ID: 955765339

View in Genome Browser
Species Human (GRCh38)
Location 3:62338553-62338575
Sequence AAATATCCAGAGATGGATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 825
Summary {0: 1, 1: 1, 2: 12, 3: 111, 4: 700}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955765339 Original CRISPR AAATATCCAGAGATGGATGG TGG Intergenic
900075463 1:812886-812908 AAAGTTCTAGAGAAGGATGGTGG + Intergenic
900667827 1:3827567-3827589 AAAGTTCTGGAGATGGATGGTGG + Intronic
901106958 1:6763901-6763923 AAAGTTCTAGAGAAGGATGGTGG - Intergenic
901431645 1:9218865-9218887 AAAGTTCTGGAGATGGATGGTGG - Intergenic
901619469 1:10571439-10571461 AGAGTTCTAGAGATGGATGGTGG + Intronic
901951726 1:12754914-12754936 AAAGTTCTAGAGATGGATGGTGG + Intronic
902066145 1:13689645-13689667 AGAATTCTAGAGATGGATGGTGG + Intergenic
902151018 1:14443403-14443425 ACACATCCAGAGATGGAGGATGG + Intergenic
902686712 1:18082025-18082047 CAACCTCCAGAGATGGATGTGGG - Intergenic
903211176 1:21819705-21819727 AAAGTTCTGGAGATGGATGGCGG + Intronic
903944634 1:26954125-26954147 AAAGGTCTGGAGATGGATGGTGG + Intronic
904239696 1:29135816-29135838 AAATGTCCTCAGATGGTTGGAGG + Intergenic
904631351 1:31844881-31844903 AAAGTTCTGGAGATGGATGGTGG - Intergenic
904783670 1:32969459-32969481 AAAGTTCTGGAGATGGATGGTGG - Intergenic
905320609 1:37114253-37114275 AAATGTGCAGTGATGGTTGGTGG - Intergenic
905841524 1:41183997-41184019 AAAGTTCTAGAGATTGATGGTGG + Intronic
905858896 1:41333098-41333120 AAAGATGCAGAGAAGGAAGGTGG - Intergenic
905935712 1:41822413-41822435 GCATATGCAGAGATGGATGGGGG + Intronic
906763076 1:48396824-48396846 AAAGTTCTAGAGATAGATGGTGG + Intronic
907057650 1:51385937-51385959 AAAGTTCTTGAGATGGATGGTGG + Intronic
907932593 1:59014644-59014666 CACTATCCAGAGGTGGATGGAGG - Intergenic
908002796 1:59697280-59697302 AGAGTTCCGGAGATGGATGGTGG - Intronic
908345727 1:63230386-63230408 AAAATTCTGGAGATGGATGGTGG - Intergenic
909202479 1:72708904-72708926 AGATATCCAGTGATTAATGGAGG + Intergenic
909571951 1:77123691-77123713 AAAGTTCTGGAGATGGATGGGGG + Intronic
909593895 1:77382687-77382709 AAGAATCCACAGATGGTTGGTGG - Intronic
910132449 1:83924625-83924647 AGACTTCCAGAGATGGATGGTGG + Intronic
910292184 1:85610114-85610136 AAAGTTCTGGAGATGGATGGTGG - Intergenic
910372206 1:86528272-86528294 AATGTTCTAGAGATGGATGGGGG - Intergenic
911212132 1:95153201-95153223 AAAGTTCTGGAGATGGATGGTGG + Intronic
911247109 1:95530157-95530179 AAATATCCAGAGATAGGAGGTGG - Intergenic
911580245 1:99625640-99625662 AAAAATTCAGAGATTAATGGGGG + Intergenic
911677305 1:100674136-100674158 AAAGTTCTGGAGATGGATGGTGG - Intergenic
911925653 1:103828378-103828400 AAATATCTGGAGATAAATGGTGG - Intergenic
912548646 1:110469456-110469478 AAATTTCTGGAAATGGATGGTGG - Intergenic
912648444 1:111416950-111416972 AAAGTTCTGGAGATGGATGGTGG + Intronic
912904057 1:113684876-113684898 AAATATCCAGAAATAGTTGGTGG - Exonic
913403396 1:118461655-118461677 AACTTTCCAGGGAGGGATGGAGG + Intergenic
914224660 1:145710233-145710255 AAAGTTCTGGAGATGGATGGTGG - Intergenic
914439909 1:147695786-147695808 AAATTTCTGGAGATGGATGGTGG - Intergenic
915388017 1:155514190-155514212 AAAGATCCAGAGCTGGTGGGTGG + Intronic
916202136 1:162282185-162282207 AAAGTTCTGGAGATGGATGGTGG - Intronic
916223850 1:162470409-162470431 AGAGTTCCAGAGATGGTTGGTGG - Intergenic
916235953 1:162588508-162588530 AAATATAAAGAGATGATTGGGGG + Intronic
916544013 1:165784947-165784969 TAAGTTCTAGAGATGGATGGTGG + Intronic
917238135 1:172916909-172916931 AAATATTCAGTGATGGGTGATGG - Intergenic
917412382 1:174772665-174772687 AAAGATCTGGAGATGGATGGTGG - Intronic
919422622 1:197389592-197389614 AAAGTTCTGGAGATGGATGGTGG + Intronic
919962938 1:202490570-202490592 AAAGTTCTAGAGATGAATGGTGG - Intronic
920286956 1:204887083-204887105 AAAGTTCTGGAGATGGATGGCGG - Intronic
920526369 1:206669647-206669669 TAATATGCTGAGCTGGATGGTGG + Intronic
920909954 1:210207043-210207065 AAATATCCAGGAGTGGATGCTGG - Intergenic
921124735 1:212167344-212167366 GAATATCCACAGAGGGATGAAGG - Intergenic
921218536 1:212956955-212956977 AAACGTCTGGAGATGGATGGTGG - Intronic
921220627 1:212971186-212971208 AAATATCCATCGATGGATAAAGG - Intronic
921493302 1:215805488-215805510 AGAGCTCTAGAGATGGATGGTGG + Intronic
921636853 1:217505772-217505794 AAATAACCATAGATGGCTAGTGG - Intronic
922271305 1:224037760-224037782 AAAGTTCTAGAGATGTATGGTGG + Intergenic
922337315 1:224628368-224628390 AAAGTTCTGGAGATGGATGGTGG - Intronic
922443344 1:225675943-225675965 AAAGTTCCAGAGGTGGATGGCGG + Intergenic
922537181 1:226390060-226390082 AAATACCCAGGGAAGGAAGGTGG + Intronic
922580139 1:226691114-226691136 AAAGTTCTAGAGATGGATGGTGG + Intronic
922598408 1:226831636-226831658 AAAGTTCTAGAGATGGATGGTGG + Intergenic
923070971 1:230564128-230564150 AAAGATCAGGAGATGAATGGTGG + Intergenic
923366552 1:233267453-233267475 AAAATTCTGGAGATGGATGGTGG - Intronic
923524863 1:234764743-234764765 AAAAATCTGGAGACGGATGGTGG - Intergenic
923595482 1:235358032-235358054 AAATATGCTGAAATTGATGGGGG + Intergenic
923639726 1:235742468-235742490 AAGTTCCTAGAGATGGATGGTGG + Intronic
923642093 1:235773688-235773710 AGATTTACAGAGATGGATGGTGG + Intronic
923767901 1:236909947-236909969 AGAGTTCTAGAGATGGATGGTGG - Intergenic
924297453 1:242602667-242602689 AAATGTACAGACATGGAAGGGGG - Intergenic
924356294 1:243180006-243180028 AAAGTTACAGAGATGGATGGCGG + Intronic
924684179 1:246270402-246270424 AGAGTTACAGAGATGGATGGTGG - Intronic
1062804370 10:406320-406342 AAAGTTCTAGAGATGGCTGGTGG - Intronic
1062928368 10:1335300-1335322 AGATATGCAGGGATGGAGGGAGG + Intronic
1063013882 10:2054910-2054932 AAAAATCCAGAGATTGCTGTCGG - Intergenic
1063279968 10:4617525-4617547 AAATCTCCCAAGCTGGATGGGGG + Intergenic
1063452698 10:6161975-6161997 AAAGTTCTAGAGATGGTTGGTGG - Intronic
1063550971 10:7032779-7032801 AAAGTTCTGGAGATGGATGGTGG + Intergenic
1064099710 10:12452935-12452957 AAAGTTCTGGAGATGGATGGTGG - Intronic
1064187419 10:13174581-13174603 AAATATCCACAGGTGGCTAGTGG - Intronic
1064350968 10:14576142-14576164 AAAGTTCTGGAGATGGATGGTGG + Intronic
1064806583 10:19141436-19141458 AAAGTTCTGGAGATGGATGGTGG + Intronic
1065217144 10:23460034-23460056 ACATATCCAGCGATTGAGGGTGG + Intergenic
1065783428 10:29191490-29191512 TAATTTTCAGAGATGCATGGAGG - Intergenic
1066039863 10:31537971-31537993 AAAGTTCTGGAGATGGATGGGGG - Intergenic
1067050088 10:43010752-43010774 AAATATCCAGAGAGCAATGAGGG + Intergenic
1067052947 10:43034946-43034968 AAATATTCAGAGCTGAATGATGG + Intergenic
1067437645 10:46289394-46289416 ACATTTCTGGAGATGGATGGTGG - Intronic
1067947638 10:50700263-50700285 AAGTATTCATGGATGGATGGTGG + Intergenic
1067971878 10:50980961-50980983 AATTTTCTAGAGATGGATGGTGG + Intergenic
1069437677 10:68400161-68400183 AATTAGCCAGGTATGGATGGTGG + Intronic
1069536103 10:69254442-69254464 AAAGTTTAAGAGATGGATGGTGG - Intronic
1070458635 10:76642939-76642961 AAATAGGGAGAGAGGGATGGGGG - Intergenic
1070546810 10:77458884-77458906 CAATAACCACAGATGGCTGGTGG + Intronic
1070882955 10:79865250-79865272 AAGTATTCATGGATGGATGGTGG + Intergenic
1071246011 10:83764519-83764541 AAAGTTCTAGAGATGGATGCTGG + Intergenic
1071519537 10:86320589-86320611 AAAGTTCTGGAGATGGATGGTGG + Intronic
1071529766 10:86380203-86380225 AAAGTTCAGGAGATGGATGGTGG + Intergenic
1071649523 10:87381554-87381576 AAGTATTCATGGATGGATGGTGG + Intergenic
1071833715 10:89398002-89398024 AAATTTCTGGAGATGGATGGTGG - Intronic
1071844937 10:89512209-89512231 AAAGTTCTGGAGATGGATGGTGG + Intronic
1072136503 10:92551763-92551785 AAAGTTCTAGAGATGGATGATGG + Intronic
1073024930 10:100480963-100480985 AAAAATCCAGAGTTAGAGGGAGG - Intronic
1073316739 10:102586789-102586811 AAACTTCTAGAGATGGATGGTGG - Intronic
1073399400 10:103244406-103244428 AAAATTCTGGAGATGGATGGTGG - Intergenic
1073588279 10:104731852-104731874 AAACAACCAGAGATGAATGAAGG - Intronic
1074198001 10:111206293-111206315 GAATAAACAAAGATGGATGGAGG - Intergenic
1074470774 10:113724768-113724790 AGAAAGCCTGAGATGGATGGTGG - Intronic
1074870749 10:117574156-117574178 AATTAGCCAGGCATGGATGGTGG + Intergenic
1074875745 10:117611804-117611826 AACCTTCTAGAGATGGATGGTGG - Intergenic
1075383210 10:122035692-122035714 AAAGTTCTGGAGATGGATGGCGG - Intronic
1075851736 10:125593817-125593839 AAGTTTCTGGAGATGGATGGCGG + Intronic
1076019583 10:127061364-127061386 AAATATACAGAAAGGGAGGGTGG - Intronic
1076304125 10:129451469-129451491 AAAGGTCTGGAGATGGATGGTGG + Intergenic
1077254728 11:1575233-1575255 AAAGCTCCAGAGATGGGTGGTGG - Intergenic
1077427018 11:2485619-2485641 AAAATTCTAGAAATGGATGGTGG - Intronic
1077479921 11:2808973-2808995 ATAGATGCAGAGATGGAGGGAGG + Intronic
1077611360 11:3645018-3645040 AGACATCCAGAAATAGATGGGGG + Intergenic
1077811392 11:5641491-5641513 AAAGATCCAGGGCTGGATGCAGG - Intronic
1078241267 11:9532693-9532715 AAAGTTCTGGAGATGGATGGTGG - Intergenic
1078734112 11:14003961-14003983 AAATATGCAGAGATAGATAAGGG - Intronic
1080272103 11:30461272-30461294 AAAGCTCTGGAGATGGATGGTGG + Intronic
1080423637 11:32136402-32136424 AATATTCCACAGATGGATGGTGG + Intergenic
1080573484 11:33577861-33577883 AAATCTCCAGTGAGTGATGGGGG - Intronic
1080654659 11:34249380-34249402 AAATATCCAGAGCTGGCTGCAGG + Intronic
1081770485 11:45647672-45647694 AAAATTACAGAGCTGGATGGTGG + Intergenic
1081818894 11:45971818-45971840 AGATATCCAGAACTGTATGGTGG - Intronic
1081837785 11:46171675-46171697 AAAGTTCTAGAGATGCATGGTGG - Intergenic
1082063076 11:47877104-47877126 AAAGTTCTGGAGATGGATGGTGG + Intergenic
1083387076 11:62319085-62319107 GAAGATCCAGAGAAGGAGGGAGG + Intergenic
1084040365 11:66539235-66539257 AACTATGCAAAGATGGAGGGAGG + Exonic
1084539974 11:69780137-69780159 AACCATCTGGAGATGGATGGTGG - Intergenic
1084552066 11:69850411-69850433 AAAGTTCTAGAGATGGATGGTGG - Intergenic
1085064947 11:73486288-73486310 AAAGTTCTGGAGATGGATGGTGG - Intronic
1085471496 11:76761318-76761340 AAATGACCAGAGATGGAAGTAGG + Intergenic
1085587604 11:77725137-77725159 AAAGTTCTGGAGATGGATGGTGG + Intronic
1087109845 11:94452918-94452940 AAAGTTCTATAGATGGATGGGGG - Intronic
1087120973 11:94573843-94573865 AAAGATCTAAAGTTGGATGGTGG - Intronic
1087640672 11:100751578-100751600 CAATACCCAGTGGTGGATGGAGG + Intronic
1088291132 11:108238903-108238925 AAAGTTCTGGAGATGGATGGTGG - Intronic
1088791990 11:113234376-113234398 AAAGTTCTGGAGATGGATGGTGG - Intronic
1089362763 11:117901927-117901949 GAGTGTCCATAGATGGATGGAGG - Intronic
1089412948 11:118262535-118262557 CAGTTTCCAGAGAAGGATGGAGG + Exonic
1090035567 11:123246686-123246708 AAAAATCCAAAAATGGAAGGTGG - Intergenic
1090218776 11:124996633-124996655 AAAACTCTGGAGATGGATGGTGG - Intronic
1090266031 11:125353464-125353486 AGCTATCAAGGGATGGATGGAGG + Intronic
1090365838 11:126204768-126204790 AAAGTTCTAGAGATGGATGGTGG - Intronic
1090552338 11:127836434-127836456 AAATATACAAATATGGAAGGTGG + Intergenic
1090681112 11:129058286-129058308 ATATATTCTGATATGGATGGGGG - Intronic
1090681117 11:129058322-129058344 ATATATTCTGATATGGATGGGGG - Intronic
1091235602 11:134020297-134020319 AAATCTCCCCAGATGGATGGTGG - Intergenic
1092510976 12:9156359-9156381 CAAGATCCAGAGATGGAGGAAGG - Intronic
1092611071 12:10173959-10173981 AAAGTTCTGGAGATGGATGGTGG - Intronic
1094215663 12:27939479-27939501 AAATGTCCATGAATGGATGGAGG + Intergenic
1094284530 12:28778016-28778038 AAATAGCCACAGGTGGCTGGTGG - Intergenic
1094666173 12:32523380-32523402 AAAATTCTAAAGATGGATGGTGG - Intronic
1094776587 12:33736474-33736496 AAGTTTCTAGAGATGGATGTTGG - Intergenic
1095198377 12:39352121-39352143 AAATTTCTGGAGATGGATGGTGG - Intronic
1096160316 12:49371137-49371159 AAAATTCCCAAGATGGATGGTGG - Intronic
1096395804 12:51265749-51265771 AAAGTTCTGGAGATGGATGGTGG + Intronic
1096425152 12:51495257-51495279 AAAGTTCCAGAGCTGGAGGGTGG - Intronic
1098092379 12:66917854-66917876 AGATATAAAGAGATAGATGGCGG - Intergenic
1098541944 12:71666535-71666557 AAAAAAAAAGAGATGGATGGTGG + Intronic
1098889236 12:75991990-75992012 AAAGTTCTAGAGATGGATGGTGG - Intergenic
1100236473 12:92666663-92666685 AGAGAACCAGAGATGGAAGGTGG - Intergenic
1100881316 12:99020181-99020203 AAAGTGCCAGAGATGGATGATGG - Intronic
1101162992 12:101998125-101998147 AAAATTCTAGAGATGGATGGTGG - Intronic
1101210748 12:102533236-102533258 AAAGTTCTGGAGATGGATGGTGG + Intergenic
1101310923 12:103578133-103578155 AAAAACCTGGAGATGGATGGTGG + Intergenic
1101657311 12:106734227-106734249 AAAGCTCTGGAGATGGATGGCGG + Intronic
1101863687 12:108503596-108503618 AGAGTTCTAGAGATGGATGGTGG + Intergenic
1102646349 12:114406328-114406350 AGAGAAGCAGAGATGGATGGAGG - Intronic
1102699037 12:114823275-114823297 AAAATCCTAGAGATGGATGGTGG - Intergenic
1103196774 12:119050799-119050821 AAATAGCCACAGATGGCTAGTGG - Intronic
1103265305 12:119624738-119624760 AAAATTCCAGAGATAGATGGTGG + Intronic
1103277631 12:119726166-119726188 AAAGTTCTAGAAATGGATGGTGG - Intronic
1103542735 12:121677588-121677610 AAAGTTCTGGAGATGGATGGAGG - Intergenic
1103584800 12:121944370-121944392 AAATAGCCACATATGGTTGGTGG - Intronic
1104052808 12:125207667-125207689 AAAGTTCCAGAGATGGATGGCGG - Intronic
1104361878 12:128140924-128140946 AAAACTCCAGAGATGGATTCAGG - Intergenic
1104651349 12:130536657-130536679 AAATAGCCAGACATGGCTGGTGG - Intronic
1105370825 13:19800438-19800460 AAAGTTCTGGAGATGGATGGTGG - Intergenic
1106218137 13:27721267-27721289 AGAGTTCCAGAGATGCATGGTGG + Intergenic
1106397223 13:29392784-29392806 AAAGTTCTGGAGATGGATGGTGG + Intronic
1106453640 13:29907929-29907951 AAATATCCAAATAAGGATGGAGG - Intergenic
1106599922 13:31178972-31178994 AATTAGCCAGGGATGGATGGTGG - Intergenic
1106945669 13:34824887-34824909 AAAGTTCTGGAGATGGATGGTGG - Intergenic
1107385630 13:39905371-39905393 AAAGTTCTGGAGATGGATGGTGG - Intergenic
1107898909 13:44992877-44992899 ATAGTTCTAGAGATGGATGGTGG - Intronic
1107942763 13:45389184-45389206 AAAGTTCTGGAGATGGATGGTGG + Intergenic
1108160957 13:47638697-47638719 AAAAGTTCAGACATGGATGGGGG + Intergenic
1108442283 13:50467022-50467044 AAATCACCAGAGAAGTATGGGGG - Intronic
1108522218 13:51256776-51256798 AAAGTTACAGAGATGGATGGTGG - Intronic
1108935893 13:55879381-55879403 AAATAGCCAGAGATGGATAAAGG - Intergenic
1109254007 13:60055852-60055874 AAATTTCCAGAGAAGAAAGGGGG + Intronic
1109628232 13:65007739-65007761 AAATATCAGGAGATGAAAGGAGG - Intergenic
1109973033 13:69795253-69795275 AAATATACACAGATTGATGGGGG - Intronic
1110980218 13:81888913-81888935 AAATATCTAGAGATTGAAGGTGG + Intergenic
1111207589 13:85032712-85032734 ACATGTCTATAGATGGATGGGGG - Intergenic
1111568184 13:90044091-90044113 AAATATACAGAGCTACATGGAGG + Intergenic
1111574129 13:90128066-90128088 AAATTTTCAGAGTTGGATGAGGG - Intergenic
1111889644 13:94065751-94065773 AATTATACAGAGAAAGATGGTGG - Intronic
1112022427 13:95383315-95383337 AAAGTTCTGGAGATGGATGGTGG + Intergenic
1112313197 13:98338242-98338264 AGAGTTCTAGAGATGGATGGTGG - Intronic
1112345979 13:98589821-98589843 AAAAATGCAGAGATGGTTTGAGG - Intergenic
1112356483 13:98678147-98678169 AAAGTTCTGGAGATGGATGGTGG + Intergenic
1112356488 13:98678180-98678202 AAAGTTCTGGAGATGGATGGTGG + Intergenic
1112356493 13:98678213-98678235 AAAGTTCTGGAGATGGATGGTGG + Intergenic
1112384975 13:98931011-98931033 AAATGACAAGAGATGGATGGTGG - Intronic
1112441840 13:99430062-99430084 AAAGTTCTGGAGATGGATGGTGG - Intergenic
1112919974 13:104600516-104600538 ACATATCTAGAGATGAAGGGGGG - Intergenic
1113985579 13:114313391-114313413 AGAGGTACAGAGATGGATGGTGG + Intergenic
1114824072 14:26055663-26055685 AAATAACAAGAGAGGGAGGGAGG + Intergenic
1115307651 14:31948935-31948957 AAAGTTGTAGAGATGGATGGTGG - Intronic
1115475934 14:33812712-33812734 AAATATCCGGAGCAGCATGGAGG - Intergenic
1115777585 14:36732658-36732680 AAATATTCAGAGACTGAGGGGGG - Intronic
1116664336 14:47755638-47755660 AGATATACATAGATGGAGGGTGG + Intergenic
1116965645 14:51012161-51012183 AAAGTTCTGGAGATGGATGGTGG - Intronic
1117517333 14:56514807-56514829 AAAGTTCTAGAGATGGATAGTGG + Intronic
1117758661 14:59003241-59003263 AATAATCTGGAGATGGATGGTGG + Intergenic
1118799773 14:69179214-69179236 AAAGTTCTGGAGATGGATGGTGG - Intergenic
1118996074 14:70837511-70837533 AAAGTTCTGGAGATGGATGGTGG + Intergenic
1119304111 14:73593198-73593220 AAATACCCAGAGATGGTTTTAGG - Intronic
1119562563 14:75602732-75602754 AAAGTTCTAGAAATGGATGGAGG + Intronic
1121188198 14:91996087-91996109 AAAGTTCTGGAGATGGATGGTGG - Intronic
1121878266 14:97474915-97474937 AAAGTTCCAGAGATGGATGGTGG - Intergenic
1122146709 14:99693913-99693935 AAAGTTCTGGAGATGGATGGTGG - Intronic
1122468943 14:101952904-101952926 AAATGTCTGGAAATGGATGGTGG + Intergenic
1122704526 14:103611835-103611857 AAATTTCTGGAGATGGATGGTGG + Intronic
1122752562 14:103949069-103949091 AGATTTCTGGAGATGGATGGTGG + Intronic
1122916703 14:104862558-104862580 AAAGTTCTGGAGATGGATGGTGG - Intergenic
1123432476 15:20230431-20230453 AAAGTTTTAGAGATGGATGGTGG - Intergenic
1123681085 15:22764583-22764605 AAAGTTGTAGAGATGGATGGTGG - Intergenic
1123962641 15:25421616-25421638 AAAGTTTCAGAGATGGATAGTGG + Intronic
1123980611 15:25598700-25598722 AGATTTCTAGAGATGGATGGTGG + Intergenic
1124041388 15:26108595-26108617 AAAGTTCTGGAGATGGATGGTGG + Intergenic
1124333302 15:28839044-28839066 AAAGTTGTAGAGATGGATGGTGG - Intergenic
1124422823 15:29537574-29537596 AATGATCCAGAGAGAGATGGTGG - Intronic
1124463749 15:29917918-29917940 AAAGTCCCAGAGATGGATGGGGG - Intronic
1124510993 15:30325577-30325599 GAATTTCTAGAGATAGATGGTGG - Intergenic
1124731895 15:32204953-32204975 GAATTTCTAGAGATAGATGGTGG + Intergenic
1124782515 15:32649638-32649660 AAACATCCAGAGAGGATTGGGGG + Intronic
1124859093 15:33420785-33420807 AAATATGCAGATATGGAAGTAGG + Intronic
1124964032 15:34420006-34420028 AAAGTTCTGGAGATGGATGGTGG + Intronic
1124980646 15:34566237-34566259 AAAGTTCTGGAGATGGATGGTGG + Intronic
1125582749 15:40798403-40798425 AAAGTTGTAGAGATGGATGGTGG + Intronic
1125904200 15:43375307-43375329 AAAGTTCTGGAGATGGATGGTGG + Intronic
1125917128 15:43497785-43497807 AAAGTTCTGGAGATGGATGGTGG + Intronic
1126639964 15:50814503-50814525 AATTTTCTGGAGATGGATGGTGG - Intergenic
1126646330 15:50878344-50878366 AAAATTCTGGAGATGGATGGTGG + Intergenic
1126898318 15:53284252-53284274 AAATTTAAAAAGATGGATGGGGG - Intergenic
1126969285 15:54091681-54091703 AAATATTCAGACATTGATAGTGG - Intronic
1127220588 15:56876336-56876358 AAATTTCTGGAGATAGATGGTGG + Intronic
1127312390 15:57764065-57764087 AAAGTTCTAGAGTTGGATGGTGG - Intronic
1127496365 15:59516276-59516298 AATTAGCCAGGGATGGATGGTGG - Intronic
1127504695 15:59587082-59587104 AAAGATTTGGAGATGGATGGTGG - Intergenic
1127593967 15:60459013-60459035 AAAGTTCTGGAGATGGATGGTGG + Intronic
1128007205 15:64254288-64254310 AAAGTTCTGGAGATGGATGGTGG + Intronic
1128287280 15:66447804-66447826 AAAGTTCTGGAGATGGATGGTGG - Intronic
1128336317 15:66787964-66787986 AAAGTTCTGGAGATGGATGGAGG - Intergenic
1128373732 15:67060492-67060514 AAAACTCTGGAGATGGATGGTGG - Intergenic
1128722407 15:69960055-69960077 AAATTTCTGGAGCTGGATGGTGG + Intergenic
1128793443 15:70449247-70449269 AGAGATGGAGAGATGGATGGAGG + Intergenic
1129984980 15:79911077-79911099 AAAGTTCTAGAGATGGATGGTGG + Intronic
1130338877 15:82981904-82981926 AAAAATCTCGAGATGGATGGCGG + Intronic
1130421768 15:83755345-83755367 AAAGTTCTAAAGATGGATGGTGG - Intronic
1130914342 15:88292852-88292874 AAAGTTCTAGAGATGGATGCTGG - Intergenic
1130914348 15:88292959-88292981 AAAGTTCTAGAGATGGATGCTGG - Intergenic
1131018912 15:89081381-89081403 AAATGTCCATTGATGGATGAAGG - Intergenic
1131857505 15:96613832-96613854 GAATCTTCAGAGATGGCTGGTGG - Intergenic
1131906704 15:97150384-97150406 AAAGTTCTGGAGATGGATGGAGG + Intergenic
1132007580 15:98243185-98243207 AAAGTTCCAGAGACGGGTGGTGG + Intergenic
1132093904 15:98967914-98967936 AAAGTTCTGGAGATGGATGGTGG + Intergenic
1132154762 15:99487515-99487537 GAAGTTCTAGAGATGGATGGTGG + Intergenic
1133388976 16:5393804-5393826 AAAGTTCTGGAGATGGATGGTGG - Intergenic
1133992302 16:10717852-10717874 AAATATCCAGGGAGGGAGAGGGG - Intergenic
1134111863 16:11520145-11520167 AAAGTTCTAGAGATGGAGGGTGG + Intronic
1135203834 16:20464840-20464862 AAAACTCGGGAGATGGATGGTGG + Intronic
1135215171 16:20560098-20560120 AAACTTCGGGAGATGGATGGTGG - Intronic
1135502011 16:23004212-23004234 AAAGTTCTCGAGATGGATGGTGG + Intergenic
1135556315 16:23439753-23439775 AAAGTTCTGGAGATGGATGGTGG + Intronic
1135606348 16:23828418-23828440 AGAGTTCCGGAGATGGATGGTGG - Intergenic
1136476566 16:30517303-30517325 AATTATCCAGGCATGCATGGTGG + Intronic
1136586112 16:31186029-31186051 AAGTATGCAGAGGTGGGTGGGGG + Intronic
1136852161 16:33620716-33620738 AAAGTTTTAGAGATGGATGGTGG + Intergenic
1137390545 16:48077646-48077668 AAATATCTGGAGACGGATGATGG + Intergenic
1137602509 16:49765982-49766004 AGAACTCTAGAGATGGATGGTGG + Intronic
1138636513 16:58343263-58343285 AAAGTTCTGGAGATGGATGGTGG - Intronic
1138639075 16:58368488-58368510 AAAGTTCTAGAGATTGATGGTGG - Intronic
1141138058 16:81479435-81479457 AAAGTTCTGGAGATGGATGGGGG - Intronic
1141196182 16:81863133-81863155 AAAGTTCTGGAGATGGATGGTGG - Intronic
1141557260 16:84844443-84844465 AAAGTGCCAGAGATGGATGGCGG - Intronic
1141642878 16:85351571-85351593 AAATGTTCTGAAATGGATGGTGG + Intergenic
1141643588 16:85355606-85355628 AAAGTTCTAGAAATGGATGGTGG + Intergenic
1203113758 16_KI270728v1_random:1469184-1469206 AAAGTTTTAGAGATGGATGGTGG + Intergenic
1144113321 17:12060901-12060923 AAAGTTCTAGAGATGGATGATGG - Intronic
1144225426 17:13140276-13140298 AAAGAAACAGAGATGGATGGTGG + Intergenic
1144274725 17:13655277-13655299 AAAGTTCTCGAGATGGATGGTGG - Intergenic
1145105045 17:20108094-20108116 AAATTTCTGGAGATGGATGGTGG + Intronic
1145361994 17:22219892-22219914 AAAGTTCTGGAGATGGATGGTGG + Intergenic
1145836526 17:27958312-27958334 AAGCTCCCAGAGATGGATGGTGG - Intergenic
1146250170 17:31333709-31333731 AAGGTTCTAGAGATGGATGGTGG + Intronic
1146511235 17:33450550-33450572 AAAATTCTGGAGATGGATGGTGG + Intronic
1146644447 17:34567791-34567813 AAAGATGCAGCCATGGATGGGGG - Intergenic
1147438055 17:40430088-40430110 AAAGATGCAGGGAAGGATGGGGG + Intergenic
1148840377 17:50492062-50492084 GTATATCCAGAGATGCCTGGAGG - Intergenic
1148877200 17:50696437-50696459 AAAAACCCAGAGATGTATGAAGG + Intronic
1149515281 17:57276535-57276557 AAATATGCAGAGAAAGATAGAGG + Intronic
1149663518 17:58349918-58349940 AAAGTTCTGGAGATGGATGGTGG + Intronic
1150297590 17:64021435-64021457 AGAGCTCCAGAGATGGATGGTGG - Intergenic
1151847398 17:76666907-76666929 AAAGTTCTGGAGATGGATGGTGG - Intergenic
1151885255 17:76919843-76919865 AGAAATCTGGAGATGGATGGTGG - Intronic
1151921321 17:77158253-77158275 AAAGTTCTGGAGATGGATGGTGG - Intronic
1152147871 17:78580001-78580023 GAAGTTCTAGAGATGGATGGTGG + Intergenic
1152393379 17:80016527-80016549 AAAGATCCAGAGCTGGTTGAGGG + Intronic
1152425513 17:80216468-80216490 AAAGTTCTGGAGATGGATGGTGG + Intronic
1152565499 17:81098537-81098559 AAAGTTCTGGAGATGGATGGTGG - Intronic
1153124229 18:1770696-1770718 AAATTTCTGGAGATGGATGGTGG - Intergenic
1153519019 18:5934558-5934580 AAATACCTCTAGATGGATGGAGG - Intergenic
1153772556 18:8427311-8427333 AAAGTTCTGGAGATGGATGGTGG - Intergenic
1154049302 18:10938435-10938457 AAAAATCCGGAGCTAGATGGAGG + Intronic
1154131632 18:11741956-11741978 AAATTTCTGGAGATGGATGGTGG - Intronic
1155013821 18:21811781-21811803 AAAGTTCTAGAGATGGATGGTGG + Intronic
1155025727 18:21938812-21938834 AAACTTCTGGAGATGGATGGTGG + Intergenic
1155149996 18:23115654-23115676 AAAGTTCTAGAGATGGTTGGTGG - Intergenic
1155172311 18:23275998-23276020 AAGATTCCAGAAATGGATGGTGG + Intronic
1155268915 18:24120632-24120654 GAAGTTCCAGAGATGGATGCTGG - Intronic
1155493014 18:26418245-26418267 AAATATTCAGAGATGGCAAGGGG - Intergenic
1155999513 18:32369512-32369534 GAATATATGGAGATGGATGGAGG + Intronic
1157363758 18:47044384-47044406 AATTTTCTGGAGATGGATGGTGG + Intronic
1157670325 18:49523109-49523131 AATGTTCCAGAGATGGATGGTGG - Intergenic
1157713540 18:49866435-49866457 AAAGTTCTCGAGATGGATGGTGG - Intronic
1157812515 18:50707590-50707612 AAAGTTCTGGAGATGGATGGTGG + Intronic
1158056955 18:53292537-53292559 AATTATCCAGGCATGGGTGGTGG + Intronic
1158076733 18:53538698-53538720 GAAGTTCTAGAGATGGATGGTGG + Intergenic
1158149221 18:54348392-54348414 GATTATCCAGAGATGGATTCTGG - Intronic
1158477248 18:57791074-57791096 AAATTTCTAGGGATGGGTGGTGG - Intronic
1158480933 18:57821198-57821220 AAATTTCTGGAGGTGGATGGTGG + Intergenic
1159555818 18:69943378-69943400 AAATATGCAGAGATGACTTGGGG - Intronic
1159903267 18:74067522-74067544 AAGTGTCCAGAGAGTGATGGGGG + Intergenic
1159949181 18:74467663-74467685 AAAGTTCTGGAGATGGATGGTGG - Intergenic
1160378704 18:78432556-78432578 AAAAATCCAGAGAGGGCCGGAGG - Intergenic
1160497690 18:79384731-79384753 AAAGCTCTGGAGATGGATGGTGG + Intergenic
1161360166 19:3844095-3844117 AAAGTTCTGGAGATGGATGGTGG + Intronic
1161366602 19:3883525-3883547 AAATATCCATAGATCCAAGGTGG - Intronic
1161694849 19:5760647-5760669 AAACTTCTGGAGATGGATGGTGG + Intronic
1161928328 19:7318099-7318121 AAAGTTCTGGAGATGGATGGTGG - Intergenic
1161942106 19:7411693-7411715 AAAGTTCTAGAGATGGATGGTGG - Intronic
1161994990 19:7706641-7706663 AAAGTTCCGGAGACGGATGGTGG - Intergenic
1162080515 19:8215072-8215094 AAGCAGCCAGAGCTGGATGGAGG + Intronic
1162425783 19:10594601-10594623 AAAGTTCTGGAGATGGATGGTGG - Intergenic
1162850855 19:13430086-13430108 AAAGTTCTGGAGATGGATGGCGG + Intronic
1163015973 19:14454792-14454814 AAAGTTCTGGAGATGGATGGTGG + Intronic
1163044042 19:14625992-14626014 AAAGTTCCGGAGATGGATGTTGG + Intronic
1164501906 19:28827378-28827400 AAATATCCGGGGATTGGTGGTGG - Intergenic
1164662937 19:29994354-29994376 AAATATCTGGAGATGGATGGTGG - Intronic
1164978711 19:32596003-32596025 AATTAGCCAGGCATGGATGGTGG + Intergenic
1165028722 19:32981829-32981851 AAAGTTTTAGAGATGGATGGTGG - Intronic
1165216524 19:34278114-34278136 AAAGTTCTGGAGATGGATGGTGG - Intronic
1165220508 19:34312379-34312401 AAAGTTCTAGAGATGGATGATGG - Intronic
1165761643 19:38325101-38325123 AAAGTTTTAGAGATGGATGGTGG - Intronic
1166808561 19:45501325-45501347 AGATATCCAAAGATGTATAGTGG + Intronic
1167829194 19:52004691-52004713 AAGTATCAAGATGTGGATGGCGG - Intronic
1168376443 19:55883869-55883891 AAAGTTCTGGAGATGGATGGTGG + Intergenic
1168512680 19:56985986-56986008 ACAGTTCTAGAGATGGATGGCGG - Intergenic
925037328 2:698823-698845 AAATATTCAGAGATAGATCGGGG - Intergenic
925440146 2:3878677-3878699 AAATAGCCACATATGGCTGGTGG + Intergenic
925649786 2:6077591-6077613 AATTATCAAGAGATGTTTGGAGG + Intergenic
925925288 2:8665695-8665717 AAAGTTCCAGAGGTGGATGATGG + Intergenic
926071659 2:9899092-9899114 AAAATTCTAGAGATGGATGGTGG - Intronic
926079467 2:9972715-9972737 AAATATGCAGAACTGGATGCAGG - Intronic
926712618 2:15893843-15893865 AAAGTTCTGGAGATGGATGGTGG + Intergenic
927421671 2:22939805-22939827 TATTAACCAGAGATGGATGTAGG - Intergenic
927704487 2:25288723-25288745 AAAGTTCTGGAGATGGATGGGGG - Intronic
927714998 2:25346050-25346072 AAAGTTCTGGAGATGGATGGCGG + Intergenic
928163972 2:28955952-28955974 AAAGTTCTGGAGATGGATGGTGG - Intergenic
929522554 2:42667338-42667360 AATGTTCCAGAGATGGATGGTGG - Intronic
929580407 2:43078658-43078680 AAAAGTCCGGAGATGGATGGGGG - Intergenic
929738028 2:44572076-44572098 AAAGTTCTAGAGATGGATGGTGG - Intronic
929814871 2:45222707-45222729 AAAGGTCTAGAAATGGATGGTGG + Intergenic
930212487 2:48655783-48655805 AAATTTCTAGAGATGGGTGGTGG - Intronic
930409419 2:51005131-51005153 GAATATCCAGAGAAAGATGTAGG - Intronic
930495295 2:52134217-52134239 AAAGAGCCAGATATTGATGGTGG - Intergenic
930834793 2:55782007-55782029 AGAGTTCTAGAGATGGATGGTGG - Intergenic
931208466 2:60169897-60169919 GAATGTCCAGATATGGATGCAGG + Intergenic
931438350 2:62268503-62268525 AAAGTTCTAGAGATGGATGATGG - Intergenic
931635240 2:64334713-64334735 AAAGTTCTGGAGATGGATGGTGG - Intergenic
932177015 2:69612055-69612077 AAAGTTCTGGAGATGGATGGTGG + Intronic
932291197 2:70581320-70581342 ACAGATACAGAGATGGATGGGGG - Intergenic
932860210 2:75283783-75283805 AAAGATCTGGAGATGGATGGTGG - Intergenic
933866324 2:86521521-86521543 AAAGTTCTGGAGATGGATGGCGG - Intronic
933933906 2:87184468-87184490 ACAGTTCTAGAGATGGATGGTGG - Intergenic
933933912 2:87184543-87184565 ACAGTTCTAGAGATGGATGGTGG - Intergenic
933933918 2:87184618-87184640 ACAGTTCTAGAGATGGATGGTGG - Intergenic
933933924 2:87184693-87184715 ACAGTTCTAGAGATGGATGGTGG - Intergenic
933933930 2:87184768-87184790 ACAGTTCTAGAGATGGATGGTGG - Intergenic
933933936 2:87184843-87184865 ACAGTTCTAGAGATGGATGGTGG - Intergenic
933933942 2:87184918-87184940 ACAGTTCTAGAGATGGATGGTGG - Intergenic
933933948 2:87184993-87185015 ACAGTTCTAGAGATGGATGGTGG - Intergenic
933974824 2:87500641-87500663 AAAGCTCTGGAGATGGATGGTGG + Intergenic
934723524 2:96599318-96599340 AAAGTTCTGGAGATGGATGGTGG + Intronic
935159169 2:100514388-100514410 AATTATCCAGACATGGTTGTGGG - Intergenic
935229418 2:101082831-101082853 AAAGTTCTGGAGATGGATGGTGG + Intronic
935542893 2:104370123-104370145 AAAGTTCTGGAGATGGATGGTGG + Intergenic
935619760 2:105118511-105118533 AAACTTCTGGAGATGGATGGTGG + Intergenic
935661905 2:105474066-105474088 ATAATTCTAGAGATGGATGGAGG - Intergenic
936319001 2:111450172-111450194 AAAGCTCTGGAGATGGATGGTGG - Intergenic
936359195 2:111780902-111780924 ACAGTTCTAGAGATGGATGGTGG + Intronic
936359201 2:111780977-111780999 ACAGTTCTAGAGATGGATGGTGG + Intronic
937030549 2:118735713-118735735 AAAGTTCTGGAGATGGATGGTGG - Intergenic
939309967 2:140463257-140463279 TAATCTCCAGAGAAGGATCGTGG + Intronic
939998602 2:148944257-148944279 AAAGTTCTAGAGATGGAAGGTGG - Intronic
940212747 2:151272991-151273013 AAAGTTCTAGAGATGGATAGTGG + Intronic
940299889 2:152165641-152165663 AAAGCTTCAGAGATGGATGTAGG - Intronic
940399146 2:153226907-153226929 AAATATCCTGAGATGGGAGTTGG + Intergenic
940889217 2:159018578-159018600 AAAGTTCTGGAGATGGATGGTGG - Intronic
941616058 2:167721039-167721061 AGATATACAGAGAGAGATGGGGG - Intergenic
941699435 2:168588340-168588362 AGAGTTCTAGAGATGGATGGTGG - Intronic
943654046 2:190488435-190488457 AAAGTTCTGGAGATGGATGGTGG + Intronic
943687560 2:190834792-190834814 AAAGAGACAGAGAGGGATGGAGG - Intergenic
944588680 2:201196764-201196786 AAAGTTCTGGAGATGGATGGTGG - Intronic
944999998 2:205338925-205338947 AAAAGTCCAGAGATTGGTGGGGG + Intronic
945280975 2:208035224-208035246 AAACATCCAGGGAGGGATGAAGG + Intergenic
946483977 2:220083209-220083231 AAAGATTTAGAGATGGATGGTGG - Intergenic
946493621 2:220173386-220173408 AAAGTTCTGGAGATGGATGGTGG + Intergenic
946786770 2:223254769-223254791 AAATTTCTGGAGATGGATAGTGG - Intergenic
946993687 2:225365960-225365982 AAAGTTCTGGAGATGGATGGTGG - Intergenic
947434161 2:230058552-230058574 AAAGTTCTAAAGATGGATGGTGG + Intronic
947961776 2:234245605-234245627 AAATAACCAGAAATAGAGGGTGG - Intergenic
949037786 2:241825663-241825685 AAAGTTCTGGAGATGGATGGCGG + Intergenic
949082262 2:242111915-242111937 AAAGTTCTAGAGATGGATGGTGG - Intergenic
1169101352 20:2952649-2952671 AAAGTTCCAGAGATGGATGGCGG - Intronic
1169696061 20:8387859-8387881 AAAGTTCTAGAGATGGATGGTGG + Intronic
1169866426 20:10204763-10204785 AGAGTTCTAGAGATGGATGGTGG - Intergenic
1169930781 20:10830636-10830658 AAATATCCATACATGGATGAAGG + Intergenic
1170129576 20:13004512-13004534 ATATATACAGAGATGTATGATGG + Intergenic
1170986035 20:21259867-21259889 AAAGATCTGGAGCTGGATGGTGG - Intergenic
1171001369 20:21419117-21419139 AAAGTTCTGGAGATGGATGGTGG + Intergenic
1171228759 20:23465122-23465144 AAAATTCTAGAGATGGATTGTGG - Intergenic
1172485460 20:35295256-35295278 AGAGTTCTAGAGATGGATGGTGG - Intergenic
1173917217 20:46716667-46716689 AAATAACCACATATGGATGCTGG - Intronic
1174818678 20:53709128-53709150 AAAGTTCTGGAGATGGATGGTGG - Intergenic
1176409238 21:6438846-6438868 AAAGTTCTGGAGATGGATGGTGG - Intergenic
1177138647 21:17333690-17333712 AAAATTCTGGAGATGGATGGTGG + Intergenic
1178040538 21:28635943-28635965 AAATAGCCACAGGTGGCTGGTGG + Intergenic
1178470687 21:32889930-32889952 AAAGTTCTGGAGATGGATGGGGG + Intergenic
1178886462 21:36488710-36488732 AAAGCTCCGGAGAGGGATGGTGG + Intronic
1179191781 21:39128699-39128721 AAAGTTCCAGAGATGGATAATGG - Intergenic
1179505543 21:41837591-41837613 AAAGTTCCACAGATGGATGGGGG + Intronic
1179684733 21:43047168-43047190 AAAGTTCTGGAGATGGATGGTGG - Intergenic
1180841080 22:18959238-18959260 AAATGTCCAGAGATGTCTGGGGG + Intergenic
1180860305 22:19075519-19075541 AAAGTTCTGGAGATGGATGGTGG - Intronic
1181060417 22:20279555-20279577 AAATGTCCAGAGATGTCTGGGGG - Intronic
1181542673 22:23581972-23581994 AAAAATCTAGAAATGGATGGTGG - Intergenic
1181583517 22:23840839-23840861 AAAGTTCTGGAGATGGATGGTGG + Intergenic
1181611614 22:24017414-24017436 AAAGTTCCGGAGATGGATGGTGG - Intronic
1182072272 22:27472106-27472128 AGATGTCCAGAGGTGGAGGGAGG - Intergenic
1182384124 22:29921610-29921632 AAAGTTCTAGAGAAGGATGGTGG - Intronic
1182854810 22:33507613-33507635 AAAGTTCTGGAGATGGATGGTGG + Intronic
1183065342 22:35358851-35358873 AAAGTTCTGGAGATGGATGGTGG + Intergenic
1183141797 22:35948900-35948922 AAAGTTCTGGAGATGGATGGAGG - Intronic
1184016462 22:41789572-41789594 AAAGATCTAGAGATGGATGATGG - Intronic
1184392127 22:44209684-44209706 AAAGTTCTGGAGATGGATGGAGG - Intronic
1184599761 22:45536328-45536350 AAAGTTCTGGAGATGGATGGGGG + Intronic
1185231727 22:49687637-49687659 AGACATCCTGAGATGGAGGGAGG - Intergenic
949576414 3:5343075-5343097 AAAGAGGCAGAGATGGATTGGGG - Intergenic
949956391 3:9272341-9272363 AAAGTTCCTGAGATGGATGGTGG - Intronic
950036470 3:9889618-9889640 AAAGTTCTGGAGATGGATGGTGG - Intergenic
950146382 3:10652992-10653014 AAAGTTCTGGAGATGGATGGTGG + Intronic
950485214 3:13269358-13269380 AAACATCCAGAGAGGGAAAGGGG - Intergenic
950514811 3:13457813-13457835 ACACATTCTGAGATGGATGGTGG + Intergenic
950538653 3:13596643-13596665 AAATTTCTGGAGGTGGATGGTGG - Intronic
950615500 3:14154694-14154716 AGAAATCTGGAGATGGATGGTGG + Intronic
950732207 3:14970415-14970437 AAAGTTCTAGAGATGGATGGTGG - Intronic
951112424 3:18819972-18819994 GAATATCCAGAGATATATAGAGG + Intergenic
951442243 3:22736776-22736798 AAATATCCAGATAATTATGGAGG - Intergenic
952052405 3:29400478-29400500 AAAGTTCTGGAGATGGATGGTGG + Intronic
952456600 3:33478470-33478492 AAATAGCCAGGCATGCATGGTGG + Intergenic
952504063 3:33991684-33991706 AAACATCCAGAGTTGGGTGAGGG + Intergenic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
953695551 3:45155650-45155672 AAAGCTCTGGAGATGGATGGTGG - Intergenic
954049782 3:47964936-47964958 AAAGTTCTGGAGATGGATGGTGG - Intronic
954283914 3:49604302-49604324 AAAGTTCTGGAGATGGATGGTGG - Intronic
954495337 3:50954038-50954060 AAAATTCTAGAGATGGATGGTGG - Intronic
954657011 3:52200254-52200276 AAAGTTCTGGAGATGGATGGTGG - Intronic
954778267 3:53039519-53039541 AAAGTTCTAGAGATGGATGGTGG + Intronic
954887518 3:53889200-53889222 AAACTTCTAGAGGTGGATGGTGG - Intronic
955136931 3:56228292-56228314 GAAGTTCCGGAGATGGATGGTGG - Intronic
955765339 3:62338553-62338575 AAATATCCAGAGATGGATGGTGG + Intergenic
956087647 3:65629837-65629859 AAAGTTCTAGAAATGGATGGCGG + Intronic
956126625 3:66017034-66017056 AAAGTTCTGGAGATGGATGGTGG + Intronic
956775587 3:72562843-72562865 AAATCTCCAGAAATGGAGTGTGG + Intergenic
956889650 3:73599481-73599503 AAAGTTCTGGAGATGGATGGTGG + Intronic
957369037 3:79267063-79267085 AAATATCCACATATGGATAGTGG - Intronic
957410328 3:79831619-79831641 AAATGTCCATCAATGGATGGAGG + Intergenic
957667968 3:83261036-83261058 AAATATTCAGAGACTGCTGGTGG + Intergenic
958959707 3:100497488-100497510 AAATGTCTGGAGATGGATGGTGG - Intronic
959511950 3:107223676-107223698 AATGTTCCAGAGATGGATGATGG + Intergenic
959959180 3:112276793-112276815 AAGAATCCAGGGTTGGATGGTGG + Intronic
959992965 3:112648852-112648874 AAAGTTCTAGAGATGGATAGTGG - Intronic
960996112 3:123341536-123341558 AAAGTTCCAGAGATGGACGGTGG + Intronic
961560900 3:127729369-127729391 AACTATCTAGAGATGGATGATGG - Intronic
961765479 3:129207158-129207180 AAAAGTTCTGAGATGGATGGTGG - Intergenic
961774636 3:129275796-129275818 AAAGTTCTGGAGATGGATGGTGG - Intronic
961918344 3:130400142-130400164 AAAGAACCAGAGATGGAAGATGG - Intronic
963242884 3:143027369-143027391 AAAGTTCTGGAGATGGATGGTGG - Intronic
963738765 3:149053243-149053265 TAATCTCCAGAGTTGGATGAGGG + Intronic
965598382 3:170430691-170430713 AATTAGCCAGGCATGGATGGTGG - Intronic
966697983 3:182812809-182812831 AAAGTTCAAGAGATGGATGGTGG - Intronic
967266672 3:187697887-187697909 AAATATCCACATATGGCTAGTGG + Intergenic
967701929 3:192603456-192603478 AAATATCTAGGGATGTATTGGGG + Intronic
968001031 3:195206944-195206966 AAATATCCACAGAAGGAGAGAGG - Intronic
968200378 3:196748877-196748899 AAAGTTTCGGAGATGGATGGTGG - Intronic
968268279 3:197379421-197379443 AAAGTTCTGGAGATGGATGGTGG - Intergenic
968598740 4:1499174-1499196 GAATATACAGAGGTGGATGGAGG + Intergenic
968819742 4:2841859-2841881 AAAGTTCTGGAGATGGATGGTGG - Intergenic
968888960 4:3356466-3356488 CAACTTCTAGAGATGGATGGTGG - Intronic
969045975 4:4337015-4337037 AAAGCTCTGGAGATGGATGGTGG + Intergenic
969128529 4:4973261-4973283 AAAGTTCTGGAGATGGATGGTGG - Intergenic
969317737 4:6392106-6392128 AAAGTCCCAGAAATGGATGGTGG + Intronic
970109528 4:12622075-12622097 AAATGTCCTGAAATGGAGGGTGG - Intergenic
970574084 4:17410956-17410978 AAACTTCTGGAGATGGATGGTGG + Intergenic
971166491 4:24189208-24189230 ACAGTTCCGGAGATGGATGGTGG + Intergenic
971374240 4:26043700-26043722 AAAGTTCCGGAGATGGATGGTGG - Intergenic
971411376 4:26376214-26376236 AAATTTCTGGAGATGGATGGTGG - Intronic
971592109 4:28481263-28481285 AAATATCCAGATATTCATGAAGG - Intergenic
972012625 4:34203967-34203989 AAATCTTCAGAGCTGGATTGGGG - Intergenic
972422358 4:38900827-38900849 AAAGTTCTGGAGATGGATGGTGG + Intronic
972505112 4:39713645-39713667 AAAGTTCTGGAGATGGATGGTGG - Intronic
972518847 4:39834805-39834827 AAAGTTCTAGAGATGGATGGTGG - Intronic
972586608 4:40443215-40443237 AAAGGTCTGGAGATGGATGGTGG + Intronic
972614303 4:40683469-40683491 AAAGTTCTGGAGATGGATGGTGG - Intergenic
972614362 4:40683936-40683958 AAAGTTCTGGAGATGGATGGTGG - Intergenic
972617435 4:40713284-40713306 AAACATGCAGAGTTGGAGGGAGG + Intergenic
973279835 4:48347702-48347724 AAAGGTCTAGAGATGGATGGTGG - Intronic
973647712 4:52966930-52966952 GGAGTTCCAGAGATGGATGGTGG - Intronic
973705100 4:53573296-53573318 AAATTTCTAGAGATGGATGGTGG + Intronic
973712962 4:53647702-53647724 CAAGATCTAGAGATGGATGGTGG - Intronic
973862845 4:55082965-55082987 ATATATCCAGAGCTCGATGGAGG - Intronic
975208792 4:71675093-71675115 AAAGTTCTGGAGATGGATGGTGG + Intergenic
975634119 4:76429217-76429239 AAAGTTCTGGAGATGGATGGTGG - Intergenic
976006188 4:80432860-80432882 AAAAATCTAGAGTTGGAGGGAGG + Intronic
976171073 4:82304877-82304899 AAAGTTCTGGAGATGGATGGTGG + Intergenic
976185198 4:82436377-82436399 GTATATCAAGAGGTGGATGGAGG + Intronic
976516924 4:85979416-85979438 AAAGCTCTGGAGATGGATGGCGG - Intronic
976637136 4:87297434-87297456 AAAGTTGTAGAGATGGATGGTGG - Intergenic
977240617 4:94564338-94564360 AAAGCTGCAGAGATGGCTGGGGG - Intronic
977953208 4:102998097-102998119 AAAGTTCTGGAGATGGATGGTGG - Intronic
978145607 4:105367538-105367560 AATTATCAAGAGATAGATAGTGG - Intergenic
979056445 4:116000479-116000501 AAAGATCCAGAGTTTAATGGAGG - Intergenic
979245521 4:118499623-118499645 AAAGTTACAGAGATGGATGGTGG - Intergenic
979512903 4:121574296-121574318 ACATATGCAGACATGGAGGGTGG + Intergenic
980506484 4:133730855-133730877 AAATACCCATAGATAGATGTAGG - Intergenic
980719039 4:136668978-136669000 AAATCTCCAGAGAGAGATAGTGG + Intergenic
981545052 4:145885004-145885026 AAAGTTCTGGAGATGGATGGGGG + Intronic
981600196 4:146479677-146479699 AAAGTTACAGAGATGGATGATGG + Intronic
981765335 4:148242104-148242126 AAAGTTCTGGAGATGGATGGTGG + Intronic
981821448 4:148891864-148891886 AAAGTTCTGGAGATGGATGGTGG - Intergenic
981918396 4:150059756-150059778 AAAGTTCTGGAGATGGATGGTGG + Intergenic
981946229 4:150347274-150347296 ACATTTCTAGAGATGGATGGTGG + Intronic
982759516 4:159264680-159264702 AAAGTTCTGGAGATGGATGGCGG - Intronic
983010601 4:162540709-162540731 AAATTTCCAGTGATGGAAGTGGG - Intergenic
983586356 4:169359016-169359038 AAAGTTCTGGAGATGGATGGCGG + Intergenic
984331167 4:178320750-178320772 AAAGTTCTGGAGATGGATGGCGG + Intergenic
984462184 4:180052409-180052431 AAATATCTAGAGATGGATGGTGG + Intergenic
984609289 4:181819594-181819616 AATTTTCCACAGATGGAGGGTGG + Intergenic
984774929 4:183473404-183473426 AAAGTTCCGGAGATGGATGGTGG - Intergenic
984887198 4:184460374-184460396 AAAGTTCTGGAGATGGATGGTGG + Intronic
985067096 4:186133288-186133310 AAACTTCTGGAGATGGATGGCGG - Intronic
986028108 5:3869867-3869889 AAAGTTCTGGAGATGGATGGTGG + Intergenic
986319478 5:6616555-6616577 AGATTTCTGGAGATGGATGGTGG + Intronic
986381350 5:7189467-7189489 AAATCTCCAGGGATGAATGTTGG + Intergenic
986392079 5:7296574-7296596 AAAGTTGTAGAGATGGATGGTGG - Intergenic
987594683 5:19981873-19981895 AATTGTCAAGAGATAGATGGTGG - Intronic
988051565 5:26037618-26037640 AAATATCCAAAGATTCATAGAGG - Intergenic
988446073 5:31287383-31287405 AAATATCCAAAGGTGGATTTTGG - Intronic
988542033 5:32119117-32119139 AAAGTTGCAGGGATGGATGGTGG - Intergenic
990516416 5:56534878-56534900 CATTCTCCAGAGATGGAGGGTGG - Intronic
990806825 5:59672477-59672499 AAATATCCAGAGATTTGAGGAGG - Intronic
990991233 5:61686026-61686048 TAATATACAGAAATGGAAGGAGG - Intronic
991645884 5:68799881-68799903 AAATTCCCAGAGATGGGTGTTGG + Intergenic
992045590 5:72885400-72885422 TAATATACATACATGGATGGGGG + Intronic
992435287 5:76750299-76750321 AAAGTTCTGGAGATGGATGGTGG + Intergenic
992478346 5:77125863-77125885 AAAATTCTGGAGATGGATGGTGG + Intergenic
992577809 5:78137018-78137040 AAAATTCTAGAGATGGATGGTGG - Intronic
992658616 5:78935883-78935905 AAATACCCAGAGAGGGACGTTGG - Intronic
992704379 5:79374260-79374282 AAATATCCTAAAATAGATGGAGG + Exonic
993562459 5:89427926-89427948 AAAACTCCAGAGCTTGATGGTGG + Intergenic
993683238 5:90906002-90906024 ATATATCAAGAGAAGAATGGAGG - Intronic
994946150 5:106394707-106394729 AAAGTTCTGGAGATGGATGGTGG - Intergenic
995164185 5:109018819-109018841 AAATATCCAGAAAACGATGTGGG - Intronic
995495801 5:112741706-112741728 AAATTTCTAGAGATGGGTGGTGG - Intronic
995816567 5:116175929-116175951 AAAAGTCTGGAGATGGATGGTGG + Intronic
996090432 5:119345764-119345786 AAAGTTCTAGAGATGGATAGTGG + Intronic
996190333 5:120533029-120533051 AAACAGCCAGAGATGAAGGGGGG - Intronic
996203717 5:120704270-120704292 AAATGGGCAGCGATGGATGGAGG + Intergenic
996792658 5:127309373-127309395 AAAGTTCTGGAGATGGATGGTGG - Intronic
997109923 5:131063891-131063913 AAAGTTCTGGAGATGGATGGTGG + Intergenic
997260483 5:132462149-132462171 AAAGTTCTGGAGATGGATGGTGG + Exonic
997320690 5:132976014-132976036 AAAGTTCTAGAGATGGATGGTGG + Intergenic
997581799 5:135022282-135022304 AAAGCTCTGGAGATGGATGGTGG - Intergenic
998427087 5:142038039-142038061 AAAATTCTAGAGATGGATGGTGG + Intergenic
998450497 5:142230645-142230667 AAAGTTATAGAGATGGATGGTGG + Intergenic
999082558 5:148857894-148857916 AAATATCCAGAGCTGGGATGTGG + Intergenic
999518913 5:152330339-152330361 AAATCTCTAGAGATGGATCTCGG + Intergenic
999794550 5:154976911-154976933 AAAGTTCTGGAGATGGATGGTGG - Intergenic
1001438566 5:171720152-171720174 TAATATGGAGAGATGGCTGGTGG - Intergenic
1001456362 5:171863419-171863441 AAATATCAGGAGATGGTTGGGGG + Exonic
1001523398 5:172411912-172411934 GAGGTTCCAGAGATGGATGGTGG - Intronic
1001583205 5:172814189-172814211 AAAATTCTGGAGATGGATGGTGG + Intergenic
1001687080 5:173601717-173601739 AAAGTTCTGGAGATGGATGGTGG + Intergenic
1002325264 5:178400631-178400653 AAAGTTCTGGAGATGGATGGTGG - Intronic
1002336469 5:178482511-178482533 AAAGGTTCTGAGATGGATGGTGG + Intronic
1002372311 5:178764989-178765011 AAGTTTCTAGAAATGGATGGTGG - Intergenic
1002607298 5:180390777-180390799 ACATGTCCACAGCTGGATGGTGG + Intergenic
1002762495 6:212744-212766 AACATTCCAGAGATGGATGGTGG + Intergenic
1002882653 6:1266544-1266566 AAAAGCCCAGAGACGGATGGTGG + Intergenic
1003119498 6:3308083-3308105 AAAATTCTAGAAATGGATGGTGG + Intronic
1003135219 6:3429953-3429975 AAATATCTGGAGATGGATGGTGG + Intronic
1003169179 6:3707465-3707487 AAAGTTCTGGAGATGGATGGTGG + Intergenic
1003243121 6:4361618-4361640 AAATGTCTGGAGATGGGTGGTGG - Intergenic
1003259269 6:4502119-4502141 AAATTTCTGGAGATGGATGATGG - Intergenic
1003321118 6:5052636-5052658 AATATTCTAGAGATGGATGGTGG + Intergenic
1003531846 6:6943665-6943687 AAAGTTCTAGAGATAGATGGTGG + Intergenic
1003609675 6:7599331-7599353 AAAGTTCTAGAGATGGATAGAGG + Intronic
1003859175 6:10306409-10306431 AGATTTCAGGAGATGGATGGCGG + Intergenic
1003958385 6:11187309-11187331 AAATAAAGAGAGATGGATTGAGG - Intronic
1004015297 6:11726705-11726727 AAAGTTCTGGAGATGGATGGTGG + Intronic
1004285833 6:14319741-14319763 AAAGTTCTGGAGATGGATGGTGG + Intergenic
1004321119 6:14632458-14632480 AAATACCCAGAGCTGGATGGTGG + Intergenic
1004508936 6:16268772-16268794 AAAGTTCCAGAGATGGATAATGG + Intronic
1004759678 6:18652650-18652672 AAAGTTCTAGCGATGGATGGTGG + Intergenic
1004892517 6:20115025-20115047 ACATATCATGAGATTGATGGAGG + Intronic
1004893325 6:20122708-20122730 AAAGATCTAGAGATAGACGGTGG + Intronic
1005613551 6:27550350-27550372 AAATTTCTGGAGATAGATGGTGG - Intergenic
1006742247 6:36317492-36317514 AAAGACCCAGAGATGGAGGCTGG - Intronic
1007801476 6:44397465-44397487 AAATATTCTGAAATGGTTGGGGG - Intronic
1008428399 6:51385979-51386001 AAATATCCAGAGTGGGCTAGAGG - Intergenic
1008563091 6:52740941-52740963 AAATATCCAAAAACGGAGGGTGG - Intergenic
1008628195 6:53338081-53338103 AAATATCTAAGGGTGGATGGTGG + Intronic
1009908258 6:69894875-69894897 AAATAAACAGTGATGGTTGGGGG + Intronic
1010254460 6:73742103-73742125 AGAGTTACAGAGATGGATGGTGG - Intronic
1010622082 6:78089392-78089414 AAATAGAGAGAGATGGAGGGAGG + Intergenic
1011190510 6:84723081-84723103 AAAGTTCTGGAGATGGATGGTGG - Intronic
1011548746 6:88509251-88509273 AAAGTTCCAGAGATCAATGGTGG + Intergenic
1011555460 6:88567899-88567921 AAAGGTCTGGAGATGGATGGTGG - Intergenic
1011627244 6:89293356-89293378 AAAGTTCTGGAGATGGATGGTGG + Intronic
1011658160 6:89570486-89570508 AAATTTCTGAAGATGGATGGTGG - Intronic
1011659559 6:89582561-89582583 AAAGATCTGGAAATGGATGGTGG - Intronic
1011869424 6:91873853-91873875 AAAGTTCTGGAGATGGATGGTGG + Intergenic
1012165655 6:95947904-95947926 AAATCTCTAGAGATGTATGATGG + Intergenic
1012946825 6:105475204-105475226 AAATTTCTGGAGGTGGATGGTGG - Intergenic
1013350605 6:109302325-109302347 ACATGTCCAGAGATGAATGCTGG - Intergenic
1014145146 6:117988836-117988858 AAAGCTCCAGAGTTGGATGATGG + Intronic
1014212803 6:118723948-118723970 AGAGTTCTAGAGATGGATGGTGG - Intergenic
1014248055 6:119088145-119088167 AAAGGTCCAGAAATGAATGGTGG + Intronic
1014634348 6:123826447-123826469 AAAGTTCTGGAGATGGATGGTGG - Intronic
1015226734 6:130865624-130865646 AACTATCCAAAGATTGATGGCGG - Exonic
1015783080 6:136891791-136891813 AATTAGCCAGGCATGGATGGTGG - Intronic
1015809185 6:137144309-137144331 AAATATTCAGAAATGTATTGGGG - Exonic
1015856638 6:137632118-137632140 AAATTTCCATGGATGGAGGGTGG + Intergenic
1015872174 6:137788339-137788361 AAAATTCTGGAGATGGATGGTGG - Intergenic
1015968743 6:138722101-138722123 AAATACCCACAGATGGATATTGG - Intergenic
1016082424 6:139872066-139872088 AAATGACCAGAGGGGGATGGAGG + Intergenic
1016689498 6:146920204-146920226 AAATATACAGAGATGCATAGGGG - Intergenic
1016757508 6:147702938-147702960 AAATGTCCAGAAATTGAAGGTGG + Intronic
1017132443 6:151119250-151119272 AAAGTTCTGGAGATGGATGGTGG + Intergenic
1017698610 6:157044734-157044756 AAATAGCCACACATGGCTGGTGG - Intronic
1017790919 6:157798711-157798733 AAAAAGCCAGGGATGGATGGTGG + Intronic
1018055094 6:160045453-160045475 AAAGTTCTGGAGATGGATGGTGG - Intronic
1018293521 6:162318001-162318023 AAATTTCTGGAGTTGGATGGTGG - Intronic
1019501209 7:1365574-1365596 AAATATTCAGGAAGGGATGGTGG - Intergenic
1019535574 7:1527922-1527944 AAATTTCTGGAGATGGATGATGG + Intergenic
1020027425 7:4908952-4908974 AAAGTTCTTGAGATGGATGGTGG + Intronic
1020174968 7:5874863-5874885 AAAGTTCTGGAGATGGATGGTGG - Intergenic
1020583965 7:10042242-10042264 AATTATCCAGAGTTGCATGGCGG - Intergenic
1020667703 7:11068588-11068610 AAAGTTCTGGAGATGGATGGTGG + Intronic
1020951197 7:14679927-14679949 AAAAATCCGGAACTGGATGGAGG + Intronic
1021484420 7:21151394-21151416 GGAGTTCCAGAGATGGATGGTGG + Intergenic
1021536575 7:21711965-21711987 ATCCTTCCAGAGATGGATGGTGG - Intronic
1021699433 7:23303129-23303151 AAATTTCTGGAGACGGATGGTGG - Intronic
1021712154 7:23426355-23426377 AAATTGCCAGAAATGGTTGGGGG + Intronic
1022970834 7:35515367-35515389 AAACTTCTAGAGATGGATGGTGG - Intergenic
1023033670 7:36112118-36112140 AAGTATTCAGAGATGCATGAAGG + Intergenic
1023700834 7:42890742-42890764 AAATATCCAGAGATTGCAGGAGG - Intergenic
1024142169 7:46472712-46472734 AAACTTCTGGAGATGGATGGTGG - Intergenic
1024600507 7:50976444-50976466 AAAGTTCTGGAGATGGATGGTGG - Intergenic
1024854898 7:53767160-53767182 AAAGTTCTAGAGATCGATGGTGG - Intergenic
1026421902 7:70247423-70247445 AAATTTCTGGAGCTGGATGGTGG + Intronic
1026767412 7:73169049-73169071 AGAGTTCTAGAGATGGATGGTGG + Intergenic
1027043879 7:74978751-74978773 AGAGTTCTAGAGATGGATGGTGG + Intronic
1027079766 7:75223601-75223623 AGAGTTCTAGAGATGGATGGTGG - Intergenic
1027160474 7:75798793-75798815 TTCTATCAAGAGATGGATGGAGG + Intergenic
1027830263 7:83168004-83168026 AAAAATGCACAGATGGATAGAGG - Intergenic
1028727360 7:94102566-94102588 TAATATTCAGAAATGGATTGAGG - Intergenic
1028835737 7:95373128-95373150 ATATATCCAGTGATAGATAGGGG - Intronic
1029021848 7:97372389-97372411 AAATTTCTGGAGATGGATAGTGG - Intergenic
1029083810 7:97995780-97995802 AAAGTTCTGGAGATGGATGGTGG + Intergenic
1029086909 7:98018976-98018998 AAAGTTCTGGAGATGGATGGTGG - Intergenic
1029388980 7:100262190-100262212 AGAGTTCTAGAGATGGATGGTGG - Intronic
1029561539 7:101306230-101306252 AAAGTTCTGGAGATGGATGGTGG + Intergenic
1030301351 7:107977343-107977365 AAAACCCCTGAGATGGATGGAGG + Intronic
1030622396 7:111804493-111804515 AGAGTTCTAGAGATGGATGGTGG + Intronic
1031542742 7:123015022-123015044 AATTACAGAGAGATGGATGGTGG - Intergenic
1031925044 7:127631003-127631025 AAACTTCTAGAGATGGATGGTGG - Intergenic
1031990472 7:128195082-128195104 AAACATCCAGAGGTGGGGGGAGG - Intergenic
1032059468 7:128712404-128712426 AAAGTTCTGGAGATGGATGGTGG - Intronic
1032150160 7:129422155-129422177 CAATATACAGAAATGGAAGGAGG + Intronic
1032327826 7:130948479-130948501 AAGATTCCAGAGATGGATGATGG + Intergenic
1032492991 7:132338708-132338730 AAATATCAGGAGGTGGATGGTGG + Intronic
1033193367 7:139304392-139304414 TAATATACAGGGATGGAAGGTGG - Exonic
1033383379 7:140846577-140846599 AAATTTCTAGAAATGGATGGTGG + Intronic
1033438870 7:141360354-141360376 AAATATCCTTTGATGCATGGAGG - Intronic
1033442361 7:141391617-141391639 AAAGTTCTGGAGATGGATGGAGG - Intronic
1034083319 7:148300923-148300945 GAATTTCCAGAGATGGGTGGTGG + Intronic
1034213447 7:149384655-149384677 AAATGTCTAGAGATGGATGGTGG + Intergenic
1034300159 7:150008486-150008508 AAATATCCACAGGTGGTTAGAGG + Intergenic
1034805891 7:154088824-154088846 AAATATCCACAGGTGGTTAGAGG - Intronic
1034853097 7:154514480-154514502 AAGGATCTGGAGATGGATGGAGG - Intronic
1034951978 7:155304628-155304650 AAACATCTAGAAATGGTTGGAGG + Intronic
1034969953 7:155412740-155412762 CAATATCCTGACATGGAAGGTGG + Intergenic
1035057823 7:156048014-156048036 AAATTTCTGGAGAGGGATGGTGG + Intergenic
1035211031 7:157328290-157328312 AAATATCCAAAAATGGTTTGGGG - Intergenic
1035228624 7:157447413-157447435 AAAGTTCTGGAGATGGATGGTGG - Intergenic
1035408653 7:158619161-158619183 AAAATTCTAGAGATGGATGGTGG + Intergenic
1035540175 8:428628-428650 AAAGTTCTAGAGATGGATGGTGG - Intronic
1035915875 8:3621501-3621523 AAATTTACAGAGATGAATAGTGG + Intronic
1036153746 8:6323177-6323199 AAAGTTCTGGAGATGGATGGTGG - Intergenic
1036218333 8:6899603-6899625 AAATATCTAGAGATGGATAGTGG - Intergenic
1036695604 8:10972767-10972789 AGACATCTGGAGATGGATGGTGG + Intronic
1036775738 8:11611916-11611938 AAAATTCTGGAGATGGATGGTGG + Intergenic
1036814038 8:11887976-11887998 AAAGTTCTGGAGATGGATGGTGG + Intergenic
1037095993 8:14988837-14988859 AAATATCCAGAAATAAATGAGGG - Intronic
1037123347 8:15316545-15316567 AAAGTTCTGGAGATGGATGGCGG - Intergenic
1037257239 8:16969231-16969253 AACATTCTAGAGATGGATGGTGG + Intergenic
1037736237 8:21569085-21569107 AGAGTTCTAGAGATGGATGGTGG + Intergenic
1037942982 8:22967778-22967800 AAAGTTCTGGAGATGGATGGTGG + Intronic
1039219745 8:35316590-35316612 AACTATTCAGAAATGGAAGGGGG + Intronic
1039481817 8:37879509-37879531 AAAGTTCCGGAGATGGATGGCGG + Intronic
1039493099 8:37962464-37962486 GAATATCCAGAGATGGGGAGAGG + Intergenic
1039652569 8:39358248-39358270 AAAGATGAAGAGATAGATGGTGG + Intergenic
1042073630 8:64964002-64964024 ATAATTCCAGAGATGGATGGTGG + Intergenic
1042547183 8:69961237-69961259 AAAGTTCCAGAGATGGATGGTGG - Intergenic
1043675393 8:82946085-82946107 CAAAATCCAGAGCTGAATGGAGG + Intergenic
1045030549 8:98131196-98131218 AAAGTTCTGGAGATGGATGGTGG - Intronic
1045127646 8:99110618-99110640 AAATAGCCACATATGGCTGGTGG + Intronic
1045180197 8:99772520-99772542 AAAGTTCTAGAGATGGATGGTGG + Intronic
1045774258 8:105783477-105783499 AGAGCTCTAGAGATGGATGGTGG - Intronic
1046262819 8:111792278-111792300 ACATATTCAGAGCTGAATGGAGG + Intergenic
1047503086 8:125457215-125457237 AAAGTTCTGGAGATGGATGGTGG - Intergenic
1048020223 8:130531565-130531587 AGAGTTCTAGAGATGGATGGTGG - Intergenic
1048489299 8:134877680-134877702 AAACTTCCAGAAAAGGATGGTGG + Intergenic
1049031447 8:140041022-140041044 TAATATCCAGGTATGAATGGTGG + Intronic
1049916577 9:323594-323616 AAATTCCTGGAGATGGATGGTGG - Intronic
1050167721 9:2783454-2783476 AAATAGCCAGAAATGGTTGCAGG + Intronic
1051357357 9:16252094-16252116 AAAGGTCTAGAGATGGATGGTGG + Intronic
1051376072 9:16404263-16404285 AAAGTTCTTGAGATGGATGGTGG + Intergenic
1051480953 9:17560050-17560072 AAATGTTCACAGATGGAAGGTGG + Intergenic
1052721406 9:32175274-32175296 ACAGATACAGAGATGGAAGGAGG - Intergenic
1053030734 9:34775442-34775464 AAATTTCTGGATATGGATGGTGG + Intergenic
1053053955 9:34982711-34982733 AAAAATCAAGAGATGGGTAGAGG + Intergenic
1053201704 9:36156516-36156538 AGAATTCTAGAGATGGATGGTGG - Intronic
1054772591 9:69096757-69096779 AAAATTCTGGAGATGGATGGTGG - Intronic
1054886580 9:70205256-70205278 AAAGCTCTGGAGATGGATGGTGG - Intronic
1055353253 9:75411519-75411541 AATAATTAAGAGATGGATGGAGG + Intergenic
1055639313 9:78307130-78307152 AAAGTTCTGGAGATGGATGGTGG - Intronic
1056083715 9:83123895-83123917 AAACTTCTGGAGATGGATGGTGG - Intergenic
1056125707 9:83534946-83534968 AAATTTCCAGACATGGAAAGAGG - Intronic
1056559415 9:87717208-87717230 AAAGTTCTGGAGATGGATGGCGG + Intergenic
1056575379 9:87852398-87852420 AAGTATTCATGGATGGATGGTGG - Intergenic
1056998403 9:91485078-91485100 AAATAGCCACAGATGGCTGGTGG - Intergenic
1057089685 9:92246067-92246089 AAAATTCCTGAGATGGCTGGGGG - Intronic
1057258835 9:93572805-93572827 AATTTTCTGGAGATGGATGGTGG + Intergenic
1057603634 9:96481919-96481941 AAAGTTCTAGAGATGGATGGTGG - Intronic
1057797252 9:98167363-98167385 AGAGTTCTAGAGATGGATGGTGG + Intronic
1057864547 9:98668604-98668626 AAAGTTGTAGAGATGGATGGTGG - Intronic
1057987742 9:99734311-99734333 AAAGTTCTAAAGATGGATGGTGG + Intergenic
1058488839 9:105472795-105472817 TAATATCCAAAGATGTAAGGTGG - Intronic
1059399671 9:114061037-114061059 AAATGCCCAGAGCTGGATGAAGG + Exonic
1059716959 9:116921950-116921972 TAATATCCAGAGCTGGATGTGGG - Intronic
1059957745 9:119535861-119535883 ACATTTCCAGTGCTGGATGGTGG - Intergenic
1060456234 9:123801246-123801268 AAATTTCTGGAGATGGATAGTGG - Intronic
1060475223 9:123981805-123981827 AAAGTTTTAGAGATGGATGGTGG + Intergenic
1061294553 9:129669930-129669952 AAAGTTCTGGAGATGGATGGTGG - Intronic
1061436647 9:130567224-130567246 AAAATTCTGGAGATGGATGGTGG - Intergenic
1061501557 9:131006185-131006207 AAAGGTCTGGAGATGGATGGTGG + Intergenic
1061611137 9:131746780-131746802 AGAGTTCTAGAGATGGATGGTGG + Intergenic
1061713293 9:132502426-132502448 AAAGTTCTTGAGATGGATGGTGG - Intronic
1061770767 9:132919393-132919415 AAATTTCCAGTGATGTATGTTGG - Intronic
1185803430 X:3034344-3034366 AAAGATCTACAGATGGATGCAGG + Intergenic
1185888960 X:3807545-3807567 GAATTTCCAGAGGTGGATGGTGG - Intergenic
1185945538 X:4371712-4371734 AAATATCCTGAGATGGGGAGAGG + Intergenic
1186861012 X:13672577-13672599 AAATCTACAGAGATGGAAAGTGG + Intronic
1187313444 X:18168585-18168607 CAATATAAAGACATGGATGGGGG + Intronic
1187481269 X:19657969-19657991 AAAGTTCTGGAGATGGATGGTGG + Intronic
1187576579 X:20562712-20562734 AAATTTTGGGAGATGGATGGGGG - Intergenic
1187589885 X:20705783-20705805 AAAGTTCTGGAGATGGATGGCGG + Intergenic
1187957544 X:24534566-24534588 AAACTTCTGGAGATGGATGGTGG + Intronic
1188165744 X:26861088-26861110 AAATTTCTAGAGATGGATATTGG + Intergenic
1188930418 X:36102748-36102770 AAATAAACAGAAATTGATGGGGG + Intronic
1189685432 X:43559312-43559334 GAAGTTCTAGAGATGGATGGTGG + Intergenic
1190511006 X:51174425-51174447 AAAGTTCTGGAGATGGATGGTGG + Intergenic
1190753189 X:53380037-53380059 AAATATCCAGAGATTGGGAGAGG + Exonic
1192115013 X:68401749-68401771 CAATAAACAGAGATGTATGGGGG + Intronic
1192331705 X:70180631-70180653 AAAATTCTGGAGATGGATGGTGG - Intronic
1193470878 X:81901736-81901758 AAAGTTCCGAAGATGGATGGTGG - Intergenic
1193730963 X:85102359-85102381 AAATGTCTGGAGATGGATAGTGG + Intronic
1194634116 X:96322948-96322970 CAATATCCAGTGGTGGGTGGAGG + Intergenic
1195719429 X:107852246-107852268 TAATAGACAGAGATGCATGGGGG - Intronic
1195867900 X:109453133-109453155 AAACATCAAGGGATGGATAGGGG + Intronic
1196216311 X:113056080-113056102 AAAAATGCAGAGATGAATGTAGG + Intergenic
1197144084 X:123151654-123151676 AGAGTTCCAGAGATGCATGGTGG + Intergenic
1197231051 X:124004078-124004100 AAAGTTCCAGAGATGGATGGTGG - Intronic
1197740026 X:129884150-129884172 AAAACTCTGGAGATGGATGGTGG - Intergenic
1199712762 X:150482419-150482441 AAAGTTCTGGAGATGGATGGTGG + Intronic
1199763194 X:150921531-150921553 AAAGTTCTGGAGATGGATGGTGG - Intergenic
1199800832 X:151248979-151249001 AAAGCTCTGGAGATGGATGGTGG + Intergenic
1199970782 X:152859308-152859330 AAAGGTTTAGAGATGGATGGTGG - Intronic
1200773106 Y:7145437-7145459 GAATTTCCAGAGATGGATGGTGG + Intergenic
1200826643 Y:7651554-7651576 AAAAATACTGATATGGATGGGGG - Intergenic
1201235665 Y:11908466-11908488 AAATCTGCAGAGAAGGAAGGTGG + Intergenic
1201239196 Y:11941929-11941951 AAAAATTCTGGGATGGATGGTGG + Intergenic
1202298597 Y:23386486-23386508 AAAGTTCTAGAGATGAATGGTGG - Intergenic
1202572211 Y:26284113-26284135 AAAGTTCTAGAGATGAATGGTGG + Intergenic