-79040091 AAATCTGAGGAGAGGGTTGTGGG + Intronic
998465712 5:142342242-142342264 CAGTCTAAGACGGGGGCTGTTGG + Intergenic
1001496248 5:172189213-172189235 GAATCTAAGGAGAGTGCTGGGGG + Intergenic
1007968330 6:46024725-46024747 GAATCTGTATAGAGGGCTGTAGG + Intronic
1013300943 6:108804448-108804470 CAAGATAAGTAAAGGGGTGTTGG + Intergenic
1015198282 6:130548632-130548654 CAATCTAAATACAGGGGGGTAGG + Intergenic
1017382278 6:153844684-153844706 CAATCTAAGATGAGTGCTGGAGG - Intergenic
1017590278 6:155972058-155972080 CAATATAAGTAGAGACCTGAAGG + Intergenic
1019708792 7:2509033-2509055 CAATCTGAGTGGGGGCCTGTGGG + Intergenic
1019757027 7:2778476-2778498 CTATGTAAGTAGGGAGCTGTTGG - Intronic
1024103383 7:46056749-46056771 AAACCTAAGGAGGGGGCTGTGGG + Intergenic
1024445289 7:49470630-49470652 AAACCTGAGGAGAGGGCTGTGGG + Intergenic
1026290670 7:69003011-69003033 AAAACTGAGGAGAGGGCTGTAGG + Intergenic
1032705199 7:134415234-134415256 GACTCCAAGTAGAGGCCTGTGGG + Intergenic
1038587930 8:28808174-28808196 AAATCTAAATAAAGGGCTGAGGG - Intronic
1041499365 8:58523180-58523202 CAAACTTAGGAGAGGGATGTGGG - Intergenic
1050544699 9:6700090-6700112 CAATCTTAGTGGAGGGATGGAGG + Intergenic
1053464156 9:38292696-38292718 CAATCTGCCTAGAGGGCTCTGGG + Intergenic
1056210760 9:84362763-84362785 CATTCTGAGAAGAGGGCTGTAGG - Intergenic
1058643443 9:107108830-107108852 AAGTGTAAGTAGAGGGCTGGTGG - Intergenic
1059302730 9:113328144-113328166 CTTTCTAAATAAAGGGCTGTTGG + Intronic
1062567786 9:137170964-137170986 CCACCTGAGTAGAGGGCTGAGGG - Exonic
1186610931 X:11137842-11137864 CAATGTAAGTACAAAGCTGTAGG + Exonic
1196514052 X:116548747-116548769 GAATCTAAGTAGAGAGGTCTTGG - Intergenic
1200126037 X:153815613-153815635 CAATTTAATTACAAGGCTGTGGG + Intronic
1202099826 Y:21295451-21295473 CAATCTAAGCAGAATGCAGTTGG - Intergenic